Skip to main content
SpringerLink
Log in

Abstract Shape Analysis of RNA

  • Protocol
  • First Online:
Book cover RNA Sequence, Structure, and Function: Computational and Bioinformatic Methods

Part of the book series: Methods in Molecular Biology ((MIMB,volume 1097))

Abstract

Abstract shape analysis is a method to learn more about the complete Boltzmann ensemble of the secondary structures of a single RNA molecule. Abstract shapes classify competing secondary structures into classes that are defined by their arrangement of helices. It allows us to compute, in addition to the structure of minimal free energy, a set of structures that represents relevant and interesting structural alternatives. Furthermore, it allows to compute probabilities of all structures within a shape class. This allows to ensure that our representative subset covers the complete Boltzmann ensemble, except for a portion of negligible probability. This chapter explains the main functions of abstract shape analysis, as implemented in the tool RNA shapes. It reports on some other types of analysis that are based on the abstract shapes idea and shows how you can solve novel problems by creating your own shape abstractions.

This is a preview of subscription content, log in via an institution to check access.

Access this chapter

Log in via an institution
Protocol
USD 49.95
Price excludes VAT (USA)
  • Available as PDF
  • Read on any device
  • Instant download
  • Own it forever
eBook
USD 139.00
Price excludes VAT (USA)
  • Available as EPUB and PDF
  • Read on any device
  • Instant download
  • Own it forever
Softcover Book
USD 179.99
Price excludes VAT (USA)
  • Compact, lightweight edition
  • Dispatched in 3 to 5 business days
  • Free shipping worldwide - see info
Hardcover Book
USD 219.99
Price excludes VAT (USA)
  • Durable hardcover edition
  • Dispatched in 3 to 5 business days
  • Free shipping worldwide - see info

Tax calculation will be finalised at checkout

Purchases are for personal use only

Institutional subscriptions

Notes

  1. 1.

    To be concrete, this is gb:X02584.1/1-77,

    GCCAAGGUGGCAGAGUUCGGCCCAACGCAUCCGCCUGCAGAGCGGAACCCCCGCCGGUUCAAAUCCGGCCCUUGGCU.

  2. 2.

    This was observed in 23 cases out of 306 in [23]—so the situation is rare, but real.

  3. 3.

    For the experts in dynamic programming, we remark that this is because there is an exponential number of shapes, and the accumulation of Boltzmann weights does not satisfy Bellman’s Principle of Optimality. We cannot focus on the most likely sub-shapes during the construction of larger shapes.

References

  1. Mathews DH, Sabina J, Zuker M, Turner DH (1999) Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. J Mol Biol 288(5):911–940. ISSN 00222836. DOI 10.1006/jmbi.1999.2700. URL http://dx.doi.org/10.1006/jmbi.1999.2700

  2. Zuker M, Stiegler P (1981) Optimal computer folding of large RNA sequences using thermodynamics and auxiliary information. Nucleic Acids Res 9(1):133–148. ISSN 0305–1048. DOI 10.1093/nar/9.1.133

    Google Scholar 

  3. Markham NR, Zuker M (2008) UNAFold: software for nucleic acid folding and hybridization. Meth Mol Biol (Clifton, NJ) 453:3–31. ISSN 1064–3745. DOI 10.1007/978-1-60327-429-6_1

    Google Scholar 

  4. Hofacker IL, Fontana W, Stadler PF, Bonhoeffer SL, Tacker M, Schuster P (1994) Fast folding and comparison of RNA secondary structures. Monatsh Chem 125:167–188. DOI http://dx.doi.org/10.1007/BF00818163. URL http://dx.doi.org/10.1007/BF00818163

    Google Scholar 

  5. Reuter J, Mathews D (2010) RNAstructure: software for RNA secondary structure prediction and analysis. BMC Bioinformatics 11(1):129. ISSN 1471–2105. DOI 10.1186/1471-2105-11-129. URL http://www.biomedcentral.com/1471-2105/11/129

  6. Giegerich R, Voß B, Rehmsmeier M (2004) Abstract shapes of RNA. Nuclic Acids Res 32(16):4843–4851. DOI 10.1093/nar/gkh779. URL http://nar.oxfordjournals.org/cgi/content/abstract/32/16/4843

    Google Scholar 

  7. Voß B, Giegerich R, Rehmsmeier M (2006) Complete probabilistic analysis of RNA shapes. BMC Biol 4(1):5. ISSN 1741–7007. DOI 10.1186/1741-7007-4-5. URL http://www.biomedcentral.com/1741-7007/4/5

    Google Scholar 

  8. Reeder J, Giegerich R (2009) RNA secondary structure analysis using the RNA shapes package. Wiley. ISBN 9780471250951. DOI 10.1002/0471250953.bi1208s26. URL http://dx.doi.org/10.1002/0471250953.bi1208s26

  9. Steffen P, Voß B, Rehmsmeier M, Reeder J, Giegerich R (2006) RNA shapes: an integrated RNA analysis package based on abstract shapes. Bioinformatics 22(4):500–503. ISSN 1367–4803. URL http://view.ncbi.nlm.nih.gov/pubmed/16357029

    Google Scholar 

  10. Voß B (2006) Structural analysis of aligned RNAs. Nucleic Acids Res 34(19):5471–5481. DOI 10.1093/nar/gkl692. URL http://nar.oxfordjournals.org/content/34/19/5471.abstract

    Google Scholar 

  11. Doshi KJ, Cannone JJ, Cobaugh CW, Gutell RR (2004) Evaluation of the suitability of free-energy minimization using nearest-neighbor energy parameters for RNA secondary structure prediction. BMC Bioinformatics 5. ISSN 1471–2105. DOI 10.1186/1471-2105-5-105. URL http://dx.doi.org/10.1186/1471-2105-5-105

  12. Mathews DH, Turner DH (2006) Prediction of RNA secondary structure by free energy minimization. Curr Opin Struct Biol 16(3):270–278. ISSN 0959–440X. DOI 10.1016/j.sbi.2006.05.010. URL http://dx.doi.org/10.1016/j.sbi.2006.05.010

  13. Meyer IM, Miklós I (2004) Co-transcriptional folding is encoded within RNA genes. BMC Mol Biol 5(1). ISSN 1471–2199. DOI 10.1186/1471-2199-5-10. URL http://dx.doi.org/10.1186/1471-2199-5-10

  14. Mandal M, Breaker RR (2004) Gene regulation by riboswitches. Nat Rev Mol Cell Biol 5(6):451–463

    Article  CAS  PubMed  Google Scholar 

  15. Waldminghaus T, Gaubig LC, Klinkert B, Narberhaus F (2009) The Escherichia coli ibpA thermometer is comprised of stable and unstable structural elements. RNA Biol 6(4):455 – 463. DOI 10.4161/rna.6.4.9014. URL http://www.landesbioscience.com/journals/rnabiology/article/9014/

  16. McCaskill JS (1990) The equilibrium partition function and base pair binding probabilities for RNA secondary structure. Biopolymers 29(6–7):1105–1119. ISSN 0006–3525. DOI 10.1002/bip.360290621. URL http://dx.doi.org/10.1002/bip.360290621

  17. Wuchty S, Fontana W, Hofacker IL, Schuster P (1999) Complete suboptimal folding of RNA and the stability of secondary structures. Biopolymers 49(2):145–165. ISSN 0006–3525. URL http://view.ncbi.nlm.nih.gov/pubmed/99169417

    Google Scholar 

  18. Lorenz R, Bernhart SH, Hoener zu Siederdissen C, Tafer H, Flamm C, Stadler PF, Hofacker IL (2011) ViennaRNA Package 2.0. Algorithms for Molecular Biology 6(1):26. ISSN 1748–7188. DOI 10.1186/1748-7188-6-26 URL http://www.almob.org/content/6/1/26

  19. Ding Y, Lawrence CE (2003) A statistical sampling algorithm for RNA secondary structure prediction. Nuclic Acids Res 31(24):7280–7301. ISSN 1362–4962. DOI 10.1093/nar/gkg938. URL http://dx.doi.org/10.1093/nar/gkg938

  20. Chan CY, Lawrence CE, Ding Y (2005) Structure clustering features on the Sfold Web server. Bioinformatics 21(20):3926–3928. ISSN 1367–4803. DOI 10.1093/bioinformatics/bti632. URL http://dx.doi.org/10.1093/bioinformatics/bti632

    Google Scholar 

  21. Giegerich R, Haase D, Rehmsmeier M (1999) Prediction and visualization of structural switches in RNA. In: Proc. 1999 Pacific Symposium on Biocomputing, pp 126–137. World Scientific, Singapore

    Google Scholar 

  22. Voß B, Meyer C, Giegerich R (2004) Evaluating the predictability of conformational switching in RNA. Bioinformatics 20:1573–1582. URL http://bioinformatics.oupjournals.org/cgi/content/abstract/bth129v1?ct

    Google Scholar 

  23. Janssen S, Schudoma C, Steger G, Giegerich R (2011) Lost in folding space? comparing four variants of the thermodynamic model for RNA secondary structure prediction. BMC Bioinformatics 12(1):429. ISSN 1471–2105. DOI 10.1186/1471-2105-12-429. URL http://www.biomedcentral.com/1471-2105/12/429

  24. Lorenz WA, Ponty Y, Clote P (2008) Asymptotics of RNA shapes. J Comput Biol 15(1):31–63. DOI 10.1089/cmb.2006.0153. URL http://dx.doi.org/10.1089/cmb.2006.0153

    Google Scholar 

  25. Nebel ME, Scheid A (2009) On quantitative effects of RNA shape abstraction. Theory Biosci. 128(4):211–225. ISSN 1431–7613. DOI 10.1007/s12064-009-0074-z. URL http://dx.doi.org/10.1007/s12064-009-0074-z

    Google Scholar 

  26. Brejová B, Brown DG, Vinař T (2007) The most probable annotation problem in HMMs and its application to bioinformatics. J Comput Syst Sci 73(7):1060–1077. DOI http://dx.doi.org/10.1016/j.jcss.2007.03.011

    Google Scholar 

  27. Sauthoff G, Janssen S, Giegerich R (2011) Bellman’s GAP - a declarative language for dynamic programming. In: Proceedings of 13th International ACM SIGPLAN Symposium on Principles and Practice of Declarative Programming, PPDP ’11. ACM. 12:29–40. ISBN 978-1-4503-0776-5. DOI 10.1145/2003476.2003484. URL http://doi.acm.org/10.1145/2003476.2003484

  28. Zehner ZE, Shepherd RK, Gabryszuk J, Fu T-F, Al-Ali M, Holmes WM (1997) RNA-protein interactions within the 3’ untranslated region of vimentin mRNA. Nucleic Acids Res 25(16):3362–3370. DOI 10.1093/nar/25.16.3362. URL http://nar.oxfordjournals.org/content/25/16/3362.abstract

    Google Scholar 

  29. Gardner PP, Daub J, Tate J, Moore BL, Osuch IH, Griffiths-Jones S, Finn RD, Nawrocki EP, Kolbe DL, Eddy SR, Bateman A (2010) Rfam: Wikipedia, clans and the “decimal” release. Nucleic Acids Res. DOI 10.1093/nar/gkq1129. URL http://nar.oxfordjournals.org/content/early/2010/11/08/nar.gkq1129.abstract

  30. Smit S, Rother K, Heringa J, Knight R (2008) From knotted to nested RNA structures: A variety of computational methods for pseudoknot removal. RNA 14(3):410–416. DOI 10.1261/rna.881308. URL http://rnajournal.cshlp.org/content/14/3/410.abstract

  31. Nawrocki EP, Kolbe DL, Eddy SR (2009) Infernal 1.0: inference of RNA alignments. Bioinformatics 25(10):1335–1337. DOI 10.1093/bioinformatics/btp157. URL http://bioinformatics.oxfordjournals.org/content/25/10/1335.abstract

  32. Janssen S, Giegerich R (2010) Faster computation of exact RNA shape probabilities. Bioinformatics 26(5):632–639. DOI 10.1093/bioinformatics/btq014. URL http://bioinformatics.oxfordjournals.org/cgi/content/abstract/26/5/632

    Google Scholar 

  33. Reeder J, Giegerich R (2005) Consensus shapes: an alternative to the Sankoff algorithm for RNA consensus structure prediction. Bioinformatics 21(17):3516–3523. ISSN 1367–4803. URL http://view.ncbi.nlm.nih.gov/pubmed/16020472

  34. Reeder J, Reeder J, Giegerich R (2007) Locomotif: from graphical motif description to RNA motif search. Bioinformatics 23(13):i392. DOI doi:10.1093/bioinformatics/btm179

    Google Scholar 

  35. Macke TJ, Ecker DJ, Gutell RR, Gautheret D, Case DA, Sampath R (2001) RNAMotif, an RNA secondary structure definition and search algorithm. Nucleic Acids Res 29(22):4724–4735. DOI 10.1093/nar/29.22.4724. URL http://nar.oxfordjournals.org/content/29/22/4724.abstract

  36. Janssen S, Reeder J, Giegerich R (2008) Shape based indexing for faster search of RNA family databases. BMC Bioinformatics 9:131. DOI 10.1186/1471-2105-9-131. URL http://dx.doi.org/10.1186/1471-2105-9-131

Download references

Acknowledgment

Many people have contributed to the development of the abstract shapes approach. We gratefully acknowledge the early contributions by Björn Voß, Peter Steffen, Marc Rehmsmeier, and Jens and Janina Reeder.

Author information

Authors and Affiliations

  1. Faculty of Technology and Center of Biotechnology, Bielefeld University, Bielefeld, Germany

    Stefan Janssen & Robert Giegerich

Authors
  1. Stefan Janssen
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Robert Giegerich
    View author publications

    You can also search for this author in PubMed Google Scholar

Editor information

Editors and Affiliations

  1. Center for non-coding RNA in Technology and Health, IKVH University of Copenhagen, Frederiksberg, Denmark

    Jan Gorodkin

  2. University of Washington Dept. Computer Science & Engineering, Seattle, Washington, USA

    Walter L. Ruzzo

Rights and permissions

Reprints and permissions

Copyright information

© 2014 Springer Science+Business Media New York

About this protocol

Cite this protocol

Janssen, S., Giegerich, R. (2014). Abstract Shape Analysis of RNA. In: Gorodkin, J., Ruzzo, W. (eds) RNA Sequence, Structure, and Function: Computational and Bioinformatic Methods. Methods in Molecular Biology, vol 1097. Humana Press, Totowa, NJ. https://doi.org/10.1007/978-1-62703-709-9_11

Download citation

  • DOI: https://doi.org/10.1007/978-1-62703-709-9_11

  • Published:

  • Publisher Name: Humana Press, Totowa, NJ

  • Print ISBN: 978-1-62703-708-2

  • Online ISBN: 978-1-62703-709-9

  • eBook Packages: Springer Protocols

Publish with us

Policies and ethics

Search

Navigation