Key words

1 Introduction

Affinity tags are used on a routine basis to enhance protein expression and facilitate purification of recombinant proteins . The polyhistidine (His) tag is the most commonly used, primarily due to its simplicity of handling and low costs. Other popular affinity tags include glutathione S-transferase (GST) and the maltose binding protein (MBP), which unlike the short His-tag , add a large (~24 and 40 KDa, respectively) and unrelated protein moiety to the fusion protein . Regardless of the tag used for purification, for many applications, the tag must be removed in order to obtain the native protein. Removal of the tag is done primarily by digestion with proteases, such as tobacco etch virus (TEV ), Factor Xa , enterokinase, thrombin , or Sumo [1,2,3]. An additional purification step is needed to separate the protease and non-cleaved protein from the mature cleaved product.

The Profinity eXact™ protein expression and purification system (Bio-Rad) offers an alternative approach, which combines both affinity purification and subsequent on-column cleavage of the tag, thus releasing a tag-free protein. The system is based on the immobilized Subtilisin engineered mutant (S189) protease, which recognizes and binds the engineered affinity tag prodomain of subtilisin fused to the N-terminus of the target protein [4]. Thus the Subtilisin is used as both the affinity ligand and the processing protease. The process includes: I. Cloning the engineered 8.2 kDa subtilisin prodomain at the N-terminus of the target of interest, and expression in bacteria. II. Binding of the fusion protein to the immobilized subtilisin column. III. Washing to remove free contaminants from the column. IV. Cleavage on the column, precisely at the C-terminus of a nine amino acid sequence (EEDKLFKAL) corresponding to the Subtilisin prodomain, in the presence of fluoride anions to release the target protein. The resulting product, produced in a single step, is a purified native protein that lacks any amino acid residues from the Profinity eXact™ tag .

Two commercial vectors, pPAL7 and pPAL8 (Bio-Rad), are available for expression of this tag in E. coli. These two vectors differ only in the codon usage of the tag, whereby the codon sequence in pPAL8 is optimized for E. coli expression. Both vectors utilize the T7 lac promoter for expression in E. coli cells. Any other bacterial or eukaryotic expression vector can be engineered to contain the Profinity eXact™ tag to obtain high expression levels and a simple purification procedure. The tag sequence can be modified, and the codon usage can be further optimized for a given expression system. In certain cases, a small spacer (e.g., Thr–Ser) at the N-terminus of the target protein may enhance the efficiency of tag cleavage. The Profinity eXact™ tag system was used successfully for expression and purification of target proteins in E. coli, resulting in production of homogenous proteins for functional and structural studies [5,6,7,8,9]. This one-step chromatographic purification system provides an easy and rapid process to obtain recombinant native target proteins, avoiding the multiple consecutive chromatographic purification steps usually required with other tags.

Here, we describe in detail the construction of novel expression vectors compatible with the Profinity eXact™ system, containing additional fusion-tags and providing enhanced solubility and expression, and describe the expression and purification process. The Profinity eXact™ system enables efficient binding of the fusion protein to the resin followed by on-column cleavage in one step. However, depending on the target protein sequence and the expression levels, optimization of the binding and cleavage conditions are sometimes necessary. Partial cleavage could occur when non-ideal N-terminal amino acids of the target protein exist adjacent to the cleavage recognition sequence. Following the on-column cleavage, protein contaminants in addition to the native protein may appear. In such a case, additional purification steps would be required.

2 Materials

2.1 Bacterial Strains and DNA Cloning

For all procedures involving DNA cloning and plasmid preparation, the DH5α strain of E. coli (Agilent Technology) is used. For protein expression , E. coli BL21(DE3) (Novagen/EMD Millipore Chemicals) is employed. All materials required for the Restriction Free (RF) and Transfer-PCR (TPCR) cloning procedures, including preparation of competent cells , have been described in detail previously [10,11,12,13] (see Note 1 ).

2.2 Profinity eXact™ Expression Vectors

In initial experiments conducted at the Israel Structural Proteomics Center (ISPC) the vectors provided by Bio-Rad, pPAL7 and the codon-optimized pPAL8 were used. These T7-based vectors occasionally resulted in low protein expression for some of the proteins tested. We therefore constructed a series of expression vectors containing the Profinity eXact™ tag in addition to a 6× His-tag , with or without additional expression-enhancing sequences. The Profinity eXact™ tag was introduced into the previously described vectors [14] harboring glutathione S-transferase (GST) , the β1-domain of the streptococcal protein G (GB1), and thioredoxin (Trx) . The newly established vectors, pET28-Profinity , pETTrx-Profinity , pETGST-Profinity, and pETGB1-Profinity are schematically represented in Fig. 1. Kanamycin was used as a selection marker for all the new expression vectors constructed. Maltose binding protein (MBP) fusion was also established, but testing of the MBP vector is not described in the current study.

Fig. 1
figure 1

Schematic representation of the Profinity eXact™ vectors. The Bio-Rad vectors pPAL7 and pPAL8 harbor only an N-terminal Profinity eXact™ tag (green) followed by a multiple cloning site (MCS, orange). The other vectors were constructed in-house and are based on the pET vector backbone (Novagen) to contain 6× His-tag (marked in red) with or without an additional expression enhancing tag (blue). The components of the expression cassette are not drawn to scale. The MCS and the antibiotic resistance in the Profinity-pET based vectors differ from the ones in pPAL7 and pPAL8 (see Note 4 )

Full size image

2.3 Protein Expression

  1. 1.

    Expression vectors (listed in Fig. 1).

  2. 2.

    High efficiency E. coli BL21 (DE3) competent cells for heat shock or electroporation-mediated transformation (see Note 2 ).

  3. 3.

    Luria–Bertani (LB) liquid medium: Dissolve 20 g of LB broth (Lennox; contains 10 g of tryptone, 5 g of sodium chloride, and 5 g of yeast extract) in 1 L of ultrapure water. Adjust pH to 7.0 using 1 M NaOH and sterilize by autoclaving.

  4. 4.

    30 mg/mL kanamycin stock solution (1000×): Dissolve 300 mg of kanamycin monosulfate powder in 10 mL of ultrapure water. Filter through a 0.2 μm syringe filter and store aliquots of 500 μL–1 mL at −20 °C.

  5. 5.

    0.2 M IPTG (isopropyl-thio-β-d-galactopyranoside) stock solution.

  6. 6.

    250 mL flasks.

  7. 7.

    Temperature-controlled (15–37 °C) shaker.

  8. 8.

    50 mL polypropylene centrifuge tubes.

  9. 9.

    14 mL polypropylene tubes.

  10. 10.

    Benchtop centrifuge.

  11. 11.

    Spectrophotometer.

  12. 12.

    Spectrophotometer cuvettes.

2.4 Cell Extraction, Protein Purification and Analysis

  1. 1.

    Cell-lysis buffer for sonication . Bacteria are lysed in 0.1 M sodium phosphate buffer pH 7.2 with 1 μL/mL protease inhibitor cocktail (Set IV, EMD Chemicals Inc.) (see Note 3 ).

  2. 2.

    Phosphate buffer: Prepared by mixing 360 mL of 0.2 M sodium phosphate dibasic stock solution (Na2HPO4) and 140 mL of 0.2 M sodium phosphate, monobasic, monohydrate stock solution (NaH2PO4.H2O) in a total volume of 1 L of ultrapure water. The buffer was passed through 0.22 μm filter and stored at 4 °C.

  3. 3.

    Sonicator equipped with a micro-tip for 1.5 mL tubes.

  4. 4.

    50 mL centrifuge tubes.

  5. 5.

    RC6 Sorvall floor centrifuge.

  6. 6.

    50 mL polypropylene centrifuge tubes.

  7. 7.

    14 mL polypropylene tubes.

  8. 8.

    Temperature-adjustable microcentrifuge and 1.5 mL tubes.

  9. 9.

    Retort stand and clamps.

  10. 10.

    Rotator (e.g., Intelli-mixer or equivalent).

  11. 11.

    Profinity eXact™ purification resin (Bio-Rad).

  12. 12.

    Econo-Pac® chromatography columns, 1.5 × 12 cm polypropylene column.

  13. 13.

    Column wash and storage buffer: 0.1 M sodium phosphate buffer, pH 7.2.

  14. 14.

    Elution buffer: 0.1 M sodium phosphate buffer pH 7.2, containing 0.1 M Sodium fluoride. To 100 mL of the 0.1 M sodium phosphate buffer (pH 7.2) described above, add 420 mg of sodium fluoride, mix well, and store at 4 °C.

  15. 15.

    Column stripping buffer: 0.1 M phosphoric acid. The buffer was prepared by diluting 6.8 mL of concentrated phosphoric acid (H3PO4, 14.6 M) to a total volume of 1 L with ultrapure water. The buffer is passed 0.22 μm filter and stored at 4 °C.

  16. 16.

    Protein gel electrophoresis system (e.g., Bolt Mini Gel Tank, Novex—Life Technologies or similar).

  17. 17.

    Protein gels (Bolt 4–12% Bis-Tris Plus, Novex—Life Technologies, or similar).

  18. 18.

    Protein running buffer—MES SDS running buffer (× 20 concentrated, Novex—Life Technologies, or similar).

  19. 19.

    InstantBlue™, Coomassie based staining solution for protein gel (Expedeon or equivalent).

  20. 20.

    Gel-doc 2000 visualization system (Bio-Rad Laboratories or similar).

  21. 21.

    Ultrapure water for buffer preparation.

  22. 22.

    Protein sample buffer (SB), 4× concentrated (SB × 4); To make 10 mL of a SB × 4 stock solution: Mix 4.8 mL of 0.5 M Tris–HCl, pH 6.8, 0.8 g of SDS, 4.0 mL of glycerol, 0.4 mL of 14.7 M β-mercaptoethanol and 8 mg of bromophenol blue. Store in aliquots at −20 °C.

  23. 23.

    PageRuler™ Prestained Protein Ladder (Thermo Fisher Scientific).

2.5 Column Regeneration

  1. 1.

    Stripping buffer: 0.1 M phosphoric acid buffer.

  2. 2.

    Storage and wash buffer: 0.1 M sodium phosphate buffer pH 7.2 (0.02% (w/v) sodium azide is added only for long-term storage).

3 Methods

3.1 Establishment of Expression Vectors

Cloning of any gene of interest into the newly established Profinity eXact™ expression vectors can be performed by the Restriction Free (RF) or Transfer-PCR (TPCR) cloning techniques (see Note 1 ). Alternatively, cloning can be performed using restriction enzymes at the multiple cloning sites (MCS) (see Note 4 ), downstream to the Profinity eXact™ cassette. Cloning of the water soluble chlorophyll protein (WSCP) gene into the different Profinity eXact™ expression vectors, pET28-Profinity, pETTrx-Profinity, pETGST-Profinity, and pETGB1-Profinity , resulted in a precise and seamless integration without introduction of unnecessary sequences (see Note 5 ). Nevertheless, integrity of the expression cassettes must be verified by DNA sequencing before proceeding to protein expression .

3.2 Protein Expression

Optimization of protein expression is achieved by changing multiple parameters, including codon optimization, alteration of the induction temperature, expression strain, and the type of solubility tag. Therefore, when a new protein with the Profinity eXact™ tag is tested for expression, an initial screen should be performed using the vectors established in this study. Fig. 2 illustrates a comparative analysis of expression and purification of the WSCP protein using several of the vectors listed in Fig. 1. The solubility enhancing tags (Trx, GST, GB1) increase the yield of the WSCP compared to the pET28-Profinity vector containing only a His-tag (Fig. 2).

  1. 1.

    Transform expression vector into competent BL21(DE3) E. coli cells (see Note 2 ). Following the recovery stage, cells are transferred into a 14 mL tube containing 4 mL of LB plus 30 μg/mL kanamycin for all newly established vectors listed in Fig. 1. Cells are grown overnight for 14–16 h at 37 °C, and are used directly for the expression experiment.

  2. 2.

    The following morning, dilute the culture 1:100, into 250 mL flasks containing 100 mL of fresh LB medium plus 30 μg/mL kanamycin (see Note 6 ).

  3. 3.

    Incubate cultures at 37 °C with shaking until OD600 reaches 0.6–0.8.

  4. 4.

    Induce protein expression with 200 μM IPTG (1:1000 dilution of 0.2 M IPTG stock solution). For each clone, incubate one flask at 37 °C for 3–4 h (see Note 7 ).

  5. 5.

    Harvest cells by centrifugation at 4 °C for 15 min at 12,000 × g.

  6. 6.

    Store cell pellet at −20 °C, or proceed immediately to protein extraction and purification.

Fig. 2
figure 2

Comparison of protein expression using different solubility tags. The Water Soluble Chlorophyll Protein gene (WSCP, amino acids 12–190, NCBI XP_013613804.1) was cloned into each of the vectors listed in Fig. 1 (see Note 5 ). Expression of proteins was performed at 37 °C for 3 h. Cell pellets were processed in parallel, as described in the text. Analysis was performed using Bolt 4–12% Bis-Tris plus gel (Invitrogen). S- Soluble fraction, following cell lysis . E- Elution fraction following cleavage from the Profinity eXact™ tag . Arrow indicates position of the WSCP following cleavage. Asterisk indicates position of the full-length fusion protein in each of the soluble fraction

Full size image

3.3 Protein Extraction , Purification, and Analysis

The buffer constituents used for protein purification using the Profinity eXact™ system should be carefully selected. While certain buffers are recommended for binding and cleavage (see Subheading 2.4), other buffers, and commonly used salts such as NaCl or KCl, must be avoided. Chloride ions act as slower cleavage-triggering ions. In addition, the time and temperature of the reaction should be monitored to ensure complete cleavage. Addition of additives such as 0.5 M l-Arginine was shown to enhance the binding of the protein to the resin and to support efficient cleavage [8]. For some proteins, a small spacer (e.g., Thr–Ser) at the N-terminus of the target protein (+1 and +2 positions) may enhance the cleavage efficiency of the tag. Proline must be avoided at the +1 position, since its presence will inhibit cleavage. Detailed information on reagents that are compatible with the system, and suitable amino acids at the +1 and +2 positions are described in the Profinity eXact™ manual (see Note 8 ). The amount of Profinity eXact™ resin used should be adjusted based on the predicted expression levels, determined in prior small-scale experiments. The amount of the fusion protein expression is expected to vary, depending on properties of the fusion partner (see Note 9 ). The Profinity eXact™ resin may be regenerated multiple times for repeated use. We have used the same resin, following regeneration, for more than 50 different proteins or protein variants, without apparent loss of binding capacity.

3.3.1 Preparation of Chromatography Resin

  1. 1.

    Mix the Profinity eXact™ affinity resin and transfer 2 mL of resin suspension (equivalent to 1 mL of settled beads) to the Bio-Rad Econo-Pac column. When packing the column, inclusion of any air bubbles should be avoided.

  2. 2.

    Equilibrate the column with 15 column volumes (CV) of wash buffer.

3.3.2 Cell Extraction by Sonication

  1. 1.

    Resuspend each cell pellet in 5 mL of sonication lysis buffer (see Subheading 2.4, item 1) and transfer to a 50 mL polypropylene tube.

  2. 2.

    Disrupt the cells on ice, by sonication using a micro-tip. Use 20% amplitude with four intervals of 30 sec ON and 15 s OFF. If the bacterial suspension is not clear, repeat the process (see Note 10 ).

  3. 3.

    Remove cell debris by centrifugation at 4 °C for 40 min at 12,000 × g. Transfer the clear supernatant into a new 15 mL tube.

3.3.3 Protein Purification and Analysis

  1. 1.

    Load the sample slowly into the equilibrated column; hold by clamp on a retort stand. Load without disturbing the resin. Allow the lysate to drain by gravity.

  2. 2.

    Add 10–15 column volumes (CV) of cold wash buffer and allow the buffer to flow through.

  3. 3.

    After washing, leave a small volume (~200–400 μL) of buffer on top of the resin, and tightly close the bottom-tip of the column with a cap. Add 2–3 CV of cold elution buffer and tightly close the top of the column with end-cap.

  4. 4.

    Gently shake the column so that the resin completely mixes with the buffer.

  5. 5.

    Keep the column at 4 °C, in a cold cabinet. Column can be slightly tilted during the incubation.

  6. 6.

    Collect the eluate containing the target protein after incubation for 3–24 h.

  7. 7.

    The eluted samples are analyzed in Bolt protein gels using 1× MES SDS running buffer alongside the pre-stained protein ladder. The voltage is set at 165 and electrophoresis allowed to run for 35 min.

  8. 8.

    The gel is stained using InstantBlue solution and de-stained using tap water.

3.3.4 Resin Regeneration

  1. 1.

    Following the protein cleavage step, wash the resin with 10 CV of wash buffer.

  2. 2.

    Optional step: Wash the column with 3–5 CV of 0.1 M NaOH (see Note 11 ) and then wash the column with 10 CV wash buffer.

  3. 3.

    Strip the column with 10 CV of stripping buffer.

  4. 4.

    Wash the column with 10 CV of wash buffer and store the column at 4 °C with wash buffer including 0.02% (w/v) sodium azide.

4 Notes

  1. 1.

    Restriction Free (RF) and Transfer-PCR (TPCR) cloning techniques are used on a routine basis at the ISPC. RF and TPCR cloning are highly efficient and robust. In addition, using these approaches, cloning can be performed into any vector of choice and at any position, avoiding the need for restriction enzymes. Primer design and reaction conditions are described in detail in our previous publications [10,11,12,13]. In brief, primers (forward and reverse) for the RF or TPCR reactions include at the 5′-end a vector specific sequence (25–30 bases) complementary to the site of integration into the recipient vector, and at the 3′-end a sequence complementary to the gene of interest used for amplification of the gene (Tm 60–70 °C for the gene-specific sequence). Primers up to 60 bases are ordered with only basic desalting purification. Longer primers are purified either by HPLC or SDS-PAGE. An example of primer design for the RF or TPCR reactions is discussed in Note 5 . The RF cloning is a two-stage procedure, in which, in the first stage, a set of mega-primers is generated and purified. In the second stage, the mega-primers are integrated into the destination vector. The generation of the mega-primer is performed using 20 ng of the donor vector and 0.5 μM of the forward and the reverse primers. Following purification of the mega-primer , a typical RF reaction includes 100 ng of mega-primer and 20 ng of destination vector. The TPCR is a single tube reaction in which all reaction components are included in the same tube. On a routine basis for the TPCR reaction, 20 μM of the forward and reverse primers are used in addition to 10 ng of the donor and destination vectors. The same amplification conditions are used for both RF and TPCR reactions: 95 °C for 30 s followed by 30 cycles of 95 °C for 30 s, 60 °C for 1 min, and 72 °C for 5 min. The reaction is continued with a single cycle at 72 °C for 7 min.

  2. 2.

    We found that preparation of competent cells according to a procedure described elsewhere [15] results in highly efficiency transformation . In this procedure, cells are grown at 18 °C prior to harvesting and preparation of the competent cells . Alternatively, BL21(DE3) cells can be transformed by electroporation. For preparation of cells for electroporation, consult the MicroPulser™ Applications Guide from Bio-Rad (http://www.biorad.com/webroot/web/pdf/lsr/literature/4006174B.pdf).

  3. 3.

    For details on buffers and reagents compatible with the Profinity eXact™ resin, consult the Profinity eXact™ instruction manual (http://www.bio-rad.com/webroot/web/pdf/lsr/literature/10011260.pdf). The protease inhibitor cocktail can be omitted from the lysis buffer if the protein is stable.

  4. 4.

    When the new Profinity eXact™ expression vectors (listed in Fig. 1) were established, we did not take into account the use of the unique MCS for cloning. The RF or TPCR methods, which we routinely use for cloning (see Note 1 ) do not rely on the presence of restriction endonuclease sites. However, if one wishes to use restriction enzymes for cloning, combinations of HindIII, which is part of the Profinity eXact tag in pPAL8 (http://www.biorad.com/webroot/web/pdf/lsr/literature/Bulletin_6045.pdf), and NotI or XhoI can be used. These combinations can be used for all the newly established vectors, except for pETGB1-Profinity.

  5. 5.

    For cloning of the WSCP gene into the expression vectors listed in Fig. 1, we designed a set of primers: Forward, TPWSCPProfinityF (5′-GTCGAAGAGGACAAGCTCTTCAAAGCTTTG AGAGAACAGGTGAAGGACTCC) and reverse, TPWSCPProfinityR (5′-GTGGTGGTGGTGGTGGTGCTCG AGTGCGGCCGC TTA AGTAGCATCATCATCAACCTTC). The underlined letters represent the vector-specific sequences, which determine the site of integration and can be added to any specific gene sequence for cloning into the expression vectors listed in Fig. 1. The stop codon is marked in bold in the reverse primer . Italic letters represent WSCP specific sequences. Note that for all the Profinity eXact™ vectors described in this study, a single set of primers is used for establishment of the mega-primer [10,11,12,13].

  6. 6.

    A glycerol stock should be prepared from the selected culture (final glycerol concentration 20–25% (v/v)). The stock should be stored at −80 °C until used.

  7. 7.

    It is highly recommended to optimize protein expression and to perform a small-scale expression screen to determine the optimal expression conditions [14].

  8. 8.

    Based on Bio-Rad data presented in the Profinity eXact™ manual, we cloned a different protein (LvWSCP) into the pETTrx-Profinity expression vector, using two tandem threonine (Thr–Thr) sequences following the Profinity cleavage site [7]. The expression and subsequent purification of the LvWSCP was highly successful, with a yield of about 10 mg/L culture.

  9. 9.

    The binding capacity of the resin was reported to be >3 mg of tag-free protein (for maltose binding protein) per mL resin (http://www.biorad.com/webroot/web/pdf/lsr/literature/Bulletin_5655.pdf).

  10. 10.

    If the proteins need to remain active following extraction, make sure not to overheat the extracts; perform extraction on ice, and when using a micro-tip, do not exceed 40% of the maximal amplitude. When multiple samples are handled simultaneously, a multiple-tip probe is a good option (available from Sonics).

  11. 11.

    The use of 0.1 M NaOH during column regeneration ensures complete removal of contaminants from the resin. This step can be performed, as well, following the stripping stage. The resin should be washed immediately after the NaOH treatment and the stripping step.