Advertisement

Whole-Genome Sequencing of Porcine Epidemic Diarrhea Virus by Illumina MiSeq Platform

  • Leyi WangEmail author
  • Tod Stuber
  • Patrick Camp
  • Suelee Robbe-Austerman
  • Yan ZhangEmail author
Protocol
Part of the Springer Protocols Handbooks book series (SPH)

Abstract

Porcine epidemic diarrhea virus (PEDV) belongs to the genus Alphacoronavirus of the family Coronaviridae. PEDV was identified as an emerging pathogen in US pig populations in 2013. Since then, this virus has been detected in at least 31 states in the USA and has caused significant economic loss to the swine industry. Active surveillance and characterization of PEDV are essential for monitoring the virus. Obtaining comprehensive information about the PEDV genome can improve our understanding of the evolution of PEDV viruses, and the emergence of new strains, and can enhance vaccine designs. In this chapter, both a targeted amplification method and a random-priming method are described to amplify the complete genome of PEDV for sequencing using the MiSeq platform. Overall, this protocol provides a useful two-pronged approach to complete whole-genome sequences of PEDV depending on the amount of virus in the clinical samples.

Key words

Porcine epidemic diarrhea virus Targeted amplification SISPA Whole-genome sequencing MiSeq 

1 Introduction

Complete genome sequencing and genetic analysis significantly improved our understanding of the evolution and relationship of porcine epidemic diarrhea virus (PEDV) strains worldwide. The first PEDV whole-genome sequence was completed for the prototype strain CV777 in 2001 [1]. Since then, several PEDV strains have been sequenced and now over 170 whole-genome sequences have been deposited in GenBank. Based on the phylogenetic analysis of the whole-genome sequence, PEDV has been classified into two Genogroups—1 and 2—which the variant and classical strains of US PEDV belong to, respectively [2].

Since the first 454 FLX pyrosequencing platform was introduced to the market in 2005, next-generation sequencing (NGS) has significantly advanced research in diverse fields. NGS has the advantages of high-throughput and cost-effectiveness. Currently, there are several platforms available, including the Genome Analyser developed by Illumina/Solexa, and the Personal Genome Machine (PGM) by Ion Torrent. One of Illumina NGS platforms—MiSeq—is commonly used in diagnostic laboratories.

In general, sequencing viruses directly from fecal samples for PEDV are technically challenging without prior amplification with specific primers. In this chapter, we describe a useful two-pronged approach where the random-priming method can be used to sequence the complete PEDV genome from samples with Ct values of less than 15, whereas the targeted amplification method is recommended to be used to sequence clinical fecal samples with higher Ct values (low viral loads).

2 Materials

2.1 RNA Extraction from Feces or Intestinal Contents

  1. 1.

    MagMAX Pathogen RNA Kit (Life Technologies) for viral RNA extraction from fecal or intestinal contents (see Note 1 ).

     
  2. 2.

    HBSS (GIBCO).

     

2.2 Real-Time Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) Reaction

  1. 1.

    One-Step RT-PCR kit (Qiagen).

     
  2. 2.

    Smart Cycler II (Cepheid, Sunnyvale CA).

     
  3. 3.

    10 pmol Primers and probes [3] (see Note 2 ).

     

Forward primer: 5′-CATGGGCTAGCTTTCAGGTC-3′.

Reverse primer: 5′-CGGCCCATCACAGAAGTAGT-3′.

Probe: 5′/56-FAM/CATTCTTGGTGGTCT TTCAATCCTGA/ZEN 3IABkFQ/3′.

2.3 Targeted Amplification One-Step RT-PCR

  1. 1.

    One-Step RT-PCR kit (Qiagen) (see Note 3 ).

     
  2. 2.
    Oligonucleotide primers dissolved in nuclease-free water to a stock concentration of 100 pmol/μl and a working concentration of 20 pmol/μl. The sequences for 19 pairs of primers are listed in Table 1.
    Table 1

    Nineteen pairs of primers for whole-genome amplification of PEDV

    Fragment no.

    Sequence

    Sense

    Size

    F1

    ACTTAAAAAGATTTTCTATCTAC

    Forward

    1622

    CGTTAACGATACTAAGAGTGGC

    Reverse

    F2

    TGGTGACCTTGCAAGTGCAGC

    Forward

    1603

    ATTACCAACAGCCTTATTAAGC

    Reverse

    F3

    ACCATTGACCCAGTTTATAAGG

    Forward

    1587

    ACAAAAGCACTTACAGTGGC

    Reverse

    F4

    TACACCTTTGATTAGTGTTGG

    Forward

    1614

    TTTGTAGCGTCTAACTCTAC

    Reverse

    F5

    GTACCAGGTGATCTCAATGTG

    Forward

    1615

    ACGTGGCAATGTCATGGACG

    Reverse

    F6

    ATGCTGCTGTTGCTGAGGCTC

    Forward

    1600

    TCAGTTGAGATAGAGTTGGC

    Reverse

    F7

    GTGACAAGTTCGTAGGCTC

    Forward

    1597

    TAAGTGACAGAACTCACAGG

    Reverse

    F8

    TGCACAAGGTCTTGTTAACATC

    Forward

    1601

    TCTGTGCACCATTAGGAGAATC

    Reverse

    F9

    ACCTGCGTGTAGTCAAGTGG

    Forward

    1599

    GTTACCAGTGGAACACCATC

    Reverse

    F10

    ACTGTGCCAACTTCAATACG

    Forward

    1611

    TCATCAACAAACACACCTGC

    Reverse

    F11

    TGCTCGCAGCATACTATGCAG

    Forward

    1588

    GTGGTGCAGGCAGCTGTTGAG

    Reverse

    F12

    TCTATGTGCACTAATTATGAC

    Forward

    1599

    TGATTGCACAATTCGGCCGC

    Reverse

    F13

    CCATACATGATTGCTTTGTC

    Forward

    1595

    ATCGTCAAGCAGGAGATCC

    Reverse

    F14

    TGTCTAGTAATGATAGCACG

    Forward

    1647

    TTATCCCATGTTATGCCGAC

    Reverse

    F15

    TAATGATGTTACAACAGGTCG

    Forward

    1554

    AAGCCATAGATAGTATACTTG

    Reverse

    F16

    TGAGTTGATTACTGGCACGCC

    Forward

    1598

    GTACTGTATGTAAAAACAGCAG

    Reverse

    F17

    ATCGCAATCTCAGCGTTATG

    Forward

    1596

    GTGTAAACTGCGCTATTACAC

    Reverse

    F18

    CTGCTTATTATAAGCATTAC

    Forward

    1603

    GCTTCTGCTGTTGCTTAAGC

    Reverse

    F19

    AGTCTCGTAACCAGTCCAAG

    Forward

    1065

    TTTTTTTTTTTTGTGTATCCAT

    Reverse

     
  3. 3.

    Qiagen gel purification kit.

     
  4. 4.

    Qubit 2.0 Fluorometer (Life Technologies).

     

2.4 SISPA Method (Sequence-Independent, Single-Primer Amplification)

  1. 1.

    SuperScript III Reverse Transcriptase kit (Invitrogen).

     
  2. 2.

    RNase H treatment (NEB).

     
  3. 3.

    Klenow amplification (NEB).

     
  4. 4.

    Advantage 2 PCR kit (Clontech).

     
  5. 5.

    10 mM dNTP mix (NEB).

     
  6. 6.

    RNase Inhibitor (Promega).

     
  7. 7.
    Oligonucleotide primers [4] dissolved in nuclease-free water to a concentration of 50 μM, 1 μM, and 10 μM for P1, P2, and P3, respectively.
    • P1: GAC CAT CTA GCG ACC TCC ACN NNN NNN N.

    • P2: GAC CAT CTA GCG ACC TCC AC TTT TTTTTTTTTTTTTTT TT.

    • P3: GAC CAT CTA GCG ACC TCC AC.

     
  8. 8.

    QIAquick PCR Purification Kit (Qiagen).

     

2.5 Detection of PCR Products

  1. 1.

    Agarose.

     
  2. 2.

    Distilled water.

     
  3. 3.

    Ethidium bromide.

     
  4. 4.

    1× TAE buffer: 40 mM Tris, 20 mM acetic acid, 1 mM EDTA.

     

2.6 Illumina Nextera DNA Library Preparation

  1. 1.

    Nextera XT Library Prep Kit 96 samples (Box 1 of 2) (Illumina).

     
  2. 2.

    Nextera XT Library Prep Kit 96 samples (Box 2 of 2) (Illumina).

     
  3. 3.

    Nextera XT Index Kit 96 indexes-192 samples.

     
  4. 4.

    Agencourt AMPure XP beads (Beckman Coulter).

     
  5. 5.

    96-well PCR plate (Scientific Inc.).

     
  6. 6.

    96 Deep Well Block (Invitrogen).

     
  7. 7.

    Microseal “B” adhesive seals (BioRad).

     
  8. 8.

    Magnetic plate stand-96 (Life, Technologies).

     
  9. 9.

    Ethanol, 200 proof (Sigma-Aldrich).

     

2.7 Next-Generation Sequencing

  1. 1.

    MiSeqv2 Reagent Kit 500 cycles PE-Box 1 of 2 (Illumina).

     
  2. 2.

    MiSeqv2 Reagent Kit Box 2 of 2 (Illumina).

     
  3. 3.

    MiSeq (Illumina).

     

2.8 Sequence Assembly and Analysis

  1. 1.

    Kraken.

     
  2. 2.

    Krona.

     
  3. 3.

    BWA—Burrows-Wheeler Alignment Tool.

     
  4. 4.

    SAMtools.

     
  5. 5.

    Picard.

     
  6. 6.

    BLAST.

     
  7. 7.

    BioPython.

     
  8. 8.

    GATK—Genome Analysis Toolkit.

     
  9. 9.

    R.

     
  10. 10.

    IGV.

     

3 Methods

3.1 Viral RNA Extraction

  1. 1.

    Fecal or intestinal contents were diluted in HBSS to a final concentration of 20 % and were homogenized by five stainless steel balls followed by a centrifuge step at 2000 RCF at 4 °C for 5 min.

     
  2. 2.

    The supernatant was used for RNA extraction by using the MagMAX Pathogen RNA/DNA Kit (Life Technologies) (see Note 2 ).

     

3.2 Real-Time RT-PCR Reaction

  1. 1.

    Real-time RT-PCR with a 25 μl reaction volume was completed using QIAGEN one-step RT-PCR kit: 5 μl 5× RT-PCR buffer, 0.5 μl forward primer (10 pmol), 0.5 μl reverse primer (10 pmol), 0.5 μl probe (10 pmol), 1 μl dNTP, 1 μl enzyme mix, 0.2 μl RNasin inhibitor (40 Unit/μl, Promega), and RNA temple: 2.5 μl.

     
  2. 2.

    The amplification conditions were 50 °C for 30 min; 95 °C for 15 min; and 45 cycles of 94 °C, 15 s, and 60 °C, 45 s.

     

3.3 One-Step RT-PCR Reaction

  1. 1.

    RT-PCR with a 25 μl reaction volume was completed using QIAGEN one-step RT-PCR kit: 5 μl 5× RT-PCR buffer, 0.8 μl forward primer (20 pmol), 0.8 μl reverse primer (20 pmol) (Table 1), 1 μl dNTP, 1 μl enzyme mix, 0.2 μl RNasin inhibitor (40 Unit/μl, Promega), and RNA temple: 2.5 μl.

     
  2. 2.

    The amplification conditions were 50 °C for 30 min; 95 °C for 15 min; and 45 cycles of 94 °C, 30 s, 54 °C, 30 s, and 72 °C, 1 min 30 s.

     
  3. 3.

    Analyze the PCR products on a 1 % agarose gel and migrate for 1 h at 90 V.

     
  4. 4.

    Excise the correct size bands and perform gel purification with a Qiagen gel purification kit (see Note 4 ).

     
  5. 5.

    Quantify the DNA generated by a fluorescence-based method (Qubit 2.0 Fluorometer) and final amount of DNA input as 1 μg (see Note 5 ).

     

3.4 SISPA Method (See Note 6 )

3.4.1 First-Strand Synthesis

  1. 1.

    1 μl of 50 μM random primer P1; 1 μl of 1 μM oligo dT primer P2; 1 μl 10 mM dNTP mix; 10 pg-5 μg of RNA template. Add water up to 13 μl total volume.

     
  2. 2.

    Incubate the reaction at 65 °C for 5 min and incubate on ice for at least 1 min.

     
  3. 3.

    Add 4 μl 5× first-strand buffer; 1 μl 0.1 M DTT; 1 μl RNase inhibitor; 1 μl of SuperScript III Reverse Transcriptase.

     
  4. 4.

    Incubate the reaction at 25 °C for 5 min, 50 °C for 30–60 min, and 70 °C for 15 min.

     
  5. 5.

    Add 1 μl RNase H (NEB) to the reaction.

     
  6. 6.

    Incubate at 37 °C for 20 min.

     

3.4.2 Klenow Amplification

  1. 1.

    Add 3 μl 10× Klenow reaction buffer; 1 μl of 25 μmol dNTP; and 1 μl of 1 μM random primer P1 to the reaction in Sect. 3.4.1.

     
  2. 2.

    Incubate at 95 °C for 2 min and cool to 4 °C.

     
  3. 3.

    Add 1 μl Klenow fragment (NEB).

     
  4. 4.

    Incubate at 37 °C for 60 min and 75 °C for 20 min.

     

3.4.3 PCR Amplification

  1. 1.

    5 μl 10× Advantage 2 PCR buffer; 1 μl 50× dNTP mix; 2 μl 10 μM barcode primer P3; 1 μl 50× Advantage 2 Polymerase Mix; DNA template from Klenow amplification. Add water up to 50 μl total volume.

     
  2. 2.

    Incubate the reaction using the following PCR program: 1 cycle: 95 °C 5 min; 5 cycles: 95 °C 1 min; 59 °C 1 min; 68 °C 1 min 10 s; 33 cycles: 95 °C 20 s; 59 °C 20 s; 68 °C 1 min 30 s; 1 cycle: 68 °C 10 min.

     
  3. 3.

    Use 5 μl to analyze the PCR products on a 1 % agarose gel and migrate for 1 h at 90 V (see Note 7 ).

     
  4. 4.

    Use QIAquick PCR Purification Kit to purify the remaining 45 μl.

     
  5. 5.

    Quantify the DNA generated by a fluorescence-based method (Qubit 2.0 Fluorometer) and final amount of DNA input as 1 μg.

     

3.5 Library Preparation Using Nextera XT Kit

  1. 1.

    Perform the library preparation based on the Illumina company manual, which includes tagmentation of genomic DNA, PCR amplification, PCR cleanup, library normalization, and final library pooling for MiSeq sequencing.

     

3.6 Sequence Assembly and Analysis

  1. 1.

    Kraken is used to initially identify raw reads and provide a graphical representation of the reads using Krona. A custom Kraken database is used. It was built using the standard database containing all Ref Seq bacteria and virus genomes along with all complete swine enteric coronavirus disease (SECD) genomes available at NCBI and a pig genome.

     
  2. 2.

    Raw reads are run through an in-house custom shell script. In brief, 18 complete genomes from NCBI representing the 4 SECD virus species (TGEV, PRCV, PEDV, and PDCoV) are used as references to align raw reads. A function is looped 3×. This function aligns and removes duplicates, creates a VCF, updates reference with VCF information, and performs a BLAST search against the nt database using the updated reference. Eighteen complete genomes are used to start the initial loop. From this first loop the top hit returned is used as the reference for the next loop. A total of three loops are performed to find the best reference.

     
  3. 3.

    After the best reference has been found, alignment metrics including read counts, mean depth of coverage, and percent of genome with coverage are collected.

     
  4. 4.
    Reports summarizing the alignment metrics (Fig. 1) along with Kraken identification interactive Krona HTML file, a FASTA of assembled genome, and depth of coverage profile graph (Fig. 2) are e-mailed to concerned individuals.
    Fig. 1

    Report summary for sample OH851-RP-Virus. The reference set used to initiate the shell script was SECD (swine enteric coronavirus diseases). File size and read counts for each fastq file are shown. Provided by Kraken, 223,955 virus reads were identified. “Reference used” is the closest finding in the NCBI nt database. The read count shows the number of raw reads shown to match the reference. “Percent cov” shows the percent of reference having coverage. A coverage of 98.36 % for PEDV indicates a true find relative to the sporadic <51 % coverage seen from PRCV, although in this case, the presence of PRCV cannot be ruled out. There were no reads matching TGEV and PDCoV, which were not shown. Because of the high percent of genome coverage, the completed reference-guided assembly for PEDV was BLAST against the nt database to provide mismatches, e-value, and bit score against the most closely related publicly available genome

    Fig. 2

    The depth of coverage profiles for sample OH851-RP-Virus. The x-axis is the genome position. The y-axis is the log depth of coverage. Reads matching any of the four SECD target viral species are shown

     
  5. 5.

    The assembled FASTA file can be visually verified in IGV using the BAM and VCF output from the script. If necessary the FASTA can be corrected in program of choice.

     
  6. 6.

    Script details are provided on GitHub (https://github.com/USDA-VS/public/blob/master/secd/idvirus.sh).

     

4 Notes

  1. 1.

    The MagMAX Pathogen RNA/DNA Kit was used for the extraction of nucleic acid for pathogen detection—including the detection of TGEV, PEDV, and PDCoV—from pig feces or intestinal contents.

     
  2. 2.

    The real-time RT-PCR assay was developed by our laboratory and the primers and probes target the M gene of the virus.

     
  3. 3.

    In our laboratory, the QIAGEN one-step RT-PCR kit has been used to amplify RT-PCR products between 100 bp and 1.8 kb in length.

     
  4. 4.

    Alternatively, 5 μl out of 25 μl could be loaded on the gel to confirm that each target band is amplified and then the remaining 20 μl can be purified by QIAquick PCR Purification Kit.

     
  5. 5.

    A smaller amount of input DNA than the required 1 μg for targeted amplification method could be used to avoid overwhelming sequence reads.

     
  6. 6.

    The SISPA method is recommended when the Ct value of real-time RT-PCR is below 15.

     
  7. 7.

    When 5 μl was applied to the gel, a smear bank can be observed.

     

References

  1. 1.
    Kocherhans R, Bridgen A, Ackermann M, Tobler K (2001) Completion of the porcine epidemic diarrhoea coronavirus (PEDV) genome sequence. Virus Genes 23:137–144CrossRefPubMedGoogle Scholar
  2. 2.
    Wang L, Byrum B, Zhang Y (2014) New variant of porcine epidemic diarrhea virus, United States, 2014. Emerg Infect Dis 20:917–919CrossRefPubMedPubMedCentralGoogle Scholar
  3. 3.
    Wang L, Zhang Y, Byrum B (2014) Development and evaluation of a duplex real-time RT-PCR for detection and differentiation of virulent and variant strains of porcine epidemic diarrhea viruses from the United States. J Virol Methods 207:154–157CrossRefPubMedGoogle Scholar
  4. 4.
    Victoria JG, Kapoor A, Dupuis K, Schnurr DP, Delwart EL (2008) Rapid identification of known and new RNA viruses from animal tissues. PLoS Pathog 4:e1000163CrossRefPubMedPubMedCentralGoogle Scholar

Copyright information

© Springer Science+Business Media New York 2016

Authors and Affiliations

  1. 1.Animal Disease Diagnostic LaboratoryOhio Department of AgricultureReynoldsburgUSA
  2. 2.National Veterinary Services Laboratories, Animal and Plant Health Inspection ServiceUnited States Department of AgricultureAmesUSA

Personalised recommendations