Advertisement

Feline Coronavirus RT-PCR Assays for Feline Infectious Peritonitis Diagnosis

  • Takehisa SomaEmail author
Protocol
  • 675 Downloads
Part of the Springer Protocols Handbooks book series (SPH)

Abstract

Feline infectious peritonitis (FIP) is a highly fatal systemic disease in cats, caused by feline coronavirus (FCoV) infection. FCoV usually has little clinical significance; however, a mutation of this avirulent virus (feline enteric coronavirus) to a virulent type (FIP virus) can lead to FIP incidence. It is difficult to diagnose FIP, since the viruses cannot be distinguished using serological or virological methods. Recently, genetic techniques, such as RT-PCR, have been conducted for FIP diagnosis. In this chapter, the reliability of RT-PCR and procedures used to determine FCoV infection as part of antemortem FIP diagnosis is described.

Key words

Diagnosis Feline coronavirus Feline infectious peritonitis RT-PCR 

1 Introduction

Feline infectious peritonitis (FIP) is an immune-mediated progressive and systemic infectious disease occurring in domestic cats and wild felids, and caused by infection with feline coronavirus (FCoV), a single-stranded RNA virus, which has been classified as Alphacoronavirus along with canine coronavirus (CCoV) and transmissible gastroenteritis virus [1, 2]. FCoV is transmitted by the fecal-oral route and usually causes a mild to inapparent enteritis [2]. FIP is considered to be induced by a virulent mutant (FIP virus; FIPV) of this enteric FCoV (feline enteric coronavirus; FECV) [2, 3]. The incidence of FIP is generally as low as 1–3 % in FCoV-infected cats, though it varies depending on age, breed, environment, and superinfection with other viruses [2, 4, 5, 6].

It is divided into two basic clinical forms, effusive FIP, in which effusion is observed in the body cavity, and non-effusive FIP, in which multiple pyogranuloma lesions are observed, though differences in lesions are influenced by individual immunity [7]. Furthermore, there are two types (I and II) of FCoV, with FCoV type II considered to arise by a recombination of FCoV type I and CCoV [8, 9, 10]. Based on genetic and serological investigations, FCoV type I is overwhelmingly dominant as compared to type II and mixed infection with both types is not rare [11, 12, 13, 14].

Since FIPV and FECV cannot be fully distinguished using serological methods, it is generally difficult to diagnose FIP [1]. Therefore, other laboratory findings such as hematology and serum biochemistry examinations [15, 16] have been referred to FIP diagnosis. Recently, it has been stated that demonstration of FCoV RNA by RT-PCR is one of the most reliable diagnostic indicators of FIP in suspected cases [7, 17]. However, FIPV and FECV are not necessarily distinguished with certainty, and the reliability of RT-PCR for FIP diagnosis depends largely on the test specimens as well as rearing environment of the affected cat.

Test specimens used with FCoV RT-PCR for FIP diagnosis include body cavity fluid (ascitic and pleural effusions), blood, cerebrospinal fluid (CSF), and tissues. As shown in Table 1, effusion is the most suitable, and FCoV RNA detection provides highly sensitive and specific diagnosis [1, 17, 18, 19]. When using CSF, RNA detection can also give a highly specific diagnosis. However, the absence of FIP cannot be generally concluded based on negative results, because small amounts of the virus may exist in CSF from FIP cases [1, 20, 21]. Even in non-FIP and healthy carriers, RNA may be detected in blood for several months after FECV infection [22, 23]. Of note, associated RNA is frequently detected in blood from FCoV-endemic multi-cat households. Thus, the reliability of RT-PCR-positive results obtained from a blood specimen is dependent on the rearing environment [23, 24, 25]. In contrast, FIP may be excluded when a blood specimen is RT-PCR negative, because the RNA detection sensitivity is relatively high with blood from FIP cases [17, 23, 26, 27]. RNA detection sensitivity varies among tissues, i.e., higher in the liver and spleen, and lower in the kidneys and heart [28, 29, 30]. Tissue samples generally contain blood, which compromises the reproducibility of FIP diagnosis with RT-PCR-positive tissues [1, 29].
Table 1

Predictive values of FCoV RT-PCR in FIP diagnosis

Predictive value

Effusion

Blood

CSF

Tissue

Positive (specificity)

High

Valuable

High

Valuable

Negative (sensitivity)

High

Moderate to high

Low

Valuable

In this chapter, three RT-PCR techniques generally employed for FIP diagnosis in Japan are outlined in regard to their usefulness for antemortem diagnosis.

2 Materials

2.1 Primer Set for RT-PCR

Three FCoV RT-PCR primer sets are recommended for FIP diagnosis, as shown in Table 2. One targets the 3′-untranslated region (3′-UTR) (P205–P211 primer set) [17] for FIP screening. This region is the first choice for RT-PCR, because it is highly conserved among Alphacoronavirus and allows sensitive FCoV RNA detection. A second-round (nested) PCR primer set (P276–P204) is also available to check the specificity of the RT-PCR result.
Table 2

Primers for the amplification of FCoV gene

Primer

Sequence (5′–3′)

Orientation

Target

Product size

Reference

P205

GGCAACCCGATGTTTAAAACTGG

Sense

3′-UTR

223 bp

[17]

P211

CACTAGATCCAGACGTTAGCTC

Antisense

P276

CCGAGGAATTACTGGTCATCGCG

Sense

177 bp

P204

GCTCTTCCATTGTTGGCTCGTC

Antisense

212

TAATGCCATACACGAACCAGCT

Sense

M (mRNA)

295 bp

[27]

1179

GTGCTAGATTTGTCTTCGGACACC

Antisense

Iffs

GTTTCAACCTAGAAAGCCTCAGAT

Sense

S

Type I 376 bp

[31]

Type II 283 bp

Icfs

GCCTAGTATTATACCTGACTA

Sense

Iubs

CCACACATACCAAGGCC

Antisense

nIffles

CCTAGAAAGCCTCAGATGAGTG

Sense

Type I 360 bp

Type II 218 bp

nIcfs

CAGACCAAACTGGACTGTAC

Sense

nIubs

CCAAGGCCATTTTACATA

Antisense

To confirm a positive RT-PCR reaction, a subsequent RT-PCR assay is recommended using a primer set that recognizes subgenomic mRNA of the M gene (212–1179 primer set) [27] (Table 2). Since detection of this gene indicates viral replication, FIPV, which has increased microphage infectivity, is able to be detected with high specificity. This RT-PCR technique is more useful for specimens other than effusion samples and CSF. However, in our experience, mRNA detection tends to be less sensitive than 3′-UTR RT-PCR.

To determine the type of cases shown positive with the above RT-PCR assays, a primer set targeting the S gene should be used for a multiplex RT-PCR (Iffs-Icfs-Iubs primer set) (Table 2) [31]. For negative cases shown by RT-PCR, nested PCR should be conducted using nIffle-nIcfs-nIubs primer set (see Note 1 ).

Representative positive reaction bands from these three RT-PCR methods and two nested PCR assays are as shown in Figs. 1 and 2.
Fig. 1

Agarose gel electrophoresis of products obtained by FCoV RT-PCR targeting 3′-UTR and M (mRNA) genes. Lane 1: 3′-UTR RT-PCR (first-round PCR) (223 bp), lane 2: 3′-UTR nested PCR (177 bp), lane 3: M (mRNA) RT-PCR (295 bp), L: 100 bp DNA ladder marker

Fig. 2

Agarose gel electrophoresis of products obtained by FCoV multiplex RT-PCR targeting S gene. Lanes 4–6: RT-PCR (first-round PCR), Lanes 7–9: nested PCR, Lanes 4 and 7: Type I (376 bp and 360 bp, respectively), Lanes 5 and 8: Type II (283 bp and 218 bp, respectively), Lanes 6 and 9: Both type infections,, L: 100 bp DNA ladder marker

2.2 Reagent for FCoV RT-PCR

2.2.1 Extraction and Purification of Viral RNA

  1. 1.

    QIAamp Viral RNA Mini Kit (Qiagen).

     
  2. 2.

    QIAamp Blood RNA Mini Kit (Qiagen).

     
  3. 3.

    RNeasy Mini Kit (Qiagen).

     
  4. 4.

    DNase- and RNase-free water (Invitrogen).

     
  5. 5.

    DNase- and RNase-free ethanol, 99.5 %(V/V) (Wako).

     

2.2.2 RT-PCR

  1. 1.

    Qiagen One-Step RT-PCR kit, containing 5× RT-PCR buffer, enzyme mix, and dNTP mix (10 mM each) (Qiagen).

     
  2. 2.

    RNase inhibitor, 40 U/mL (Promega).

     
  3. 3.

    Primers, 10 μM (shown in Table 2).

     

2.2.3 Second-Round (Nested) PCR

  1. 1.

    DNase- and RNase-free water (invitrogen).

     
  2. 2.

    AmpliTaq Gold DNA polymerase, 5 U/mL, with 10× PCR buffer, MgCl2 solution (25 mM), and dNTP mix (2 mM each) (Applied Biosystems).

     
  3. 3.

    Primers, 10 μM (shown in Table 2).

     

2.2.4 Agarose Gel Electrophoresis

  1. 1.

    Tris-borate-EDTA (TBE) buffer, pH 8.3 (TaKaRa).

     
  2. 2.

    Agarose-LE powder (Ambion).

     
  3. 3.

    6× Gel loading dye, containing bromophenol blue and orange G (Toyobo).

     
  4. 4.

    100 bp DNA ladder marker, with loading dye (Toyobo).

     

2.2.5 EtBr Staining

  1. 1.

    Ethidium bromide (EtBr), 10 mg/mL (invitrogen).

     
  2. 2.

    Distilled water (for diluting EtBr stock solution), not necessarily DNase- and RNase-free water.

     

3 Methods

3.1 RNA Extraction and Purification

Viral RNA is extracted from effusion, serum, plasma, whole blood, cerebrospinal fluid (CSF), and tissue (biopsy) specimens using a QIAamp Viral RNA Mini Kit, QIAamp Blood RNA Mini Kit, or RNeasy Mini Kit (Qiagen), according to the manufacturer’s instructions (see Notes 2 6 ).

3.2 RT-PCR

Next, reaction mixtures for RT-PCR are prepared, as shown in Table 3. Five microliters of the template (purified RNA) is added to the reaction mixture and subjected to amplification in a thermal cycler (Table 4) (see Notes 7 9 ).
Table 3

Reaction mixtures for FCoV RT-PCR

Component

Primer set

P205–P211, 212–1179

Iffs-Icfs-Iubs

DNase-free, RNase-free water

27.8 μL

26.3 μL

5× QIAGEN OneStep RT-PCR Buffer

10.0 μL

10.0 μL

dNTP mix (containing 10 mM of each dNTP)

2.0 μL

2.0 μL

10 μM Primers

1.5 μL each

1.5 μL each

QIAGEN OneStep RT-PCR enzyme mix

2.0 μL

2.0 μL

RNase inhibitor (10 U/μL)

0.2 μL

0.2 μL

Total volume

45.0 μL

45.0 μL

Table 4

Reaction conditions for FCoV RT-PCR

 

Primer set

P205-P211

212–1179

Iffs-Icfs-Iubs

Reverse transcription

50 °C for 30 min

50 °C for 30 min

50 °C for 30 min

Inactivation of reverse transcriptase and denaturation of cDNA template

95 °C for 15 min

95 °C for 15 min

95 °C for 15 min

(Sequential cycle)

(40 cycles)

(30 cycles)

(35 cycles)

Denaturation

94 °C for 50 s

94 °C for 1 min

94 °C for 1 min

Annealing

55 °C for 1 min

62 °C for 1 min

50 °C for 1 min

Extension

72 °C for 1 min

72 °C for 1 min

72 °C for 1 min

Final extension

72 °C for 7 min

72 °C for 7 min

72 °C for 7 min

3.3 Second-Round (Nested) PCR

Reaction mixtures for the nested PCR assay are then prepared, as shown in Table 5. Five microliters of the RT-PCR product diluted 100 times with DNase- and RNase-free water is added to the reaction mixtures, and then subjected to amplification (Table 6) (see Notes 7 9 ).
Table 5

Reaction mixtures for FCoV nested PCR

Component

Primer set

P276–P204

nIffles-nIcfs-nIubs

DNase- and RNase-free water

29.8 μL

27.75 μL

10× PCR buffer (containing no MgCl2)

5.0 μL

5.0 μL

25 mM MgCl2

3.0 μL

4.0 μL

dNTP mix (containing 2 mM of each dNTP)

5.0 μL

5.0 μL

10 μM Primers

1.0 μL each

1.0 μL each

Taq polymerase (5 U/μL)

0.2 μL

0.25 μL

Total volume

45.0 μL

45.0 μL

Table 6

Reaction conditions for FCoV nested PCR

 

Primer set

P276–P204

nIffles-nIcfs-nIubs

Initial denaturation

 

90 °C for 5 min

(Sequential cycle)

(35 cycles)

(35 cycles)

Denaturation

94 °C for 50 sec

94 °C for 1 min

Annealing

55 °C for 1 min

47 °C for 1 min

Extension

72 °C for 1 min

72 °C for 1 min

Final extension

72 °C for 7 min

72 °C for 7 min

3.4 Agarose Gel Electrophoresis

Five microliters of the PCR product is then added to 6× gel loading dye at a 1/6 volume ratio and electrophoresed with TBE buffer at 100 V for 35 min on a 2 % agarose gel at room temperature.

3.5 EtBr Staining

Following electrophoresis, the gel is immersed into 10 mg/mL of EtBr solution. After staining for 30–40 min, the gel is photographed under UV illumination (see Notes 10 12 ).

4 Notes

For FCoV RT-PCR implementation and FIP diagnosis, the following points should be noted.
  1. 1.

    False-negative results may be obtained when no viral RNA is detected with the indicated primers because of viral mutations. This is more likely to occur with primers targeting the S gene.

     
  2. 2.

    Care should be exercised to prevent coagulation of whole blood samples. EDTA is suitable as an anticoagulant, while heparin is not recommended, because it may cause coagulation during transportation.

     
  3. 3.

    Care should be exercised to prevent blood contamination during CSF sampling, as viral RNA may be contained in blood even in non-FIP cases.

     
  4. 4.

    Care should be exercised during sampling and transportation, because RNA is fragile, and disposable DNase- and RNase-free sampling containers should be used. Collected samples should be immediately transported to a laboratory in a refrigerated state.

     
  5. 5.

    DNase- and RNase-free phosphate buffer saline (PBS) should be used to increase sample volume before testing as needed.

     
  6. 6.

    Effusion, serum, and plasma specimens should be centrifuged with a refrigerated centrifuge prior to purification with the QIAamp Viral RNA Mini Kit, and the resulting supernatants should then be purified.

     
  7. 7.

    Reaction mixtures should be prepared and dispensed on ice.

     
  8. 8.

    PCR is highly sensitive and may yield false-positive results when contaminated by even a small amount of nucleic acid. Thus, reaction mixtures should be prepared and dispensed in clean environments, such as a clean bench, and only test results obtained by skilled experimenters are considered to be reliable.

     
  9. 9.

    Only DNase- and RNase-free instruments, such as test tubes and pipette chips, should be used.

     
  10. 10.

    Since EtBr is deactivated by light, its solution should be stored in a light-shielded condition.

     
  11. 11.

    Care should be exercised in handling EtBr for gel staining, because EtBr is toxic to humans. It should be also detoxified in appropriate manners, such as activated carbon adsorption, reductive decomposition, and oxidative decomposition, before disposal. A detoxifying reagent is commercially available (EtBr destroyer, Wako).

     
  12. 12.

    Care should be exercised in regard to UV irradiation during gel observation, as UV may damage eyes and skin.

     

References

  1. 1.
    Addie DD (2012) Feline coronavirus infections. In: Greene CE (ed) Infectious disease of the dog and cat, 4th edn. Saunders Elsevier, St. Louis, pp 92–108Google Scholar
  2. 2.
    Hartmann K (2005) Feline infectious peritonitis. Vet Clin North Am Small Anim Pract 35:39–79CrossRefPubMedGoogle Scholar
  3. 3.
    Vennema H, Poland A, Foley J, Pedersen NC (1998) Feline infectious peritonitis viruses arise by mutation from endemic feline enteric coronaviruses. Virology 30:150–157CrossRefGoogle Scholar
  4. 4.
    Foley JE, Pedersen NC (1996) The inheritance of susceptibility to feline infectious peritonitis in purebred catteries. Feline Pract 24:14–22Google Scholar
  5. 5.
    Pedersen NC (1976) Feline infectious peritonitis: something old, something new. Feline Pract 6:42–51Google Scholar
  6. 6.
    Sparkes AH, Gruffydd-Jones TJ, Howard PE, Harbour DA (1992) Coronavirus serology in healthy pedigree cats. Vet Rec 131:35–36CrossRefPubMedGoogle Scholar
  7. 7.
    Addie D, Belák S, Boucraut-Baralon C et al (2009) Feline infectious peritonitis. ABCD guidelines on prevention and management. J Feline Med Surg 11:594–604CrossRefPubMedGoogle Scholar
  8. 8.
    Herrewegh AAPM, Smeenk I, Horzinek MC, Rottier PJ, de Groot RJ (1998) Feline coronavirus type II strains 79-1683 and 79-1146 originate from a double recombination between feline coronavirus type I and canine coronavirus. J Virol 72:4508–4514PubMedPubMedCentralGoogle Scholar
  9. 9.
    Vennema H, Poland A, Hawkins KF, Pedersen NC (1995) A comparison of the genomes of FECVs and FIPVs and what they tell us about the relationships between feline coronaviruses and their evolution. Feline Pract 23:40–44Google Scholar
  10. 10.
    Terada Y, Matsui N, Noguchi K et al (2014) Emergence of pathogenic coronaviruses in cats by homologous recombination between feline and canine coronaviruses. PLoS One 9:e106534CrossRefPubMedPubMedCentralGoogle Scholar
  11. 11.
    Benetka V, Kubber-Heiss A, Kolodziejek J et al (2004) Prevalence of feline coronavirus types I and II in cats with histopathologically verified feline infectious peritonitis. Vet Microbiol 99:31–42CrossRefPubMedGoogle Scholar
  12. 12.
    Kummrow M, Meli ML, Haessig M et al (2005) Feline coronavirus serotypes 1 and 2: seroprevalence and association with disease in Switzerland. Clin Diagn Lab Immunol 12:1209–1215PubMedPubMedCentralGoogle Scholar
  13. 13.
    Lin CN, Su BL, Wang CH et al (2009) Genetic diversity and correlation with feline infectious peritonitis of feline coronavirus type I and II: 5-year study in Taiwan. Vet Microbiol 136:233–239CrossRefPubMedGoogle Scholar
  14. 14.
    Soma T, Wada M, Taharaguchi S, Tajima T (2013) Detection of ascitic feline coronavirus RNA from cats with clinically suspected feline infectious peritonitis. J Vet Med Sci 75:1389–1392CrossRefPubMedPubMedCentralGoogle Scholar
  15. 15.
    Sparkes AH, Gruffydd-Jones TJ, Harbour DA (1994) An appraisal of the value of laboratory tests in the diagnosis of feline infectious peritonitis. J Am Anim Hosp Assoc 30:345–350Google Scholar
  16. 16.
    Hartmann K, Binder C, Hirschberger J et al (2003) Comparison of different tests to diagnose feline infectious peritonitis. J Vet Intern Med 17:781–790CrossRefPubMedGoogle Scholar
  17. 17.
    Herrewegh AAPM, de Groot RJ, Cepica A et al (1995) Detection of feline coronavirus RNA in feces, tissues, and body fluids of naturally infected cats by reverse transcriptase PCR. J Clin Microbiol 33:684–689PubMedPubMedCentralGoogle Scholar
  18. 18.
    Soma T, Kawashima S, Osada H, Ishii H (2010) Diagnostic value of feline coronavirus PCR testing in clinical cases. J Environ Dis 19:1–7Google Scholar
  19. 19.
    Kennedy MA, Millsaps BRK, Potgieter BLND (1998) Correlation of genomic detection of feline coronavirus with various diagnostic assays for feline infectious peritonitis. J Vet Diagn Invest 10:93–97CrossRefPubMedGoogle Scholar
  20. 20.
    Foley JE, Lapointe JM, Koblik P, Poland A, Pedersen NC (1998) Diagnostic features of clinical neurologic feline infectious peritonitis. J Vet Intern Med 12:415–423CrossRefPubMedGoogle Scholar
  21. 21.
    Doenges SJ, Weber K, Dorsch R, et al Detection of feline coronavirus in cerebrospinal fluid for diagnosis of feline infectious peritonitis in cats with and without neurological signs. J Feline Med Surg Mar 3. pii: 1098612X15574757. [Epub ahead of print]Google Scholar
  22. 22.
    Fehr D, Bolla S, Herrewegh AA, Horzinek MC, Lutz H (1996) Detection of feline coronavirus using RT-PCR: basis for the study of the pathogenesis of feline infectious peritonitis (FIP). Schweiz Arch Tierheilkd 138:74–79PubMedGoogle Scholar
  23. 23.
    Gunn-Moore DA, Gruffydd-Jones TJ, Harbour DA (1998) Detection of feline coronaviruses by culture and reverse transcriptase-polymerase chain reaction of blood samples from healthy cats and cats with clinical feline infectious peritonitis. Vet Microbiol 62:193–205CrossRefPubMedGoogle Scholar
  24. 24.
    Can-Sahna K, Soydal Ataseven V, Pinar D, Oğuzoğlu TC (2007) The detection of feline coronaviruses in blood samples from cats by mRNA RT-PCR. J Feline Med Surg 9:369–372CrossRefPubMedGoogle Scholar
  25. 25.
    Herrewegh AA, Mähler M, Hedrich HJ et al (1997) Persistence and evolution of feline coronavirus in a closed cat-breeding colony. Virology 234:349–363CrossRefPubMedGoogle Scholar
  26. 26.
    Sharif S, Arshad SS, Hair-Bejo M et al (2010) Diagnostic methods for feline coronavirus: a review. Vet Med Int 2010, 809480CrossRefPubMedPubMedCentralGoogle Scholar
  27. 27.
    Simons FA, Vennema H, Rofina JE et al (2005) A mRNA PCR for the diagnosis of feline infectious peritonitis. J Virol Methods 124:111–116CrossRefPubMedGoogle Scholar
  28. 28.
    Pedersen NC, Eckstrand C, Liu H, Leutenegger C, Murphy B (2015) Levels of feline infectious peritonitis virus in blood, effusions, and various tissues and the role of lymphopenia in disease outcome following experimental infection. Vet Microbiol 175:157–166CrossRefPubMedGoogle Scholar
  29. 29.
    Li X, Scott FW (1994) Detection of feline coronaviruses in cell cultures and in fresh and fixed feline tissues using polymerase chain reaction. Vet Microbiol 42(65–77):1994Google Scholar
  30. 30.
    Sharif S, Arshad SS, Hair-Bejo M et al (2011) Evaluation of feline coronavirus viraemia in clinically healthy and ill cats with feline infectious peritonitis. J Anim Vet Adv 10:18–22CrossRefGoogle Scholar
  31. 31.
    Addie DD, Schaap IAT, Nicolson L, Jarrett O (2003) Persistence and transmission of natural type I feline coronavirus infection. J Gen Virol 84:2735–2744CrossRefPubMedGoogle Scholar

Copyright information

© Springer Science+Business Media New York 2016

Authors and Affiliations

  1. 1.Veterinary Diagnostic LaboratoryMarupi Lifetech Co., Ltd.IkedaJapan
  2. 2.Department of Veterinary Internal Medicine, School of Veterinary ScienceOsaka Prefecture UniversityIzumisanoJapan

Personalised recommendations