Skip to main content
SpringerLink
Log in
Book cover

Biomineralization Mechanism of the Pearl Oyster, Pinctada fucata pp 509–573Cite as

Cellular Regulation of Biomineralization in Pinctada fucata

  • Chapter
  • First Online:

  • 407 Accesses

Abstract

Because it is widely recognized that the mantle tissue controls nacre precipitation, intensive studies have been conducted to unravel the regulatory mechanism underlying nacre formation. In this chapter, we will focus on the cellular regulation of shell formation in the pearl oyster Pinctada fucata. First, the morphology and proliferation rate in different parts of the mantle tissue have been investigated, and a proliferation hot spot located in the center of the thinnest mantle region was found. However, mantle tissues mainly composed of the mantle edge were used for primary cell culture, due to their high yield of migrated mantle cells. The primary mantle cell culture is used to study how the mantle cells regulate calcium carbonate precipitation. It was found that the physiological functions of the mantle cells were maintained in vitro. High expression of many shell matrix proteins, including ACCBP, Pif80, and nacrein, and high activities of carbonic anhydrase and alkaline phosphatase were detected. Numerous crystals were found inside the cultured cells by polar light microscopy and scanning electron microscopy, and FTIR and XRD analysis demonstrated that these particles were amorphous calcium carbonate (ACC). What’s more, the cultured mantle cells promoted and regulated calcium carbonate precipitation in the culture dishes. These results showed that mantle cells may directly participate in shell formation. In addition, we have studied the function of hemocytes in shell formation. Hemocytes were identified from P. fucata and found to be present in the extrapallial space (EPS). Many components involved in immunity and calcification were identified by proteomics analysis. Poststimulation of lipopolysaccharide and shell damage, most of the tested immune genes and calcification, was upregulated. Moreover, polar light microscopy, scanning electron microscopy, and energy spectrum showed that some hemocytes carried crystals of calcium carbonate, indicating they participated in both immunity and biomineralization. Our studies elucidated the vital roles of mantle cells and hemocytes in regulating shell growth and nacre formation, which would shed light on the improvement of the cultured pearl quality.

This is a preview of subscription content, log in via an institution.

Chapter
USD   29.95
Price excludes VAT (USA)
  • Available as PDF
  • Read on any device
  • Instant download
  • Own it forever
eBook
USD   169.00
Price excludes VAT (USA)
  • Available as EPUB and PDF
  • Read on any device
  • Instant download
  • Own it forever
Softcover Book
USD   219.99
Price excludes VAT (USA)
  • Compact, lightweight edition
  • Dispatched in 3 to 5 business days
  • Free shipping worldwide - see info
Hardcover Book
USD   219.99
Price excludes VAT (USA)
  • Durable hardcover edition
  • Dispatched in 3 to 5 business days
  • Free shipping worldwide - see info

Tax calculation will be finalised at checkout

Purchases are for personal use only

Learn about institutional subscriptions

References

  1. C. Zhang, R.Q. Zhang, Matrix proteins in the outer shells of molluscs. Mar. Biotechnol. 8, 572–586 (2006). https://doi.org/10.1007/s10126-005-6029-6

    Article  CAS  Google Scholar 

  2. Z. Fang, Q. Feng, Y. Chi, et al., Investigation of cell proliferation and differentiation in the mantle of Pinctada fucata (Bivalve, Mollusca). Mar. Biol. 153, 745–754 (2008)

    Article  Google Scholar 

  3. B. Westermann, H. Schmidtberg, K. Beuerlein, Functional morphology of the mantle of Nautilus pompilius (Mollusca, Cephalopoda). J. Morphol. 264, 277–285 (2005). https://doi.org/10.1002/jmor.10321

    Article  Google Scholar 

  4. T. Takeuchi, K. Endo, Biphasic and dually coordinated expression of the genes encoding major shell matrix proteins in the pearl oyster Pinctada fucata. Mar. Biotechnol. (N.Y.) 8, 52–61 (2006). https://doi.org/10.1007/s10126-005-5037-x

    Article  CAS  Google Scholar 

  5. S. Sudo et al., Structures of mollusc shell framework proteins. Nature 387, 563–564 (1997). https://doi.org/10.1038/42391

    Article  CAS  Google Scholar 

  6. J.M. Poncet et al., In vitro synthesis of proteoglycans and collagen in primary cultures of mantle cells from the nacreous mollusk, Haliotis tuberculata: a new model for study of molluscan extracellular matrix. Mar. Biotechnol. 2, 387–398 (2000)

    CAS  Google Scholar 

  7. I.J. Domart-Coulon, D.C. Elbert, E.P. Scully, P.S. Calimlim, G.K. Ostrander, Aragonite crystallization in primary cell cultures of multicellular isolates from a hard coral, Pocillopora damicornis. Proc. Natl. Acad. Sci. U. S. A. 98, 11885–11890 (2001). https://doi.org/10.1073/pnas.211439698

    Article  CAS  Google Scholar 

  8. C.P. Suja, N. Sukumaran, S. Dharmaraj, Effect of culture media and tissue extracts in the mantle explant culture of abalone, Haliotis varia Linnaeus. Aquaculture 271, 516–522 (2007). https://doi.org/10.1016/j.aquaculture.2007.04.086

    Article  Google Scholar 

  9. N. Gong et al., Characterization of calcium deposition and shell matrix protein secretion in primary mantle tissue culture from the marine pearl oyster Pinctada fucata. Mar. Biotechnol. (N.Y.) 10, 457–465 (2008). https://doi.org/10.1007/s10126-008-9081-1

    Article  CAS  Google Scholar 

  10. B. Rinkevich, Marine invertebrate cell cultures: New millennium trends. Mar. Biotechnol. 7, 429–439 (2005). https://doi.org/10.1007/s10126-004-0108-y

    Article  CAS  Google Scholar 

  11. C.M. Wen, G.H. Kou, S.N. Chen, Establishment of Cell-Lines from the Pacific Oyster. In Vitro Cell Dev-An. 29a, 901–903 (1993)

    Article  CAS  Google Scholar 

  12. D. Sud, D. Doumenc, E. Lopez, C. Milet, Role of water-soluble matrix fraction, extracted from the nacre of Pinctada maxima, in the regulation of cell activity in abalone mantle cell culture (Haliotis tuberculata). Tissue Cell 33, 154–160 (2001). https://doi.org/10.1054/tice.2000.0166

    Article  CAS  Google Scholar 

  13. N.P. Gong et al., Characterization of calcium deposition and shell matrix protein secretion in primary mantle tissue culture from the marine pearl oyster Pinctada fucata. Mar. Biotechnol. 10, 457–465 (2008). https://doi.org/10.1007/s10126-008-9081-1

    Article  CAS  Google Scholar 

  14. S.K. Barik, J.K. Jena, K.J. Ram, CaCO3 crystallization in primary culture of mantle epithelial cells of freshwater pearl mussel. Curr. Sci. India 86, 730–734 (2004)

    CAS  Google Scholar 

  15. T. Samata, H. Somiya, C. Horita, S. Akera, SEM observation of microcrystals developed over black secretion on the cultured tissue of the pearl oyster Pinctada fucata. Fish. Sci. 60, 343–344 (1994)

    Article  CAS  Google Scholar 

  16. Z. Fang, Q.L. Feng, Y.Z. Chi, L.P. Xie, R.Q. Zhang, Investigation of cell proliferation and differentiation in the mantle of Pinctada fucata (Bivalve, Mollusca). Mar. Biol. 153, 745–754 (2008). https://doi.org/10.1007/s00227-007-0851-5

    Article  Google Scholar 

  17. A.S. Mount, A.P. Wheeler, R.P. Paradkar, D. Snider, Hemocyte-mediated shell mineralization in the eastern oyster. Science 304, 297–300 (2004). https://doi.org/10.1126/science.1090506

    Article  CAS  Google Scholar 

  18. S. Li et al., Hemocytes participate in calcium carbonate crystal formation, transportation and shell regeneration in the pearl oyster Pinctada fucata. Fish Shellfish Immunol. 51, 263–270 (2016). https://doi.org/10.1016/j.fsi.2016.02.027

    Article  CAS  Google Scholar 

  19. B. Zaldibar, I. Cancio, I. Marigomez, Circatidal variation in epithelial cell proliferation in the mussel digestive gland and stomach. Cell Tissue Res. 318, 395–402 (2004). https://doi.org/10.1007/s00441-004-0960-0

    Article  CAS  Google Scholar 

  20. K. Okudela, T. Ito, Y. Kameda, N. Nakamura, H. Kitamura, lmmunohistochemical analysis for cell proliferation-related protein expression in small cell carcinoma of the esophagus. Histol. Histopathol. 14, 479–485 (1999)

    CAS  Google Scholar 

  21. A. Machii, K.T. Wada, Some marine invertebrates tissue culture. Invertebrate cell system applications 2, 225–233 (1989)

    Google Scholar 

  22. I. Domart-Coulon, S. Auzoux-Bordenave, D. Doumenc, M. Khalanski, Cytotoxicity assessment of antibiofouling compounds and by-products in marine bivalve cell cultures. Toxicol Vitro 14, 245–251 (2000). https://doi.org/10.1016/S0887-2333(00)00011-4

    Article  CAS  Google Scholar 

  23. N.P. Gong et al., Culture of outer epithelial cells from mantle tissue to study shell matrix protein secretion for biomineralization. Cell Tissue Res. 333, 493–501 (2008). https://doi.org/10.1007/s00441-008-0609-5

    Article  CAS  Google Scholar 

  24. S. Puverel et al., Antibodies against the organic matrix in scleractinians: a new tool to study coral biomineralization. Coral Reefs 24, 149–156 (2005). https://doi.org/10.1007/s00338-004-0456-0

    Article  Google Scholar 

  25. A. Natoli et al., Bio-vaterite formation by glycoproteins from freshwater pearls. Micron 41, 359–366 (2010). https://doi.org/10.1016/j.micron.2010.01.002

    Article  CAS  Google Scholar 

  26. S. Li et al., Morphology and classification of hemocytes in Pinctada fucata and their responses to ocean acidification and warming. Fish Shellfish Immunol. 45, 194–202 (2015). https://doi.org/10.1016/j.fsi.2015.04.006

    Article  CAS  Google Scholar 

  27. N. Koga, Y.Z. Nakagoe, H. Tanaka, Crystallization of amorphous calcium carbonate. Thermochim. Acta 318, 239–244 (1998). https://doi.org/10.1016/S0040-6031(98)00348-7

    Article  CAS  Google Scholar 

  28. S. Castellanos-Martinez, M. Prado-Alvarez, A. Lobo-da-Cunha, C. Azevedo, C. Gestal, Morphologic, cytometric and functional characterization of the common octopus (Octopus vulgaris) hemocytes. Dev. Comp. Immunol. 44, 50–58 (2014). https://doi.org/10.1016/j.dci.2013.11.013

    Article  CAS  Google Scholar 

  29. V. Matozzo et al., First evidence of immunomodulation in bivalves under seawater acidification and increased temperature. PLoS One 7 (2012). ARTN e33820301371/journal.pone.0033820

    Article  CAS  Google Scholar 

  30. J.L. Fernandez-Turiel et al., Strategy for water analysis using ICP-MS. Fresen. J. Anal. Chem. 368, 601–606 (2000). https://doi.org/10.1007/s002160000552

    Article  CAS  Google Scholar 

  31. C. Liu et al., In-depth proteomic analysis of shell matrix proteins of Pinctada fucata. Sci. Rep. 5, 17269 (2015). https://doi.org/10.1038/srep17269

    Article  CAS  Google Scholar 

  32. Tsujii, T. Studies on the mechanism of shell-and pearl-formation in Mollusca. 三重県立大学水産学部紀要 5.1 (1960)

    Google Scholar 

  33. A. Bubel, An electron-microscope investigation of the cells lining the outer surface of the mantle in some marine molluscs. Mar. Biol. 21, 245–255 (1973)

    Article  Google Scholar 

  34. A. Garciagasca, R.I. Ochoabaez, M. Betancourt, Microscopic anatomy of the mantle of the pearl oyster Pinctada-Mazatlanica (Hanley, 1856). J. Shellfish Res. 13, 85–91 (1994)

    Google Scholar 

  35. E. Kniprath, Growth of the Shell-field in Mytilus (Bivalvia). Zool. Scr. 7(1), 119–120 (1978)

    Article  Google Scholar 

  36. T.G. Dix, Histochemistry of mantle and pearl sac secretory cells in Pinctada maxima (Lamellibranchia). Aust. J. Zool. 20, 359–368 (1972)

    Article  CAS  Google Scholar 

  37. M. Morigi et al., Human bone marrow mesenchymal stem cells accelerate recovery of acute renal injury and prolong survival in mice. Stem Cells 26, 2075–2082 (2008). https://doi.org/10.1634/stemcells.2007-0795

    Article  CAS  Google Scholar 

  38. N.L. Leibson, L.T. Frolova, Winter-spring essential reorganization of cell proliferation in the digestive tract epithelia in the mussel Crenomytilus grayanus. Mar. Biol. 118, 471–477 (1994)

    Article  Google Scholar 

  39. R. Hanselmann, R. Smolowitz, Identification of proliferating cells in hard clams. Biol. Bull. 199, 199–200 (2000). https://doi.org/10.2307/1542896

    Article  CAS  Google Scholar 

  40. C.M. Yonge, XV—The digestive diverticula in the Lamellibranchs. Earth Environ. Sci. Trans. R. Soc. Edinb. 54, 703–718 (1926)

    Article  Google Scholar 

  41. R.W. McQuiston, Cyclic activity in the digestive diverticula of Lasaea rubra (Montagu)(Bivalvia: Eulamellibranchia). J. Molluscan Stud. 38, 483–492 (1969)

    Google Scholar 

  42. M.P. Cajaraville, G. Diez, I.A. Marigomez, E. Angulo, Responses of basophilic cells of the digestive gland of mussels to petroleum hydrocarbon exposure. Dis. Aquat. Org. 9, 221–228 (1990). https://doi.org/10.3354/dao009221

    Article  Google Scholar 

  43. L.V. Salvini-Plawen, The structure and function of molluscan digestive systems. The Mollusca 11, 301–379 (1988)

    Google Scholar 

  44. J.D. Icely, J.A. Nott, Digestion and absorption: digestive system and associated organs. Microscopic anatomy of invertebrates 10, 147–201 (1992)

    Google Scholar 

  45. G. Vogt, Life-cycle and functional cytology of the Hepatopancreatic cells of Astacus-Astacus (Crustacea, Decapoda). Zoomorphology 114, 83–101 (1994). https://doi.org/10.1007/Bf00396642

    Article  Google Scholar 

  46. I. Marigomez, X. Lekube, I. Cancio, Immunochemical localisation of proliferating cells in mussel digestive gland tissue. Histochem. J. 31, 781–788 (1999). https://doi.org/10.1023/A:1003950003381

    Article  CAS  Google Scholar 

  47. P.C. Denny, C. Yang, D.K. Klauser, P.A. Denny, Parenchymal-cell proliferation and mechanisms for maintenance of granular duct and acinar cell-populations in adult male-mouse submandibular-gland. Anat. Rec. 235, 475–485 (1993). https://doi.org/10.1002/ar.1092350316

    Article  CAS  Google Scholar 

  48. A.G. Checa, Fabricational morphology of oblique ribs in bivalves. J. Morphol. 254, 195–209 (2002). https://doi.org/10.1002/jmor.10028

    Article  Google Scholar 

  49. G. Pannella, Paleontological Clocks and the History of the Earth’s Rotation. Growth Rhythms and the History of the Earth’s Rotation (Wiley, London, 1975), pp. 253–284

    Google Scholar 

  50. E. Naylor, Crab clockwork: the case for interactive circatidal and circadian oscillators controlling rhythmic locomotor activity of Carcinus maenas. Chronobiol. Int. 13, 153–161 (1996). https://doi.org/10.3109/07420529609012649

    Article  CAS  Google Scholar 

  51. P. Abello, C.G. Warman, E. Naylor, Circatidal moulting rhythm in the shore crab Carcinus maenas. J. Mar. Biol. Assoc. U. K. 77, 277–279 (1997)

    Article  Google Scholar 

  52. G.R. Clark, Periodic Growth and Biological Rhythms in Experimentally Grown Bivalves. Growth Rhythms and The History of the Earth’s Rotation (Wiley, London, 1975), pp. 103–117

    Google Scholar 

  53. B. Schöne, K. Tanabe, D.L. Dettman, S. Sato, Environmental controls on shell growth rates and d 18 O of the shallow-marine bivalve mollusk Phacosoma japonicum in Japan. Mar. Biol. 142, 473–485 (2003)

    Article  Google Scholar 

  54. L.M. Joll, Daily growth rings in juvenile saucer scallops, Amusium balloti (Bernardi). J. Shellfish Res. 7, 73–76 (1988)

    Google Scholar 

  55. G.J. Parsons, S.M.C. Robinson, J.C. Roff, M.J. Dadswell, Daily growth-rates as indicated by valve ridges in Postlarval Giant scallop (Placopecten-Magellanicus) (Bivalvia, Pectinidae). Can. J. Fish. Aquat. Sci. 50, 456–469 (1993). https://doi.org/10.1139/f93-053

    Article  Google Scholar 

  56. I. Thompson, Biological Clocks and Shell Growth in Bivalves. Growth Rhythms and the History of the Earth’s Rotation (Wiley, London, 1975), pp. 149–161

    Google Scholar 

  57. C. Jolly et al., Zonal localization of shell matrix proteins in mantle of Haliotis tuberculata (Mollusca, Gastropoda). Mar. Biotechnol. 6, 541–551 (2004). https://doi.org/10.1007/s10126-004-3129-7

    Article  CAS  Google Scholar 

  58. M. Awaji, A. Machii, Fundamental studies on in vivo and in vitro pearl formation—Contribution of outer epithelial cells of pearl oyster mantle and pearl sacs. Aqua BioSci. Monogr. 4, 1–39 (2011). https://doi.org/10.5047/absm.2011.00401.0001

    Article  Google Scholar 

  59. J. Mitsuhashi, Invertebrate Tissue Culture Methods (Springer, New York, 2002)

    Book  Google Scholar 

  60. H. Miyamoto, F. Miyoshi, J. Kohno, The carbonic anhydrase domain protein nacrein is expressed in the epithelial cells of the mantle and acts as a negative regulator in calcification in the mollusc Pinctada fucata. Zool. Sci. 22, 311–315 (2005). https://doi.org/10.2108/zsj.22.311

    Article  CAS  Google Scholar 

  61. H. Miyamoto et al., A carbonic anhydrase from the nacreous layer in oyster pearls. Proc. Natl. Acad. Sci. U. S. A. 93, 9657–9660 (1996). https://doi.org/10.1073/pnas.93.18.9657

    Article  CAS  Google Scholar 

  62. H. Miyamoto et al., A carbonic anhydrase from the nacreous layer in oyster pearls. Proc. Natl. Acad. Sci. U. S. A. 93, 9657–9660 (1996)

    Article  CAS  Google Scholar 

  63. M. Rousseau, C. Milet, E. Plouguerne, E. Lopez, M. Fouchereau-Peron, Biomineralisation markers during a phase of active growth in pinctada margaritifera. J. Bone Miner. Res. 18, S107–S107 (2003)

    Google Scholar 

  64. M. Rousseau et al., Multiscale structure of sheet nacre. Biomaterials 26, 6254–6262 (2005). https://doi.org/10.1016/j.biomaterials.2005.03.028

    Article  CAS  Google Scholar 

  65. M.A. Crenshaw, The inorganic composition of molluscan extrapallial fluid. Biol. Bull. 143, 506–512 (1972). https://doi.org/10.2307/1540180

    Article  CAS  Google Scholar 

  66. D.E. Jacob et al., Nanostructure, composition and mechanisms of bivalve shell growth. Geochim. Cosmochim. Acta 72, 5401–5415 (2008). https://doi.org/10.1016/j.gca.2008.08.019

    Article  CAS  Google Scholar 

  67. L. Xiang et al., Amorphous calcium carbonate precipitation by cellular biomineralization in mantle cell cultures of Pinctada fucata. PLoS One 9 (2014). UNSP e113150691371/journal.pone.0113150

    Article  Google Scholar 

  68. Y. Miyazaki, T. Nishida, H. Aoki, T. Samata, Expression of genes responsible for biomineralization of Pinctada fucata during development. Comp. Biochem. Phys. B. 155, 241–248 (2010). https://doi.org/10.1016/j.cbpb.2009.11.009

    Article  CAS  Google Scholar 

  69. I.M. Weiss, N. Tuross, L. Addadi, S. Weiner, Mollusc larval shell formation: amorphous calcium carbonate is a precursor phase for aragonite. J. Exp. Zool. 293, 478–491 (2002). https://doi.org/10.1002/jez.90004

    Article  CAS  Google Scholar 

  70. R. Collin, J. Voltzow, Initiation, calcification, and form of larval “archaeogastropod” shells. J. Morphol. 235, 77–89 (1998)

    Article  CAS  Google Scholar 

  71. S. Auzoux-Bordenave et al., Ultrastructure, chemistry and mineralogy of the growing shell of the European abalone Haliotis tuberculata. J. Struct. Biol. 171, 277–290 (2010). https://doi.org/10.1016/j.jsb.2010.05.012

    Article  CAS  Google Scholar 

  72. Z. Ma et al., A novel extrapallial fluid protein controls the morphology of nacre lamellae in the pearl oyster, Pinctada fucata. J. Biol. Chem. 282, 23253–23263 (2007). https://doi.org/10.1074/jbc.M700001200

    Article  CAS  Google Scholar 

  73. E. Beniash, L. Addadi, S. Weiner, Cellular control over spicule formation in sea urchin embryos: A structural approach. J. Struct. Biol. 125, 50–62 (1999). https://doi.org/10.1006/jsbi.1998.4081

    Article  CAS  Google Scholar 

  74. C. McDougall, K. Green, D.J. Jackson, B.M. Degnan, Ultrastructure of the mantle of the gastropod Haliotis asinina and mechanisms of shell regionalization. Cells Tissues Organs 194, 103–107 (2011). https://doi.org/10.1159/000324213

    Article  Google Scholar 

  75. Z.G. Yan et al., In vivo and in vitro biomineralization in the presence of the inner-shell film of pearl oyster. Acta Oceanol. Sin. 30, 87–93 (2011). https://doi.org/10.1007/s13131-011-0094-7

    Article  CAS  Google Scholar 

  76. L. Addadi, D. Joester, F. Nudelman, S. Weiner, Mollusk shell formation: a source of new concepts for understanding biomineralization processes. Chem. Eur. J. 12, 981–987 (2006). https://doi.org/10.1002/chem.200500980

    Article  CAS  Google Scholar 

  77. X. Wang et al., Oyster shell proteins originate from multiple organs and their probable transport pathway to the shell formation front. PLoS One 8, e66522 (2013). https://doi.org/10.1371/journal.pone.0066522

    Article  CAS  Google Scholar 

  78. G. Zhang et al., The oyster genome reveals stress adaptation and complexity of shell formation. Nature 490, 49–54 (2012). https://doi.org/10.1038/nature11413

    Article  CAS  Google Scholar 

  79. S. Raz, S. Weiner, L. Addadi, Formation of high-magnesian calcites via an amorphous precursor phase: Possible biological implications. Adv. Mater. 12, 38–42 (2000). https://doi.org/10.1002/(Sici)1521-4095(200001)12:1<38::Aid-Adma38>3.0.Co;2-I

    Article  CAS  Google Scholar 

  80. D. Kralj, J. Kontrec, L. Brecevic, G. Falini, V. Nothig-Laslo, Effect of inorganic anions on the morphology and structure of magnesium calcite. Chem. Eur. J. 10, 1647–1656 (2004). https://doi.org/10.1002/chem.200305313

    Article  CAS  Google Scholar 

  81. J. Stolarski, M. Mazur, Nanostructure of biogenic versus abiogenic calcium carbonate crystals. Acta Palaeontol. Pol. 50, 847–865 (2005)

    Google Scholar 

  82. P.L. Clode, A.T. Marshall, Calcium associated with a fibrillar organic matrix in the scleractinian coral Galaxea fascicularis. Protoplasma 220, 153–161 (2003). https://doi.org/10.1007/s00709-002-0046-3

    Article  CAS  Google Scholar 

  83. W. Kong, S.G. Li, L. Xiang, L.P. Xie, R.Q. Zhang, Calcium carbonate mineralization mediated by in vitro cultured mantle cells from Pinctada fucata. Biochem. Bioph. Res. Commun. 463, 1053–1058 (2015). https://doi.org/10.1016/j.bbrc.2015.06.057

    Article  CAS  Google Scholar 

  84. L. Xiang, W. Kong, J. Su, J. Liang, G. Zhang, Amorphous calcium carbonate precipitation by cellular biomineralization in mantle cell cultures of Pinctada fucata (vol 9, e113150, 2014). PLoS One 9 (2014). ARTN e116034871371/journal.pone.0116034

    Article  Google Scholar 

  85. M.B. Johnstone et al., Cellular orchestrated biomineralization of crystalline composites on implant surfaces by the eastern oyster, Crassostrea Virginica. J. Shellfish Res. 34, 644–644 (2015)

    Google Scholar 

  86. L. Addadi, S. Raz, S. Weiner, Taking advantage of disorder: amorphous calcium carbonate and its roles in biomineralization. Adv. Mater. 15, 959–970 (2003)

    Article  CAS  Google Scholar 

  87. A.P. Wheeler, K.W. Rusenko, D.M. Swift, C.S. Sikes, Regulation of in vitro and in vivo CaCO 3 crystallization by fractions of oyster shell organic matrix. Mar. Biol. 98, 71–80 (1988)

    Article  CAS  Google Scholar 

  88. C. Zhang, L. Xie, J. Huang, X. Liu, R. Zhang, A novel matrix protein family participating in the prismatic layer framework formation of pearl oyster, Pinctada fucata. Biochem. Biophys. Res. Commun. 344, 735–740 (2006). https://doi.org/10.1016/j.bbrc.2006.03.179

    Article  CAS  Google Scholar 

  89. S. Weiner, L. Addadi, Design strategies in mineralized biological materials. J. Mater. Chem. 7, 689–702 (1997). https://doi.org/10.1039/a604512j

    Article  CAS  Google Scholar 

  90. A.G. Fincham, J. Moradian-Oldak, J.P. Simmer, The structural biology of the developing dental enamel matrix. J. Struct. Biol. 126, 270–299 (1999). https://doi.org/10.1006/jsbi.1999.4130

    Article  CAS  Google Scholar 

  91. E. Kadar, A. Lobo-da-Cunha, C. Azevedo, Mantle-to-shell CaCO3 transfer during shell repair at different hydrostatic pressures in the deep-sea vent mussel Bathymodiolus azoricus (Bivalvia: Mytilidae). Mar. Biol. 156, 959–967 (2009). https://doi.org/10.1007/s00227-009-1140-2

    Article  CAS  Google Scholar 

  92. V. Matozzo, L. Bailo, A first insight into haemocytes of the smooth venus clam Callista chione. Fish Shellfish Immunol. 42, 494–502 (2015). https://doi.org/10.1016/j.fsi.2014.11.034

    Article  Google Scholar 

  93. R.P. Kuchel, D.A. Raftos, D. Birch, N. Vella, Haemocyte morphology and function in the Akoya pearl oyster, Pinctada imbricata. J. Invertebr. Pathol. 105, 36–48 (2010). https://doi.org/10.1016/j.jip.2010.04.011

    Article  Google Scholar 

  94. C. Lopez, M.J. Carballal, C. Azevedo, A. Villalba, Morphological characterization of the hemocytes of the clam, Ruditapes decussatus (Mollusca: Bivalvia). J. Invertebr. Pathol. 69, 51–57 (1997). https://doi.org/10.1006/jipa.1996.4639

    Article  CAS  Google Scholar 

  95. W.P.W. Vanderknaap, C.M. Adema, T. Sminia, Invertebrate blood-cells - morphological and functional-aspects of the Hemocytes in the pond snail Lymnaea-Stagnalis. Comp. Haematol. Int. 3, 20–26 (1993)

    Article  Google Scholar 

  96. P.M. Hine, The inter-relationships of bivalve haemocytes. Fish Shellfish Immunol. 9, 367–385 (1999). https://doi.org/10.1006/fsim.1998.0205

    Article  Google Scholar 

  97. Y.H. Xie, B.C. Hu, C.G. Wen, S.N. Mu, Morphology and phagocytic ability of hemocytes from Cristaria plicata. Aquaculture 310, 245–251 (2011). https://doi.org/10.1016/j.aquaculture.2010.09.034

    Article  Google Scholar 

  98. Y.J. Wang, M.H. Hu, M.W.L. Chiang, P.K.S. Shin, S.G. Cheung, Characterization of subpopulations and immune-related parameters of hemocytes in the green-lipped mussel Perna viridis. Fish Shellfish Immunol. 32, 381–390 (2012). https://doi.org/10.1016/j.fsi.2011.08.024

    Article  CAS  Google Scholar 

  99. W. Zhang, X. Wu, J. Sun, D. Li, Morphological and functional characterization of the hemocytes of the scallop, Chlamys farreri. J. Shellfish Res. 24, 931–936 (2005)

    Article  Google Scholar 

  100. C. Dang, T. Tan, D. Moffit, J.D. Deboutteville, A.C. Barnes, Gender differences in hemocyte immune parameters of bivalves: The Sydney rock oyster Saccostrea glomerata and the pearl oyster Pinctada fucata. Fish Shellfish Immunol. 33, 138–142 (2012). https://doi.org/10.1016/j.fsi.2012.04.007

    Article  CAS  Google Scholar 

  101. L. Donaghy, C. Lambert, K.S. Choi, P. Soudant, Hemocytes of the carpet shell clam (Ruditapes decussatus) and the manila clam (Ruditapes philippinarum): Current knowledge and future prospects. Aquaculture 297, 10–24 (2009). https://doi.org/10.1016/j.aquaculture.2009.09.003

    Article  Google Scholar 

  102. M.D. Rebelo et al., New Insights from the Oyster Crassostrea rhizophorae on Bivalve Circulating Hemocytes. PLoS One 8 (2013). ARTN e573841061371/journal.pone.0057384

    Article  CAS  Google Scholar 

  103. M.C. Mix, A general model for leukocyte cell renewal in bivalve mollusks. Mar. Fish. Rev. 38(1), 37–41 (1976)

    Google Scholar 

  104. S.J. Chang, S.M. Tseng, H.Y. Chou, Morphological characterization via light and electron microscopy of the hemocytes of two cultured bivalves: a comparison study between the hard clam (Meretrix lusoria) and pacific oyster (Crassostrea gigas). Zool. Stud. 44, 144–152 (2005)

    Google Scholar 

  105. M.B. Duchemin, M. Fournier, M. Auffret, Seasonal variations of immune parameters in diploid and triploid Pacific oysters, Crassostrea gigas (Thunberg). Aquaculture 264, 73–81 (2007). https://doi.org/10.1016/j.aquaculture.2006.12.030

    Article  Google Scholar 

  106. S. Mangkalanan, P. Sanguanrat, T. Utairangsri, K. Sritunyalucksana, C. Krittanai, Characterization of the circulating hemocytes in mud crab (Scylla olivacea) revealed phenoloxidase activity. Dev. Comp. Immunol. 44, 116–123 (2014). https://doi.org/10.1016/j.dci.2013.11.018

    Article  CAS  Google Scholar 

  107. E.C. Wootton, E.A. Dyrynda, N.A. Ratcliffe, Bivalve immunity: Comparisons between the marine mussel (Mytilus edulis), the edible cockle (Cerastoderma edule) and the razor-shell (Ensis siliqua). Fish Shellfish Immunol. 15, 195–210 (2003)

    Article  CAS  Google Scholar 

  108. W.Z. Zhang, X.Z. Wu, M. Wang, Morphological, structural, and functional characterization of the haemocytes of the scallop, Argopecten irradians. Aquaculture 251, 19–32 (2006). https://doi.org/10.1016/j.aquaculture.2005.05.020

    Article  Google Scholar 

  109. C. Fleury et al., Shell repair process in the green ormer Haliotis tuberculata: a histological and microstructural study. Tissue Cell 40, 207–218 (2008). https://doi.org/10.1016/j.tice.2007.12.002

    Article  CAS  Google Scholar 

  110. J.A. Audino, J.E.A.R. Marian, A. Wanninger, S.G.B.C. Lopes, Mantle margin morphogenesis in Nodipecten nodosus (Mollusca: Bivalvia): new insights into the development and the roles of bivalve pallial folds. Bmc. Dev. Biol. 15 (2015). ARTN 221151186/s12861-015-0074-9

    Google Scholar 

  111. R. Jabbour-Zahab, D. Chagot, F. Blanc, H. Grizel, Mantle histology, histochemistry and ultrastructure of the pearl oyster Pinctada margaritifera (L.). Aquat. Living Resour. 5, 287–298 (1992)

    Article  Google Scholar 

  112. P. Southgate, J. Lucas (eds.), The pearl oyster (Elsevier, Oxford, 2011)

    Google Scholar 

  113. M.B. Johnstone et al., Cellular orchestrated biomineralization of crystalline composites on implant surfaces by the eastern oyster, Crassostrea virginica (Gmelin, 1791). J. Exp. Mar. Biol. Ecol. 463, 8–16 (2015). https://doi.org/10.1016/j.jembe.2014.10.014

    Article  CAS  Google Scholar 

  114. J.M. Myers, M.B. Johnstone, A.S. Mount, H. Silverman, A.P. Wheeler, TEM immunocytochemistry of a 48kDa MW organic matrix phosphoprotein produced in the mantle epithelial cells of the Eastern oyster (Crassostrea virginica). Tissue Cell 39, 247–256 (2007)

    Article  CAS  Google Scholar 

  115. S.-M. Cho, You-me lee, and woo-Geon Jeong. Effect of Polycyclic Aromatic Hydrocarbon (PAH) on shell repair in the Pacific oyster, Crassostrea gigas. Korean J. Malacol. 27(1), 35–42 (2011)

    Article  Google Scholar 

  116. B. Allam, C. Paillard, S.E. Ford, Pathogenicity of Vibrio tapetis, the etiological agent of brown ring disease in clams. Dis. Aquat. Org. 48, 221–231 (2002). https://doi.org/10.3354/dao048221

    Article  Google Scholar 

  117. A. Ralph, D.C. Elston, P. Frelier, D. Lynn, Invasive orchitophryid ciliate infections in juvenile Pacific and Kumomoto oysters, Crassostrea gigas and Crassostrea sikamea. Aquaculture 174, 1–14 (1999)

    Article  Google Scholar 

  118. N. Vidavsky et al., Initial stages of calcium uptake and mineral deposition in sea urchin embryos. Proc. Natl. Acad. Sci. U. S. A. 111, 39–44 (2014). https://doi.org/10.1073/pnas.1312833110

    Article  CAS  Google Scholar 

  119. S. Weiner, L. Addadi, Crystallization pathways in biomineralization. Annu. Rev. Mater. Res. 41, 21–40 (2011). https://doi.org/10.1146/annurev-matsci-062910-095803

    Article  CAS  Google Scholar 

  120. C. Pan et al., A novel acidic matrix protein, PfN44, stabilizes magnesium calcite to inhibit the crystallization of aragonite. J. Biol. Chem. 289, 2776–2787 (2014). https://doi.org/10.1074/jbc.M113.504027

    Article  CAS  Google Scholar 

  121. Y. Li et al., DNA methylation is associated with expression level changes of galectin gene in mantle wound healing process of pearl oyster, Pinctada fucata. Fish Shellfish Immunol. 45, 912–918 (2015). https://doi.org/10.1016/j.fsi.2015.06.016

    Article  CAS  Google Scholar 

  122. M. De Zoysa et al., Allograft inflammatory factor-1 in disk abalone (Haliotis discus discus): molecular cloning, transcriptional regulation against immune challenge and tissue injury. Fish Shellfish Immunol. 29, 319–326 (2010). https://doi.org/10.1016/j.fsi.2010.04.006

    Article  CAS  Google Scholar 

  123. B. Peter, J. Armstrong, P. Q. Humoral immunity: a2 macroglobulin activity in the plasma of mollusks. Veliger S 35, 161–164 (1992)

    Google Scholar 

  124. M. Suzuki et al., An acidic matrix protein, Pif, is a key macromolecule for nacre formation. Science 325, 1388–1390 (2009). https://doi.org/10.1126/science.1173793

    Article  CAS  Google Scholar 

  125. H.L. Liu et al., Identification and characterization of a biomineralization related gene PFMG1 highly expressed in the mantle of Pinctada fucata. Biochemistry 46, 844–851 (2007). https://doi.org/10.1021/bi061881a

    Article  CAS  Google Scholar 

Download references

Author information

Authors and Affiliations

  1. School of Life Sciences, Tsinghua University, Beijing, China

    Rongqing Zhang & Liping Xie

  2. Chinese Research Academy of Environmental Sciences, Beijing, China

    Zhenguang Yan

Authors
  1. Rongqing Zhang
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Liping Xie
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Zhenguang Yan
    View author publications

    You can also search for this author in PubMed Google Scholar

Supplementary Table 5.1

Supplementary Table 5.1

Chapter

Primer name

Primer sequence

5.2.2

MSI7F

CTATGGCAAATACGGCGGTG

MSI7R

GTCCATATGGTAATTCCACC

nacreinF

CACTTTGAACCTACACGC

nacreinR

TATAAGCACATTCCAGGATCC

MSI60F

GAACAATGACTGGAAT GACA

MSI60R

GGAAAGGTATCCAATAACAAC

GADPH-F

GCCGAGTATGTGGTAGAATC

GADPH-R

CACTGTTTT CTGGGTAGCTG

Rights and permissions

Reprints and permissions

Copyright information

© 2019 Springer Nature Singapore Pte Ltd.

About this chapter

Check for updates. Verify currency and authenticity via CrossMark

Cite this chapter

Zhang, R., Xie, L., Yan, Z. (2019). Cellular Regulation of Biomineralization in Pinctada fucata. In: Biomineralization Mechanism of the Pearl Oyster, Pinctada fucata. Springer, Singapore. https://doi.org/10.1007/978-981-13-1459-9_5

Download citation

Publish with us

Policies and ethics

Search

Navigation