Skip to main content
SpringerLink
Log in

Protein Ligands Engineering

  • Chapter
  • First Online:
Book cover Study of the Peptide-Peptide and Peptide-Protein Interactions and Their Applications in Cell Imaging and Nanoparticle Surface Modification

Part of the book series: Springer Theses ((Springer Theses))

  • 363 Accesses

Abstract

Protein-nanoparticle assemblies as a type of hybrid biomaterials have found increasingly wide-ranging of uses in catalysis, tissue imaging, biosensing, and cell targeting [1–4]. The inorganic nanoparticle cores grant the assemblies favorable physical properties such as optical, electrical and magnetic properties that organic or biological molecules normally do not possess, whereas protein ligands displayed on the periphery mediate the interaction between the particle and the biological environment [5–8]. As a ligand to functionalize the surface of nanoparticle, a protein is notably different from a small molecule, or a synthetic polymer. The first distinction lies in its size: proteins have similar dimensions as nanoparticles, with diameter often ranging between 3 and 6 nm, comparable to that of a nanoparticle. Therefore, while small molecules and polymers form a self-assembled monolayer on the surface of particles, monomeric proteins binds to quantum dots (QDs, as one example of nanoparticles) with a low stoichiometry around 16:1 (ligand:particle ratio) [9–11]. Secondly, featuring sophisticated three-dimensional structures, proteins are structurally asymmetric in shape, chirality, and chemical properties. These features are furthermore highly engineerable, thanks to the great advancement of recombinant technology and structural biology in recent decades. Therefore, one could base on the crystal structure of a protein to tailor-make protein ligands that have particular intermolecular interactions to affect specific controls on the properties of protein-nanoparticle assemblies, a degree of freedom that is difficult to achieve using synthetic small molecules or polymers [12–17].

This is a preview of subscription content, log in via an institution to check access.

Access this chapter

Log in via an institution
Chapter
USD 29.95
Price excludes VAT (USA)
  • Available as PDF
  • Read on any device
  • Instant download
  • Own it forever
eBook
USD 84.99
Price excludes VAT (USA)
  • Available as EPUB and PDF
  • Read on any device
  • Instant download
  • Own it forever
Softcover Book
USD 109.99
Price excludes VAT (USA)
  • Compact, lightweight edition
  • Dispatched in 3 to 5 business days
  • Free shipping worldwide - see info
Hardcover Book
USD 109.99
Price excludes VAT (USA)
  • Durable hardcover edition
  • Dispatched in 3 to 5 business days
  • Free shipping worldwide - see info

Tax calculation will be finalised at checkout

Purchases are for personal use only

Institutional subscriptions

References

  1. Dong A, Ye X, Chen J et al (2011) A generalized ligand-exchange strategy enabling sequential surface functionalization of colloidal nanocrystals. J Am Chem Soc 133:998–1006

    Article  CAS  Google Scholar 

  2. Xiao Y, Patolsky F, Katz E et al (2003) “Plugging into enzymes”: nanowiring of redox enzymes by a gold nanoparticle. Science 299:1877–1881

    Article  CAS  Google Scholar 

  3. You C-C, Agasti SS, De M et al (2006) Modulation of the catalytic behavior of α-chymotrypsin at monolayer-protected nanoparticle surfaces. J Am Chem Soc 128:14612–14618

    Article  CAS  Google Scholar 

  4. Yu JH, Kwon S-H, Petrášek Z et al (2013) High-resolution three-photon biomedical imaging using doped ZnS nanocrystals. Nat Mater 12:359–366

    Article  CAS  Google Scholar 

  5. Gu H, Xu K, Xu C et al (2006) Biofunctional magnetic nanoparticles for protein separation and pathogen detection. Chem Commun 9:941–949

    Article  Google Scholar 

  6. Sapsford KE, Algar WR, Berti L et al (2013) Functionalizing nanoparticles with biological molecules: developing chemistries that facilitate nanotechnology. Chem Rev 113:1904–2074

    Article  CAS  Google Scholar 

  7. Reddy LH, Arias JL, Nicolas J et al (2012) Magnetic nanoparticles: design and characterization, toxicity and biocompatibility, pharmaceutical and biomedical applications. Chem Rev 112:5818–5878

    Article  CAS  Google Scholar 

  8. Michalet X, Pinaud FF, Bentolila LA et al (2005) Quantum dots for live cells, in vivo imaging, and diagnostics. Science 307:538–544

    Article  CAS  Google Scholar 

  9. Medintz IL, Uyeda HT, Goldman ER et al (2005) Quantum dot bioconjugates for imaging, labeling and sensing. Nat Mater 4:435–446

    Article  CAS  Google Scholar 

  10. Clapp AR, Medintz IL, Mauro JM et al (2004) Fluorescence resonance energy transfer between quantum dot donors and dye-labeled protein acceptors. J Am Chem Soc 126:301–310

    Article  CAS  Google Scholar 

  11. Sapsford KE, Pons T, Medintz IL et al (2007) Kinetics of metal-affinity driven self-assembly between protiens or peptides and CdSe-ZnS quantum dots. J Phys Chem 111:11528–11538

    CAS  Google Scholar 

  12. Hu M, Qian L, Brinas RP et al (2007) Assembly of nanoparticles-protein binding complexes: from monomers to ordered arrays. Angew Chem Int Ed 46:5111–5114

    Article  CAS  Google Scholar 

  13. Allen M, Willits D, Mosolf J et al (2002) Protein cage constrained synthesis of ferrimagnetic iron oxide nanoparticles. Adv Mater 14:1562–1565

    Article  CAS  Google Scholar 

  14. Ishii D, Kinbara K, Ishida Y et al (2003) Chaperonin-mediated stabilization and ATP-triggered release of semiconductor nanoparticles. Nature 423:628–632

    Article  CAS  Google Scholar 

  15. Djalali R, Chem Y, Matsui H (2002) Au nanowire fabrication from sequenced histidine-rich peptide. J Am Chem Soc 124:13660–13661

    Article  CAS  Google Scholar 

  16. Blum AS, Soto CM, Wilson CD et al (2004) Cowpea mosaic virus as a scaffold for 3-D patterning of gold nanoparticles. Nano Lett 4:867–870

    Article  CAS  Google Scholar 

  17. Li F, Li K, Cui Z-Q et al (2010) Viral coat proteins as flexible nano-building-blocks for nanoparticle encapsulation. Small 6:2301–2308

    Article  CAS  Google Scholar 

  18. Monopoli MP, Walczyk D, Campbell A et al (2011) Physical-chemical aspects of protein corona: relevance to in vitro and in vivo biological impacts of nanoparticles. J Am Chem Soc 133:2525–2534

    Article  CAS  Google Scholar 

  19. Walczyk D, Bombelli FB, Monopoli MP et al (2010) What the cell “sees” in bionanoscience. J Am Chem Soc 132:5761–5768

    Article  CAS  Google Scholar 

  20. Lundqvist M, Stigler J, Elia G et al (2008) Nanoparticle size and surface properties determine the protein corona with possible implications for biological impacts. Proc Natl Acad Sci USA 105:14265–14270

    Article  CAS  Google Scholar 

  21. Cedervall T, Lynch I, Lindman S et al (2007) Understanding the nanoparticle-protein corona using methods to quantify exchange rates and affinities of proteins for nanoparticles. Proc Natl Acad Sci USA 104:2050–2055

    Article  CAS  Google Scholar 

  22. Klein J (2007) Probing the interactions of proteins and nanoparticles. Proc Natl Acad Sci USA 104:2029–2030

    Article  CAS  Google Scholar 

  23. Amiri H, Bordonali L, Lascialfari A et al (2013) Protein corona affects the relaxivity and MRI contrast efficiency of magnetic nanoparticles. Nanoscale 5:8656–8665

    Article  CAS  Google Scholar 

  24. Wang J, Xia J (2011) Preferential binding of a novel polyhistidine peptide dendrimer ligand on quantum dots probed by capillary electrophoresis. Anal Chem 83:6323–6329

    Article  CAS  Google Scholar 

  25. Wang J, Jiang P, Han Z et al (2012) Fast self-assembly kinetics of quantum dots and a dendrimeric peptide ligand. Langmuir 28:7962–7966

    Article  CAS  Google Scholar 

  26. Lu Y, Wang J, Wang J et al (2012) Genetically encodable design of ligand “bundling” on the surface of nanoparticles. Langmuir 28:13788–13792

    Article  CAS  Google Scholar 

  27. Dif A, Boulmedais F, Piont M et al (2009) Small and stable peptidic PEGylated quantum dots to target polyhistidine-tagged proteins with controlled stoichiometry. J Am Chem Soc 131:14738–14746

    Article  CAS  Google Scholar 

  28. Clarke S, Pinaud F, Beutel O et al (2010) Covalent monofunctionalization of peptide-coated quantum dots for single-molecule assays. Nano Lett 10:2147–2154

    Article  CAS  Google Scholar 

  29. Clarke S, Tamang S, Reiss P et al (2011) A simple and general route for monofunctionalization of fluorescent and magnetic nanoparticles using peptides. Nanotechnology 22:175103–175113

    Article  Google Scholar 

  30. Zhang X, Chu X, Wang L et al (2012) Rational design of a tetrameric protein to enhance interactions between self-assembled fibers gives molecular hydrogels. Angew Chem Int Ed 51:4388–4392

    Article  Google Scholar 

  31. Yan X, Zhou H, Zhang J et al (2009) Molecular mechanism of inward rectifier potassium channel 2.3 regulation by tax-interacting protein-1. J Mol Biol 392:967–976

    Article  CAS  Google Scholar 

  32. Wang J, Nie Y, Lu Y et al (2014) Assembly of multivalent protein ligands and quantum dots: a multifaceted investigation. Langmuir 30:2161–2169

    Article  CAS  Google Scholar 

  33. Medintz IL, Mattoussi H (2009) Quantum dot-based resonance energy transfer and its growing application in biology. Phys Chem Chem Phys 11:11–45

    Article  Google Scholar 

  34. Hochuli E, Bannwarth W, Döbeli H (1988) Genetic approach to facilitate purification of recombinant proteins with a novel metal chelate adsorbent. Nat Biotechnol 6:1321–1325

    Article  CAS  Google Scholar 

  35. Wang Z, Yang X, Chu L et al (2012) The structural basis for the oligomerization of the N-terminal domain of SATB1. Nucleic Acids Res 40:4193–4202

    Article  CAS  Google Scholar 

  36. Ritchie TK, Grinkova YV, Bayburt TH et al (2009) Reconstitution of membrane proteins in phospholipid bilayer nanodiscs. Methods Enzymol 464:211–231

    Article  CAS  Google Scholar 

  37. Bayburt TH, Sligar SG (2009) Membrane protein assembly into nanodiscs. FEBS Lett 584:1721–1727

    Article  Google Scholar 

Download references

Author information

Authors and Affiliations

  1. Department of Chemistry, The Chinese University of Hong Kong, Hong Kong, China

    Jianpeng Wang

Authors
  1. Jianpeng Wang
    View author publications

    You can also search for this author in PubMed Google Scholar

Corresponding author

Correspondence to Jianpeng Wang .

Appendices

Appendix 3.1 Plasmid Information of pET21a-TIP1-MC

CCTGTCACCGCCGTAGTGCAAAGAGTTGAAATTCATAAGTTGCGTCAAGGTGAGAACTTAATCTTGGGCTTCAGTATTGGAGGTGGGATCGACCAGGACCCGTCTCAGAATCCCTTCTCGGAAGATAAAACAGACAAGGGCATTTACGTCACACGAGTATCAGAGGGAGGTCCTGCTGAAATTGCTGGGCTGCAGATTGGAGACAAGATCATGCAGGTGAATGGCTGGGACATGACCATGGTCACTCACGACCAGGCTCGGAAGCGGCTCACCAAGCGCTCGGAGGAGGTGGTCCGCCTGCTGGTGACTCGGCAGTCTCTACAAAAGGCTGTACAGCAGTCCATGCTGTCT gaattc ATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTC AAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGTAActcgag

Appendix 3.2 Plasmid Information of pET21a-ULD-MCS

CATATGGGAACCATGTTACCAGTTTTCTGCGTGGTGGAACATTATGAAAACGCCATTGAGTATGATTGCAAGGAGGAGCACGCGGAATTTGTATTGGTGAGAAAGGATATGCTTTTCAACCAGCTGATAGAGATGGCGTTGCTGTCTCTAGGCTATTCACACAGCTCTGCTGCCCAAGCCAAAGGGCTCATCCAGGTTGGGAAGTGGAATCCAGTTCCACTGTCGTATGTGACAGATGCCCCTGATGCCACGGTGGCAGACATGCTTCAAGATGTGTATCATGTGGTCACCCTCAAAATTCAGTTACACAGTGAATTCATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGCTCGAG

Appendix 3.3 Plasmid Information of pET21a-MC-NB

CATATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGGGATCCGGCCCGCATAAAATTGCGCAACTGAAACATGAAAACCAGGCTCTGGAACACGAAATTGCCTCCTTGGAACACAAAATTTCTGCACTGCCACACAAGATCGCTCAGCTGAAGCACGAGAACCAAGCCCTGGAACATGAGATCGCATCTCTGGAGCATAAGATCAGCGCGCTTCCGCACAAAATCGCCCAGCTGAAACACGAAAACCAGGCACTCGAACATGAAATCGCCAGCCTGGAACACAAGATTTCCGCCCTGCCACATAAAATTGCACAACTGAAGCATGAAAATCAAGCTCTGGAGCACGAGATTGCATCCCTGGAACATAAAATCAGCGCACTCCCGCACAAGATCGCGCAGCTTAAACACGAGAATCAGGCGCTGGAGCACGAAATCGCGAGCCTGGAGCACAAAATCTCTGCTTTGCTGTAAAAGCTT

Appendix 3.4 Mass Spectrum of the Peptide

MALDI-TOF spectrum of the dimerization reaction showing the presence of the monomer CGGWRESAI and the dimer (CGGWRESAI)2. CGGWRESAI, [M + H]+, calculated 978.1, found 978.5. (CGGWRESAI)2, [M + H]+, calculated 1953.2, found 1953.7.

Appendix 3.5 SDS-PAGE Results of the Proteins

SDS-PAGE of the purified proteins: molecular weight marker (lane 1), GCN-mCherry (lane 2), TIP1-mCherry (lane 3), ULD-mCherry (lane 4), and histag-mCherry (lane 5).

Appendix 3.6 SDS-PAGE Results of Nanobelt-mCherry

Rights and permissions

Reprints and permissions

Copyright information

© 2016 Springer-Verlag Berlin Heidelberg

About this chapter

Cite this chapter

Wang, J. (2016). Protein Ligands Engineering. In: Study of the Peptide-Peptide and Peptide-Protein Interactions and Their Applications in Cell Imaging and Nanoparticle Surface Modification. Springer Theses. Springer, Berlin, Heidelberg. https://doi.org/10.1007/978-3-662-53399-4_3

Download citation

Publish with us

Policies and ethics

Search

Navigation