Abstract
The literature on molecular biology is filled with strings of letters; TGACTC, TGGCCGGGGTTTACGGACGATGA, hapl, TACATCA, TATA etc., all part of the complex language. This chapter will attempt to interpret some of this language, that is the shorthand of molecular biology.
Access this chapter
Tax calculation will be finalised at checkout
Purchases are for personal use only
Preview
Unable to display preview. Download preview PDF.
References
Beggs JD (1978) Transformation of yeast by a replicating hybrid plasmid. Nature 275:104–109 Bowdish KS, Mitchell AP (1993) Bipartite structure of an early meiotic upstream activation sequence from Saccharomyces cerevisiae. Mol Cell Boil 13 (4): 2172–2181
Bowdish KS, Yuan HE, Mitchell AP (1995) Positive control of yeast meiotic genes by the negative regulator UME6. Mol Cell Biol 15 (6): 2955–2961
Brearley RD, Kelly DE (1991) Genetic engineering in yeast. In: Wiseman A (ed) Genetically-engineered proteins and enzymes from yeast: Production control. Ellis Horwood, Chichester, pp 75–95
Brown AJP (1989) Messenger RNA translation and degradation in Saccharomyces cerevisiae. In: Walton EF, Yarranto GT (eds) The molecular biology of yeast. Blackie, London, Van Nostrand Reinhold, New York, pp 70–106
Bruhn L, Sprague GF Jr (1994) MCM point mutants deficient in expression of a-specific genes: residues important for interaction with al. Mol Cell Biol 14 (4): 2534–2544
Clark KL, Dignard D, Thomas DY, Whiteway M (1993) Interactions among the subunits of the G protein involved in Saccharomyces cerevisiae mating. Mol Cell Biol 13 (1): 1–8
Cregg JM, Tschopp JF, Stillman C et al. (1987) High level expression and efficient assembly of hepatitis B surface antigen in the methylotrophic yeast Pichia pastoris. Bio/Technology 5: 479–484
Drysdale CM, Dueiïas E, Jackson BM, Reusser U, Braus GH, Hinnebusch AG (1995) The transcriptional activator GCN4 contains multiple activation domains that are critically dependent on hydrophobic amino acids. Mol Cell Biol 15: 1220–1233
Errede B (1993) MCM1 binds to a transcriptional control element in Tyl. Mol Cell Biol 13 (1): 57–62
Evans IH, McAthey P (1991) Comparative genetics of important yeasts. In: Wiseman A (ed) Genetically- engineered proteins and enzymes from yeast: Production control. Ellis Horwood, Chichester, pp 11–74
Fangman WL, Brewer BJ (1991) Activation of replication origins within yeast chromosomes. Ann Rev Cell Biol 7: 375–402
Grandin N, Reed SI (1993) Differential function and expression of Saccharomyces cerevisiae B-type cyclins in mitosis and meiosis. Mol Cell Biol 13 (4): 2113–2125
Hartwell LH (1974) The yeast cell division cycle. Bacteriol Rev 38: 164
Herskowitz I (1988) Microbiol Rev 52: 536–553
Herskowitz I (1989) A regulatory hierarchy for cell specialization in yeast. Nature 342: 749–757
Heslot H, Gaillardin C (1991) Molecular biology and genetic engineering of yeasts. CRC Press, Boca Raton 324 pp
Hinnen A, Hicks JB, Fink GR (1978) Transformation of yeast. Proc Natl Acad Sci USA 75:1929 Holm C (1982) Clonal lethality caused by the yeast plasmid 2-µm DNA. Cell 29: 585
Kuo M-H, Grayhack E (1994) A library of yeast genomic MCMI binding sites contains genes involved in cell cycle control. Mol Cell Biol 14 (1): 348–359
Lee JC, Yeh LCC, Horowitz PM (1991) The initiation codon AUG binds at a hydrophobic site on yeast 40S ribosomal subunits as revealed by fluorescence studies with bis(1,8anilinonaphthalenesulfonate). Biochimie 73 (9): 1245–1248
Linder C, Thoma F (1994) Histone H1 expressed in Saccharomyces cerevisiae binds to chromatin and affects survival, growth, transcription and plasmid stability but does not change nucleosomal spacing. Mol Cell Biol 14 (4): 2822–2835
Lucchini R, Sogo JM (1994) Chromatin structure and transcriptional activity around the replication forks arrested at the 3’ end of the yeast rRNA genes. Mol Cell Biol 14 (1): 318–326
Marsh L, Neiman AM, Herskowitz I (1991) Signal transduction during pheromone response in yeast. Annu Rev Cell Biol 7: 699–728
Matsumoto K, Kaibuchi K, Arai K, Nakafuku M, Kaziro Y (1989) Signal transduction by GTP-binding proteins in Saccharomyces cerevisiae. In: Walton EF, Yarranton GT (eds) Molecular and cell biology of yeasts. Blackie, London, Van Nostrand Reinhold, New York, pp 201–222
Meacock PA, Brieden KW, Cashmore AM (1989) The two-micron circle model replicon and yeast vector. In: Walton EF, Yarranton GT (eds) Molecular and cell biology of yeasts. Blackie, London, Van Nostrand Reinhold, New York, pp 330–359
Mellor J (1989) The activation and initiation of transcription by the promoters of Saccharomyces cerevisiae. In: Walton EF, Yarranton GT (eds) Molecular and cell biology of yeasts. Blackie, London, Van Nostrand Reinhold, New York, pp 1–42
Mendel JE, Korswagen HC, Liu KS, Hadju-Cronin YM, Simon MI, Plasterk RHA, Sternberg PW (1995) Participation of the protein Go in multiple aspects of behavior in C. elegans. Science 267: 16521655
Messenguy F, Dubois E (1993) Genetic evidence for a role for MCM1 in the regulation of arginine metabolism in Saccharomyces cerevisiae. Mol Cell Biol 13 (4): 2586–2592
Mizuta K, Warner JR (1994) Continued functioning of the secretory pathway is essential for ribosome synthesis. Mol Cell Biol 14 (4): 2493–2502
Moore TDE, Edman JC (1993) The a-mating type locus of Cryptococcus neoformans contains a peptide pheromone gene. Mol Cell Biol 13 (3): 1962–1970
Muhlrad D, Decker CJ, Kreck MJ (1995) Turnover mechanisms of the stable yeast PKGI mRNA. Mol Cell Biol 14: 2145–2156
Newton C (1989) DNA organization and replication in yeast. In: Rose AH, Harrison JS (eds) The yeasts, vol 4, 2nd edn. Academic Press, New York, 57 pp
Oppenoorth WFF (1960) Modification of the hereditary character of yeast by ingestion of cell-free extracts. Eur Brewery Convention. Elsevier, Amsterdam, 180 pp
Piper PW, Kirk N (1991) Inducing heterologous gene expression in yeast as fermentations approach maximal biomass. In: Wiseman A (ed) Genetically-engineered proteins and enzymes from yeast: Production control. Ellis Horwood, Chichester, pp 147–184
Rose MD (1991) Nuclear fusion in yeast. Annu Rev Microbiol 45: 539–567
Ségalat L, Elkes DA, Kaplan JM (1995) Modulation of serotonin-controlled behaviors by Go in Caenorhabditis elegans. Science 267: 1648–1651
Thompson JS, Johnson LM, Grunstein M (1994) Specific repression of the yeast silent mating locus (HMR) by an adjacent telomere. Mol Cell Biol 14 (1): 446–455
Wheals AE (1987) Biology of the cell cycle in yeasts. In: Rose AH, Harrison JS (eds) The yeasts, vol 1. Academic Press, New York, pp 283–390
Yun D-F, Sherman F (1995) Initiation of translation can occur only in a restricted region of the CYCI mRNA of Saccharomyces cerevisiae. Mol Cell Biol 15: 1021–1033
Zhou Z, Gartner A, Cade R, Ammerer G, Errede B (1993) Pheromone-induced signal transduction in Saccharomyces cerevisiae requires the sequential function of three protein kinases. Mol Cell Biol 13 (4): 2069–2080
Editor information
Editors and Affiliations
Rights and permissions
Copyright information
© 1997 Springer-Verlag Berlin Heidelberg
About this chapter
Cite this chapter
Spencer, J.F.T., Spencer, D.M. (1997). Inside the Inside: Part I: Yeasts and Molecular Biology, a Recipe for Alphabet Soup. Chromosome Structure, Replication, Transcription, and Translation. In: Spencer, J.F.T., Spencer, D.M. (eds) Yeasts in Natural and Artificial Habitats. Springer, Berlin, Heidelberg. https://doi.org/10.1007/978-3-662-03370-8_11
Download citation
DOI: https://doi.org/10.1007/978-3-662-03370-8_11
Publisher Name: Springer, Berlin, Heidelberg
Print ISBN: 978-3-642-08160-6
Online ISBN: 978-3-662-03370-8
eBook Packages: Springer Book Archive