Advertisement

Sapelovirus

  • Yashpal Singh Malik
  • Sudipta Bhat
  • Anastasia N. Vlasova
  • Fun-In Wang
  • Nadia Touil
  • Souvik Ghosh
  • Kuldeep Dhama
  • Mahendra Pal Yadav
  • Raj Kumar Singh
Chapter
  • 75 Downloads
Part of the Livestock Diseases and Management book series (LDM)

Abstract

Sapelovirus (SPV), an emerging virus in the family Picornaviridae, is detected in several animal and bird species irrespective of their age. Amid all SPVs, porcine sapeloviruses (PSVs) are more ubiquitously present all over the world in porcine population. These viruses are highly stable in different environmental conditions and spread easily within the susceptible animals mainly through faeco-oral route. Usually, PSVs cause asymptomatic infections but are also clinically associated with encephalomyelitis, respiratory distress, fertility disorders and skin lesions. PSV-associated outbreaks have been reported where death occurs due to polioencephalitis and respiratory paralysis. Till date, PSVs have been detected from several European and Asian countries with moderate-to-high prevalence and clinical course. Viral capsid proteins are immunogenic and mutations in these proteins are responsible for the diverse nature of the viruses. Further, genomic analysis shows the varied evolutionary patterns and the presence of recombination within PSV strains. These viruses also exist as concurrent infections with several enteric bacterial, viral and parasitic pathogens. Classical to modern biotechnological assays are in use to detect PSV involving virus isolation in cell culture, immunohistochemistry, conventional nucleic acid amplification techniques, quantitative real-time amplification assays and isothermal amplification molecular techniques. Till date, there is no vaccine available against PSVs.

Keywords

Sapelovirus Picornaviridae Porcine Encephalomyelitis Mutation Diversity Recombination Diagnosis Epidemiology 

14.1 Preamble

Sapeloviruses, formerly known as porcine enterovirus (PEV)-8, are ubiquitous and most commonly responsible for causing asymptomatic infection of the gastrointestinal tract of animals. The genetic analysis revealed unique markers based on which PEV-8 viruses were reclassified under a new genus named Sapelovirus (Krumbholz et al. 2002). As on date, these viruses have been found to infect porcine, avian and simian species. Porcine sapelovirus (PSV)-associated clinical symptoms include pneumonia, reproductive defects, skin lesions, enteritis and encephalomyelitis. As the information available on avian sapelovirus (ASV) and simian sapelovirus (SSV) is limited, this chapter comprehends the information on PSV only.

14.2 Virus Characteristics

PSVs belong to the genus Sapelovirus under the family Picornaviridae. The size of virion particles is small (~35 nm) and they are non-enveloped possessing icosahedral symmetry with a distinct surface morphology visible under the electron microscope (Bai et al. 2018). Mature infectious virions are stable in the environment and could resist acidic pH. Furthermore, virions are not destabilised at elevated temperature (60 °C for 10 min), lipid solvents and some disinfectants. Sodium chlorite or 70% ethanol is effective to inactivate PSV (Horak et al. 2016).The Sapelovirus exhibits buoyant density in CsCl of 1.32–1.34 g/cm3.

14.3 Virus Taxonomy

The current Sapelovirus taxonomy is the result of efforts from the picorna study group and the International Committee on Taxonomy of Viruses (ICTV) Executive Committee (www.picornastudygroup.com) that are contributing their expertise to provide a classification scheme that is supported by verifiable data and expert consensus. The genus Sapelovirus contains three species, namely Avian sapelovirus (ASV), Sapelovirus A (SV-A, porcine) and Sapelovirus B (SV-B, simian) (ICTV 10th report, https://talk.ictvonline.org/ictv-reports/ictv_online_report/positive-sense-rnaviruses/picornavirales/w/picornaviridae/701/genus-sapelovirus). ASV and SV-A consist of only a single antigenically heterogenous serotype, respectively, known as ASV-1 and PSV-1. However, SSVs are highly divergent and are classified into three genetically defined Sapelovirus types as SSV-1 to SSV-3. PSV (strain csh) was first isolated from China in 2011 (Lan et al. 2011). As on date, 50 complete genomic sequences of PSV strains have been published from China, South Korea, Japan, Germany, France, India and the United Kingdom (Lan et al. 2011; Chen et al. 2012; Schock et al. 2014; Son et al. 2014; Ray et al. 2018; Piorkowski et al. 2018; Bai et al. 2018). Different virus strains exhibit affinity towards different target organs, as the PSV-csh strain (China, Shanghai) and PSV-G5 (the United Kingdom) affect mostly nervous system (Lan et al. 2011; Schock et al. 2014), whereas strains like KS0515, KS04105 and KS0552179 and Chinese PSV strain YC2011 are associated with diarrhoea. Notably, PSV-csh is a diarrhoeagenic strain that leads to respiratory distress before the onset of polioencephalomyelitis in infected animals (Lan et al. 2011).

14.4 Viral Genome

PSVs are positive-sense RNA viruses containing a genome-linked viral protein (VPg) at the 5′-terminus and a 3′-polyA tail. The complete genome size of the virus is 7.5–8.3 kb, coding a single polyprotein which is further cleaved post-translationally by virus-encoded proteinases into 12 individual proteins, viz. a leader protein (L), four structural proteins (VP1-4) and seven non-structural proteins (2A-2C, 3A-3D). The deduced polyproteins of the Sapelovirus range from 2322 to 2521 amino acids (aa). The layout of a complete genome of PSV (strain V13) with the nucleotide length of each protein is depicted in Fig. 14.1. PSVs have unique L and 2A protein (Krumbholz et al. 2002). Though the exact function of these two proteins is not known yet, both are presumed to be a protease. All three Sapeloviruses contain Internal Ribosomal Entry Site (IRES) type IV. ASVs have the longer L protein (451 aa) compared to PSV (84 aa) and SSV (88 aa). Regarding 2A protein, ASVs have very small protein (12 aa) whereas PSV and SSV have 226 aa and 302 aa, respectively. A species demarcation criteria is followed for the genus Sapelovirus that is founded on above 70% aa identity in the polyprotein, greater than 64% aa identity in P1 (VP4, VP2, VP3, VP1), greater than 70% aa identity in 2C + 3CD, a similar genome base composition which varies by no more than 1% and a common genome organisation (ICTV 10th report, 2018).
Fig. 14.1

A schematic layout of the porcine Sapelovirus genome (nucleotide lengths in base pair of different genes are given as per the first isolated PSV strain V13, NC_003987). VPg genome-linked viral protein, NCR noncoding RNA, L leader protein, VP viral protein, P1 structural protein, P2–P3 non-structural protein, pro protease, hel helicase and pol polymerase are depicted in schematic diagram

14.5 Epidemiology

14.5.1 Species Affected

Sapeloviruses have been isolated from pigs, wild boars, monkeys and ducks whereas sapelovirus-like-specific genome has been detected in a variety of species like bats (several species), cats, cattle, dogs, pigeons, quails‚ and sea lions (Li et al. 2011). Notably, these viruses to date are not known to cause any zoonotic transmission to human.

14.5.2 Geographic Distribution and Strain Variability

PSVs are being detected from different parts of the world in both healthy and diarrhoeic piglets and regarded as emerging enteric pathogens in porcine species. The countries that confirmed the presence of PSVs are shown in Fig. 14.2 (Forman et al. 1982; La Rosa et al. 2006; Buitrago et al. 2010; Lan et al. 2011; Shan et al. 2011; Cano-Gomez et al. 2013; Schock et al. 2014; Donin et al. 2014, 2015). The most immunodominant protein VP1 in the capsid of PSVs is used for estimating the divergence among the strains. Though only a single type of PSV-1 is present, fewer similarities are observed between PSV strains from different geographical regions. Phylogenetic analysis based on VP1 gene sequences shows that PSVs are distributed in different clusters depending upon the country of origin. Both full-length (855 bp) and partial-length (544 bp) VP1 genes have been used for the analysis of PSV diversity. The analysis based on VP1 sequences by SplitsTree4 software segregates three species within the genus Sapelovirus (Fig. 14.3) in three different clusters. Variations within PSV isolates are quite evident that indicates that several PSVs are circulating all over the world, and they are different from each other based on VP1 sequence. Studies from China reveal that recombinations occur between PSV strains, which further contribute to the antigenic diversity among PSVs. Recently, identification and genomic characterisation of Sapelovirus have been documented from France and India (Ray et al. 2018; Piorkowski et al. 2018; Kumari et al. 2019). A Chinese study reported the recombination hotspot near 3′ of the VP1 gene and showed six interclades within PSV recombinant strains (Yang et al. 2017).
Fig. 14.2

Distribution of PSV throughout the world. The colour-shaded portions are where PSV incidences have been reported

Fig. 14.3

Unrooted maximum-likelihood phylogenetic tree based on partial VP1 (544 bp) nucleotide sequences of the representative members of Porcine Sapelovirus PSV, Simian Sapelovirus SSV and Avian Sapelovirus ASV from China, Japan, England, India, the United States, Germany and SK (South Korea). Tree was developed using SplitsTree4 (Huson and Bryant 2006)

14.6 Transmission and Pathogenesis

The most common route of transmission of the virus is faecal-oral; however, due to its high stability the infectious virions spread through fomites also (Huang et al. 1980; Lan et al. 2011). Several intestinal epithelial cell lines are commonly used for the pathogenicity and virulence studies of PSVs (Lan et al. 2013).

After ingestion through the oral route, PSVs primarily replicate in the intestinal tract. Receptor used by the PSV is unknown, but one recent study shows that a 2,3-linked terminal sialic acid (SA) on the cell surface GD1a ganglioside could be used for PSV binding and infection as a receptor (Kim et al. 2016). Experimental data shows that PSV utilises caveolae-dependent endocytosis pathway for PK-15 cell internalisation and depends upon lower pH, dynamin, Rab7 and Rab11 (Zhao et al. 2019). PSV strains are known to cause viremia through which they access the central nervous system (CNS). The incubation periods vary from 5 to 14 days.

14.7 Clinical Signs

PSVs can cause both symptomatic and asymptomatic infections in the natural field cases and experimentally infected piglets. Commonly, co-infections of PSV with other enteric pathogens like porcine kobuvirus (PKV), porcine enterovirus (PEV), porcine teschovirus (PTV), group A-C rotaviruses (RVA-C), porcine sapovirus (PSaV), porcine norovirus (PNoV), transmissible gastroenteritis coronavirus (TGEV), porcine epidemic diarrhoea coronavirus (PEDV), Escherichia coli and Salmonella spp., Lawsonia intracellularis, Brachyspira hyodysenteriae, Brachyspira pilosicoli, Brachyspira intermedia and Clostridium perfringens. Symptomatic manifestations are mainly neurological, which include spinal cord damage, ataxia, mental dullness, paresis, paralysis and a decreased response to environmental stimuli. Polioencephalitis in grower pigs is characterised by ataxia and paraparesis. Experimental infection of polioencephalitis has been documented in 50–60-day-old grower pigs. A novel PSV isolate from the United States was found to be associated with typical polioencephalomyelitis (Arruda et al. 2016). Gastroenteritis and respiratory distress may also be seen with PSV-induced polioencephalomyelitis (Lan et al. 2011). Intravaginal inoculation at day 15 of gestation causes early embryonic death and foetal resorption, but when inoculated at day 30, it results in a significant increase in foetal death (Huang et al. 1980). PSV is also detected from intestinal contents of stillbirth animals from Indian pig population, which suggests the transplacental transmission of the virus (Kumari et al. 2019).

14.8 Morbidity and Mortality

No specific data is available on the mortality and morbidity associated with PSV infection. Experimental infection through intravaginal and intrauterine route in gilts with PSV on day 30 of gestation results in a 94.4% foetal mortality (Huang et al. 1980). An outbreak reported in the United States in 2016 stated 20% morbidity and 30% case fatality rate (Arruda et al. 2016).

14.8.1 Post-mortem and Histopathology

Lesions are mainly seen in the central nervous system (CNS), consistent with the other neurotropic viral infection, characterised as subacute, multifocal and non-suppurative polioencephalomyelitis, accompanied with punctate haemorrhage and hyperaemia in the dura mater (Lan et al. 2011; Schock et al. 2014). Neuronal vacuolisation and perivascular cuffing are also commonly observed (Lan et al. 2011). Congestion is the most common gross lesion seen in the small intestine along with pronounced loss of villi with haemorrhage in the lamina propria histologically (Lan et al. 2011). In the case of clinical pneumonia, consolidation and multifocal haemorrhage are commonly seen in the lung lobes, where erythrocytes infiltrate throughout the interstitium and alveoli with alveolar wall thinning (Lan et al. 2011). Pathological lesions from naturally infected Indian pig show severe clouding, thickening and congestion of meninges, pleural thickening, frothy exudates in the trachea, congested mesenteric lymph nodes, yellowish discolouration of liver, intestinal (ileum) corrugation and thickening of the intestinal mucosal fold (Kumari et al. 2019)

14.9 Diagnosis

14.9.1 Clinical History

A neurological disorder characterised by ataxia and limb paralysis, with or without other clinical symptoms (diarrhoea or pneumonia), is suggestive of PSV infection (Lan et al. 2011). The PSV-induced reproductive disorder can be suspected in litters with a few to several stillborn or mummified foetuses (Huang et al. 1980).

14.9.2 Samples

Samples from live animal include faeces and blood (serum). In the case of the faecal sample, direct collection from the anus is preferred to avoid sample contamination. Spinal cord and brain are the most common preferred samples from the dead animal for PSV-induced CNS infection diagnosis. Other than these, liver, spleen, trachea, lung and intestine samples are also useful in diagnosing PSV infections. Though PSV has not been successfully isolated from the tissues of stillborn or mummified foetuses, molecular detection has been reported from stillbirth cases (Huang et al. 1980; Kumari et al. 2019).

14.9.3 Detection of Virus, Nucleic Acid or Antigens

Routine laboratory diagnosis of PSVs mainly includes cell culture isolation and virus genome characterisation. Pig kidney cell-derived cell lines including EFN, PK-15, IBRS-2 and LLC-PK are susceptible to PSV with a cytopathic effect (CPE) in these cells (Sozzi et al. 2010; Lan et al. 2011). Additionally, monkey kidney (Vero) and baby hamster kidney fibroblasts (BHK-21) are also susceptible to PSVs where a CPE characterised by cell shrinkage, rounding and detachment is commonly seen after 3–5 passages. Recently, a human hepatocarcinoma cell line, PLC/PRF/5, is normally used to isolate the hepatitis E virus, from swine faecal specimens serendipitously isolated from Japanese PSV strain (Bai et al. 2018). Cultured PSVs are generally identified by using virus neutralisation (VN) (Sozzi et al. 2010) and immunofluorescence antibody (IFA) assays (Son et al. 2014). However, these methods are costly, less specific, labour intensive and time consuming. Several molecular methods like reverse transcription PCR (RT-PCR), nested reverse transcription PCR (nRT-PCR) and real-time quantitative PCR have been developed for PSV detection (Zell et al. 2000; Palmquist et al. 2002; Krumbholz et al. 2003). Table 14.1 depicts the list of assays with target genes and primer sequences used by researchers in detecting PSVs. These molecular methods are specific, sensitive and rapid and do not cross-react with other common pathogens of porcine diseases including pseudorabies virus, porcine reproductive and respiratory syndrome, porcine parvovirus, porcine coronavirus, porcine reovirus or picorna-like virus (Palmquist et al. 2002). Real-time PCR assays developed for the detection of PSVs from field samples could detect a range of 102–103 copies of DNA (Chen et al. 2014; Kumari et al. 2019). Both these real-time PCR assays utilised the TaqMan chemistry, which is quite specific. Another sensitive diagnostic available for PSV is reverse transcription loop-mediated isothermal amplification (RT-LAMP) that was developed by Wang et al. (2014) with a detection limit of ten copies of DNA. All these easy, rapid and sensitive diagnostics will help in better understanding of the epidemiology of PSV and find a better way for prevention.
Table 14.1

RT-PCR assays used for detection of PSVs

Assays

Primer sequence (5′–3′)

Targeted gene

References

RT-PCR

FP-CCCTGGGACGAAAGAGCCTG

5′UTR

Zell et al. (2000)

RP-CCTTTAAGTAAGTAGTAAAGGG

nRT-PCR

FP-CCAAGATTAGAAGTTGATTTG

RP-GGGTAGCCTGCTGATGTAGTC

Duplex PCR for PTV and PSV

FP-GTGGCGACAGGGTACAGAAGAG

5′UTR

Palmquist et al. (2002)

RP-GGCCAGCCGCGACCCTGTCAG

RT-PCR (genotyping)

FP-AGGATGTGGTGCAAGCAAGCAT

VP1

Son et al. (2014)

RP-AGGCAGCACCGTTCTGGTCAA

RT-LAMP

FP-CCATACCCTACCCTCCCTTC

5′UTR

Wang et al. (2014)

RP-GCCCATAGTTCACTGCCTAC

Real-time RT-PCR

FP-GGCAGTAGCGTGGCGAGC

5′UTR

Chen et al. (2014)

RP-CTACTCTCCTGTAACCAGT

Minor groove-binding Taqman probe—CGATAGCCATGTTAGTG

Real-time RT-PCR

FP-GGAAACCTGGACTGGGYCT

5′UTR

Kumari et al. (2018)

RP-ACACGGGCTCTCTGTTTCTT

Taqman probe—CCAGCCGCGACCCTATCAGG

14.10 Immunity

There is little information available on the immune response to PSVs. The humoral response is primarily based on the IgA. A study done on porcine intestinal epithelial cells (IPEC-J2) reveals the role of PSV infection in changing the innate immune response pathway (Lan et al. 2013). The study shows both upregulation (e.g. TLR3) and downregulations (e.g. TLR4) of several innate immune system molecules (Lan et al. 2013). Maternal antibodies proved not to be protective in the case of transplacental infection (Huang et al. 1980). Seropositive gilts when inoculated intrauterinely and intravaginally resulted in embryonic and foetal infection (Huang et al. 1980). Though maternal antibody in the colostrums is believed to be protective infections are found in post-weaning animals (Schock et al. 2014). As of now, there is no vaccine available for PSVs.

14.11 Conclusion and Prospects

Although PSV is widely distributed all over the world among the porcine population, detailed information is lacking about their evolutionary pattern and mechanisms driving their divergence. However, precise data about the prevalence of PSV infections and the genetic diversity of this virus in pigs and wild boars have been reported only in a limited number of countries. Moreover, the association of co-infections with other enteric pathogens is exactly not known which raises ambiguity in the pathogenic potential of PSVs. Several recent findings on recombination events between PSV strains emphasise to study genetic variability among PSVs.

Notes

Acknowledgements

All the authors of the manuscript thank and acknowledge their respective universities and institutes.

Conflict of interest: There is no conflict of interest.

References

  1. Arruda PH, Arruda BL, Schwartz KJ, Vannucci F, Resende T, Rovira A, Sundberg P, Nietfeld J, Hause BM (2016) Detection of a novel sapelovirus in central nervous tissue of pigs with polioencephalomyelitis in the USA. Transbound Emerg Dis 64(2):311–315CrossRefGoogle Scholar
  2. Bai H, Liu J, Fang L, Kataoka M, Takeda N, Wakita T, Li TC (2018) Characterization of porcine sapelovirus isolated from Japanese swine with PLC/PRF/5 cells. Transbound Emerg Dis 65(3):727–734CrossRefGoogle Scholar
  3. Buitrago D, Cano-Gomez C, Aguero M, Fernandez-Pacheco P, Gomez-Tejedor C, Jimenez-Clavero MA (2010) A survey of porcine picornaviruses and adenoviruses in fecal samples in Spain. J Vet Diagn Investig 22(5):763–766CrossRefGoogle Scholar
  4. Cano-Gomez C, Garcia-Casado MA, Soriguer R, Palero F, Jimenez-Clavero MA (2013) Teschoviruses and sapeloviruses in faecal samples from wild boar in Spain. Vet Microbiol 165(1-2):115–122CrossRefGoogle Scholar
  5. Chen J, Chen F, Zhou Q, Li W, Chen Y, Song Y, Zhang X, Xue C, Bi Y, Cao Y (2014) Development of a minor groove binder assay for real-time PCR detection of porcine Sapelovirus. J Virol Methods 198:69–74CrossRefGoogle Scholar
  6. Chen JW, Chen F, Zhou QF, Li W, Song Y, Pan Y, Zhang X, Xue C, Bi Y, Cao Y (2012) Complete genome sequence of a novel porcine sapelovirus strain YC2011 isolated from piglets with diarrhea. J Virol 86(19):10898–10898CrossRefGoogle Scholar
  7. Donin DG, Leme RD, Alfieri AF, Alberton GC, Alfieri AA (2014) First report of porcine teschovirus (PTV), Porcine sapelovirus (PSV) and Enterovirus G (EV-G) in pig herds of Brazil. Trop Anim Health Prod 46(3):523–528CrossRefGoogle Scholar
  8. Donin DG, Leme RD, Alfieri AF, Alberton GC, Alfieri AA (2015) Molecular survey of porcine teschovirus, porcine sapelovirus, and enterovirus G in captive wild boars (Sus scrofa scrofa) of Parana state, Brazil. Pesq Vet Bras 35(5):403–408CrossRefGoogle Scholar
  9. Forman AJ, Pass DA, Connaughton ID (1982) The characterisation and pathogenicity of porcine enteroviruses isolated in Victoria. Aust Vet J 58(4):136–142CrossRefGoogle Scholar
  10. Horak S, Killoran K, Leedom Larson KR (2016) Porcine sapelovirus. Swine Health Information Center and Center for Food Security and Public Health. http://www.cfsph.iastate.edu/pdf/shic-factsheet-porcine-sapelovirus
  11. Huang J, Gentry RF, Zarkower A (1980) Experimental infection of pregnant sows with porcine enteroviruses. Am J Vet Res 41(4):469–473PubMedGoogle Scholar
  12. Huson DH, Bryant D (2006) Application of phylogenetic networks in evolutionary studies. Mol Biol Evol 23(2):254–267CrossRefGoogle Scholar
  13. Kim DS, Son KY, Koo KM, Kim JY, Alfajaro MM, Park JG, Hosmillo M, Soliman M, Baek YB, Cho EH, Lee JH (2016) Porcine sapelovirus uses α2, 3-linked sialic acid on GD1a ganglioside as a receptor. J Virol 90(8):4067–4077CrossRefGoogle Scholar
  14. Krumbholz A, Dauber M, Henke A, Birch-Hirschfeld E, Knowles NJ, Stelzner A, Zell R (2002) Sequencing of porcine enterovirus groups II and III reveals unique features of both virus groups. J Virol 76(11):5813–5821CrossRefGoogle Scholar
  15. Krumbholz A, Wurm R, Scheck O, Birch-Hirschfeld E, Egerer R, Henke A, Wutzler P, Zell R (2003) Detection of porcine teschoviruses and enteroviruses by LightCycler real-time PCR. J Virol Methods 113(1):51–63CrossRefGoogle Scholar
  16. Kumari S, Ray PK, Singh R, Desingu PA, Sharma GT, Saikumar G (2018) Development of a Taqman-based real-time PCR assay for detection of porcine sapelovirus infection in pigs. Anim Biotechnol:1–4.  https://doi.org/10.1080/10495398.2018.1549561. (Epub ahead of print)
  17. Kumari S, Ray PK, Singh R, Desingu PA, Varshney R, Saikumar G (2019) Pathological and molecular investigation of porcine sapelovirus infection in naturally affected Indian pigs. Microb Pathog 127:320–325CrossRefGoogle Scholar
  18. La Rosa G, Muscillo M, Di Grazia A, Fontana S, Iaconelli M, Tollis M (2006) Validation of RT-PCR assays for molecular characterization of porcine teschoviruses and enteroviruses. J Vet Med B Infect Dis Vet Public Health 53(6):257–265CrossRefGoogle Scholar
  19. Lan D, Tang C, Yue H, Sun H, Cui L, Hua X, Li J (2013) Microarray analysis of differentially expressed transcripts in porcine intestinal epithelial cells (IPEC-J2) infected with porcine sapelovirus as a model to study innate immune responses to enteric viruses. Arch Virol 158(7):1467–1475CrossRefGoogle Scholar
  20. Lan DL, Ji WH, Yang SX, Cui L, Yang Z, Yuan C, Hua X (2011) Isolation and characterization of the first Chinese porcine sapelovirus strain. Arch Virol 156(9):1567–1574CrossRefGoogle Scholar
  21. Li L, Shan T, Wang C, Côté C, Kolman J, Onions D, Gulland FM, Delwart E (2011) The fecal viral flora of California sea lions. J Virol 85(19):9909–9917CrossRefGoogle Scholar
  22. Palmquist JM, Munir S, Taku A, Kapur V, Goyal SM (2002) Detection of porcine teschovirus and enterovirus type II by reverse transcription-polymerase chain reaction. J Vet Diagn Investig 14(6):476–480CrossRefGoogle Scholar
  23. Piorkowski G, Capai L, Falchi A, Casabianca F, Maestrini O, Gallian P, Barthélémy K, Py O, Charrel R, De Lamballerie X (2018) First identification and genomic characterization of a porcine sapelovirus from Corsica, France, 2017. Microbiol Resour Announc 7(11):e01049–e01018CrossRefGoogle Scholar
  24. Ray PK, Desingu PA, Kumari S, John JK, Sethi M, Sharma GK, Pattnaik B, Singh RK, Saikumar G (2018) Porcine sapelovirus among diarrhoeic piglets in India. Transbound Emerg Dis 65(1):261–263CrossRefGoogle Scholar
  25. Schock A, Gurrala R, Fuller H, Foyle L, Dauber M, Martelli F, Scholes S, Roberts L, Steinbach F, Dastjerdi A (2014) Investigation into an outbreak of encephalomyelitis caused by a neuroinvasive porcine sapelovirus in the United Kingdom. Vet Microbiol 172(3–4):381–389CrossRefGoogle Scholar
  26. Shan TL, Li LL, Simmonds P, Wang CL, Moeser A, Delwart E (2011) The fecal virome of pigs on a high-density farm. J Virol 85(22):11697–11708CrossRefGoogle Scholar
  27. Son KY, Kim DS, Kwon J, Choi JS, Kang MI, Belsham GJ, Cho KO (2014) Full-length genomic analysis of Korean porcine sapelovirus strains. PLoS One 9(9):11CrossRefGoogle Scholar
  28. Sozzi E, Barbieri I, Lavazza A, Lelli D, Moreno A, Canelli E, Bugnetti M, Cordioli P (2010) Molecular characterization and phylogenetic analysis of VP1 of porcine enteric picornaviruses isolates in Italy. Transbound Emerg Dis 57(6):434–442CrossRefGoogle Scholar
  29. Wang CY, Yu DY, Cui L, Hua X, Yuan C, Sun H, Liu Y (2014) Rapid and real-time detection of Porcine Sapelovirus by reverse transcription loop-mediated isothermal amplification assay. J Virol Methods 203:5–8CrossRefGoogle Scholar
  30. Yang T, Yu X, Yan M, Luo B, Li R, Qu T, Luo Z, Ge M, Zhao D (2017) Molecular characterization of Porcine sapelovirus in Hunan, China. J Gen Virol 98(11):2738–2747CrossRefGoogle Scholar
  31. Zell R, Krumbholz A, Henke A, Birch-Hirschfeld E, Stelzner A, Doherty M, Hoey E, Dauber M, Prager D, Wurm R (2000) Detection of porcine enteroviruses by nRT-PCR: differentiation of CPE groups I-III with specific primer sets. J Virol Methods 88(2):205–218CrossRefGoogle Scholar
  32. Zhao T, Cui L, Yu X, Zhang Z, Shen X, Hua X (2019) Porcine Sapelovirus enters PK-15 cells via caveolae-dependent endocytosis and requires Rab7 and Rab11. Virology 529:160–168.  https://doi.org/10.1016/j.virol.2019.01.009CrossRefPubMedGoogle Scholar

Copyright information

© Springer Nature Singapore Pte Ltd. 2020

Authors and Affiliations

  • Yashpal Singh Malik
    • 1
  • Sudipta Bhat
    • 1
  • Anastasia N. Vlasova
    • 2
  • Fun-In Wang
    • 3
  • Nadia Touil
    • 4
    • 5
  • Souvik Ghosh
    • 6
  • Kuldeep Dhama
    • 1
  • Mahendra Pal Yadav
    • 1
    • 7
  • Raj Kumar Singh
    • 1
  1. 1.ICAR-Indian Veterinary Research InstituteIzatnagarIndia
  2. 2.Food Animal Health Research Program, Department of Veterinary Preventive Medicine, CFAES, Ohio Agricultural Research and Development Center, College of Veterinary MedicineThe Ohio State UniversityWoosterUSA
  3. 3.School of Veterinary MedicineNational Taiwan UniversityTaipeiTaiwan
  4. 4.Faculté de Médecine et de Pharmacie, Centre de Génomique des Pathologies Humaines (GENOPATH)Université Mohamed VRabatMorocco
  5. 5.Laboratoire de Biosécuritéet de RechercheHôpitalMilitaired’Instruction Med V de RabatRabatMorocco
  6. 6.Department of Biomedical Sciences, One Health Center for Zoonoses and Tropical Veterinary MedicineRoss University School of Veterinary MedicineBasseterreTrinidad and Tobago
  7. 7.Sardar Vallabhbhai Patel University of Agriculture & TechnologyMeerutIndia

Personalised recommendations