Table 1 List of primers used for PCR amplification of small subunit (SSU), internal transcribed spacer (ITS), and large subunit (LSU) rDNA.

From: Bringing Laboulbeniales into the 21st century: enhanced techniques for extraction and PCR amplification of DNA from minute ectoparasitic fungi

Locus Primer name   Sequence Reference
SSU rDNA NS1 forward GTAGTCATATGCTTGTCTC White et al. 1990
SSU rDNA NS2 reverse GGCTGCTGGCACCAGACTTGC White et al. 1990
SSU rDNA NS4 reverse CTTCCGTCAATTCCTTTAAG White et al. 1990
SSU rDNA SL344 forward GGTCGCAAGGCTGAAACTTA Landvik et al. 1997
SSU rDNA NS6 reverse GCATCACAGACCTGTTATTGCCTC White et al. 1990
SSU rDNA SL122 forward AGGCGCGCAAATTACCCAAT Landvik et al. 1997
SSU rDNA SR4 reverse AAACCAACAAAATAGAA R. Vilgalys unpublished
SSU rDNA NSL1 forward GTAGTGTCCTCrCATGCTTTTGAC present study
SSU rDNA NSL2 reverse AATCyAAGAATTTCACCTCTGAC present study
SSU rDNA L forward AACCTGGTTGATCCTGCCAGT Wrzosek 2000
SSU rDNA 402 forward GCTACCACATCCAAGGAAGGCA Wrzosek 2000
SSU rDNA 416 reverse ATTTGCGCGCCTGCTGCCTTCC Wrzosek 2000
SSU rDNA 895 forward GTCAGAGGTGAAATTCTTGGAT Wrzosek 2000
SSU rDNA 898 reverse TAAATCCAAGAATTTCACCTCT Wrzosek 2000
SSU rDNA 1144 forward GCCTGCGGCTTAATTTGACTCAACA Wrzosek 2000
SSU rDNA 1308 reverse CTCGTTCGTTAACGGAATTAACC Wrzosek 2000
SSU rDNA R reverse TGATCCTTCTGCAGGTTCACCTACG Wrzosek 2000
ITS rDNA ITS1f forward CTTGGTCATTTAGAGGAAGTAA Gardes & Bruns 1993
ITS rDNA ITS4 reverse TCCTCCGCTTATTGATATGC White et al. 1990
ITS rDNA ITS4_kyo1 reverse TCCTCCGCTTWTTGWTWTGC Toju et al. 2012
ITS rDNA ITS5 forward GGAAGTAAAAGTCGTAACAAGG White et al. 1990
ITS rDNA ITS2 reverse GCTGCGTTCTTCATCGATGC White et al. 1990
LSU rDNA LR0R forward ACCCGCTGAACTTAAGC R. Vilgalys unpublished
LSU rDNA LR1R forward AGGAAAAGAAACCAACC Moncalvo et al. 1993
LSU rDNA LIC24R forward GAAACCAACAGGGATTG Miadlikowska & Lutzoni 2000
LSU rDNA LR3 reverse GGTCCGTGTTTCAAGAC Vilgalys & Hester 1990
LSU rDNA LR5 reverse ATCCTGAGGGAAACTTC Vilgalys & Hester 1990
LSU rDNA LR7 reverse TACTACCACCAAGATCT Vilgalys & Hester 1990
LSU rDNA NL1 forward GCATATCAATAAGCGGAGGAAAAG Kurtzman & Robnett 1997
LSU rDNA NL4 reverse GGTCCGTGTTTCAAGACGG Kurtzman & Robnett 1997