Molecular characterization of the effect of plant-based elicitor using microRNAs markers in wheat genome

Abstract

Recent studies reported a significant contribution of microRNAs (miRNAs) in plant response to elicitors. The aim of our study was to analyse the effect of exogenously applied plant-derived elicitor cobalt-diglycyrrhizinate on Triticum aestivum L. genome based on the functional characterization of stress associated miRNAs. Our results confirmed the impact of cobalt-diglycyrrhizinate on plant genome in a way of plant response stimulation via expression of stress-related miRNAs markers. We found that both miRNAs markers (miR168 and miR395) are involved in response to plant-based elicitor stimuli. The role of miR168 and miR395 as functional markers sensitive to applied elicitors has been confirmed. Marker miR168 is suitable for the mapping of plant genome response to native elicitor, lower concentration of an elicitor is more suitable for plant immune system stimulation and its inappropriate concentrations may be toxic to the plant. Plant genome very sensitively reacts to elicitor stimuli and the question of the appropriate concentration and the time point of elicitor application are crucial.

Introduction

Plants are under constant threat of pathogens. Disease control is mostly based on chemical compounds which are toxic to plant itself, environment and human health. The hazardous effects of these chemicals strongly support the search for environmental-friendly strategies of bio-based means development for disease control (Thakur and Sohal 2013; Burketova et al. 2015).

The research of plant defense mechanisms led to the discovery of elicitors that induced similar defense responses as it was induced by pathogen infection. Treating the plants with elicitors in the absence of the pathogen can promote plant resistance (Gala et al. 2014; Oliveira et al. 2016). However, the plant responses are not universal and need further research prior the application in agricultural practice (Wiesel et al. 2014).

Elicitors are natural or synthetic compounds, which activate chemical defense in plants by means of production of phenolic compounds and activation of various defense-related enzymes in plants (Thakur and Sohal 2013). Elicitors act as signal molecules at low concentrations, providing information for the plant to trigger defense while employing their natural immune mechanism (Baldi et al. 2009). Exogenously applied plant-derived elicitors offer interesting approach for integrated pathogen management practices. Glycyrrhiza glabra L. commonly known as liquorice is an important medicinal plant of many therapeutic values (Wang et al. 2013; Damle 2014; Wang et al. 2015), containing phytoconstituents such as glycyrrhizin, glycyrrhetinic acid, glabrin A and B, liquiritigenin, locochalcone A and E and isoflavones (Badkhane et al. 2014; Damle 2014). Due to its remarkable biological activities has liquorice wide range of applications not only in traditional medicines and food industry, but also as a source of bio-based elicitors with promising application in crop protection as potential alternatives to synthetic fungicides (Badkhane et al. 2014; Wang et al. 2015). The extract of liquorice inhibits the growth and cytopathology of many unrelated DNA and RNA viruses as well as exhibits the effective antibacterial and antifungal activity due the presence of phytoterapeutical components (Wang et al. 2015; Chandra and Gunasekaran 2017). Glycyrhizine (glycyrrhizic acid; glycyrrhizinate), a saponin compound, constitutes 10–25% of liquorice root extract. Glycyrhizine is considered as quenching agent of free radicals and lipid peroxidation chain reactions. The products of synthetic transformations of glycyrrhizine are considered as new bioactive derivates with the wide range of applicability. The glycyrrhizine is presented in liquorice roots as mixed of potassium-calcium-magnesium salts (Baltina 2003; Baltina et al. 2009; Wang et al. 2015), however the ammoniated salt is manufactured from liquorice extract and used as food flavouring agent (Wang et al. 2000). The study of Wang et al. (2013) proposed that the presence of some elements as molybdenum (Mo) could promote the accumulation of glycyrrhizic acid. The derivates of glycyrrhizic acid and their salts are of the interest as potentially active substances with great prospects in medicine and agriculture (Baltina 2003; Damle 2014; Garrido-Gala et al. 2014;Graebin 2018) and the production of new derivates is considered as an important task (Wiessel et al. 2014).

The genomic changes as a response of plants to elicitor’s treatment are of great scientific interest. Samota et al. (2017) have reported significant increase in total phenolic content, antioxidant activity and expression of Rice Drought-responsive (RD1 and RD2) genes in seeds treated with hormonal or chemical elicitors. Similarly, increased production of secondary metabolites and PAL (phenylalanine ammonia lyase) gene expression have been recorded in the study of Govindaraju et al. (2016) due to the application of cytokinin combined elicitors on in vitro propagated plants explants. There have been performed several microarray studies reported up-regulation of defense responsive genes (Cluzet et al. 2004; Medeiros et al. 2009; Povero et al. 2011; Lavanya et al. 2016).

Recent studies reported a significant contribution of microRNAs in different biological and developmental processes of plants. MiRNAs are non-coding regulatory molecules of endogenous origin and short to length. Most interestingly, their role in plant response to biotic and abiotic stress factors is indisputable (Bej and Basak 2014; Barciszewska-Pacak et al. 2015; Melnikova et al. 2016). Evidence is also accumulating for a role of pathogen-responsive miRNAs in plant protection mechanism (Baldrich et al. 2015; Wu et al. 2015; Kumar et al. 2017). The mechanism of action includes both a) modulation of targeted genes by miRNAs and b) accumulation of miRNAs in response to elicitor (Kruszka et al. 2014; Baldrich et al. 2015). When plants are treated with the elicitors in the absence of pathogen, the chromatin modification resulting in increased expression of transcription factors is one of the known responses (Shukla et al. 2008; Wiesel et al. 2014). Most of the miRNA target genes which encodes various transcriptional factors having important roles in biotic and abiotic stress response (Sunkar 2010; Bej and Basak 2014). Taken together, microRNAs molecules represent an integral part of stress response regulatory networks in plants.

Wheat (Triticum aestivum L.) is one of the most important cultivated crops. With wide range of uses wheat gained agronomically and nutritionally significant status, which is also of enormous economic importance. At the same time the wheat is under constant threat of pathogen attack, which considerably limits the potential opportunities of modern genotypes of intensive types. Major threat to wheat production is Leaf rust of wheat (Puccinia spp.) and Powdery mildew of grasses and cereals (Blumeria graminis (DC:) Speer) epidemics. Both types of pathogens bring about 10% annual losses globally (Dean et al. 2012; Wu et al. 2015). Although, many resistance genes have been identified and introgressed into cultivated forms of wheat, the resistance often breaks down due to flexibility of the pathogen genome. Therefore, exogenously applied plant-derived elicitors may provide promising alternative tool of environment-friendly plant protection system. However, knowledge of the mechanism of action of these elicitors is a necessary part of their full application in agricultural practice.

The aim of our study was to define the effect of exogenously applied plant-derived elicitor, cobalt-diglycyrrhizinate, on the wheat genome based on the functional characterization of stress associated miRNAs. The results confirmed the role of miR168 and miR395 as stress-sensitive markers to applied elicitor.

Material and methods

Plant material

The grains of Triticum aestivum L. variety Dustlik, originated from Uzbekistan were used in the study. Grains were surfaced sterilized in 0.1% (w/v) solution of mercuric chloride during 5 min, followed by sterilization in 70% (v/v) ethanol for 5 min and rinsed in sterile distilled water three times. Consequently, grains were immersed in the solution of the plant-based elicitor, cobalt-diglycyrrhizinate (Dalimov et al. 1999; Isaev et al. 1999; Patent CN104861016A 2015) of various concentrations (1%; 0.1%; 0.01% and 0.001% v/v) during 2 h. Different concentrations of the agent were prepared using the sterile distilled water. The procedure of seeds material preparation and fungicide stock solutions was carried out in flow laminar cabinet.

Establishment of in vitro cultivation

The grains were placed on Murashige and Skoog (1962) plant growth medium, under aseptic conditions, five grains per tissue culture vessel. In total, twenty grains per tested variant were used. The cultivation was carried out under controlled conditions (photoperiod 16/8 h day/night; 23 °C/20 °C and light intensity 50 μmol/m2/s). The germination of grains started after two days of cultivation.

Genomic DNA isolation

Pooled sample of 10 five-days old seedlings (first rinsed with water) were used to isolate the genomic DNA from roots and leaves by the Saghai-Maroof et al. (1984) method. The pool of tissues from ten plants was used for genomic DNA isolation. The quality and concentration of isolated DNA was checked by Nanophotometer P360 (Implen). For the microRNA-based markers assay was DNA diluted to the concentration of 70 ng/μL.

Total RNA isolation

Total RNA was isolated from pooled sample of 10 five-day old seedlings of wheat by Monarch® Total RNA Miniprep Kit (New England Biolabs). Isolated RNA was quantified by Nanophotometer P360 (Implen). The miRNAs were reverse transcribed (200 ng/μL) using a polyadenylation-based cDNA synthesis approach based on the miScript Plant RT Kit (Qiagen™). Firstly, an adaptor was ligated to the 3′ terminus of plant miRNAs. Following the ligation, reverse transcription was performed.

miRNA expression analysis by qRT-PCR

Amplification of analysed miRNA transcripts were performed by PowerUp SYBR Green Master Mix (Applied Biosystems™) using the 300 nmol/dm3 of both of the primers (miRNA specific combined with miRNA universal reverse one). Cell Division Control Protein (CDCP) was used as housekeeping gene with the primers designed by Paolacci et al. (2009). The following amplification profile was used: 50 °C 2 min, 95 °C 2 min, 40 cycles (95 °C for 15 s; 60 °C for 20 s; 72 °C for 20 s). Each sample was set up in triplicates and optimization reactions were performed.

miRNA-based markers assay

PCR-miRNA amplification was performed in a 20 μL of total volume reaction mixture containing 70 ng of genomic DNA, 1× DreamTaq buffer (Thermo Scientific™), containing KCl, (NH4)2SO4 and 20 mmol/dm3 MgCl2, 1 U of Dream Taq DNA polymerase (Thermo Scientific™), 0.8 mmol/dm3 dNTP mix (Invitrogen™) and 0.4 μmol/dm3 of miR168 (5’CACGCATCGCTTGGTGCAGGT3´) and miR395 (5’CACGCACTGAAGTGTTTGGGG3´) forward primers and universal reverse primer (5’CCAGTGCAGGGTCCGAGGTA3´). The PCR amplification programme used the ´touchdown´ method as follows: initial denaturation at 94 °C for 5 min; 5 cycles of denaturation at 94 °C for 30 s, annealing at 64 °C for 45 s (with 1 °C decrease in annealing temperature per cycle) and 60 s at 72 °C; 30 cycles of 30 s at 94 °C, 45 s at 60 °C and 60 s at 72 °C and final extension for 10 min at 72 °C. The PCR-miRNA products were separated were firstly checked on 3% (w/v) agarose gel for the presence of amplified products and consequently loaded on 10% Novex®TBE-Urea gels together with 10 bp DNA ladder (Invitrogen™) running in 1 × TBE buffer at a constant power 180 V for 1.45 h. The optimization reactions were performed and amplification reactions were done in duplicates.

Data analysis

The PAGE gels were stained with the GelStar™ Nucleic Acid Gel Stain (supplied as a 10,000× concentrated stock solution) for 20 min. Both agarose and polyacrylamide gels were visualized in the G-Box Syngene electrophoresis documentation system. For the recording of individual tracks fragments profiles were gels analysed by the GeneTools software (Syngene). Each fragment is characterized by quantity and volume of its profile in pixels. Profiles are recorded on the basis of set threshold value in which the analysis is carried out. Statistical analysis of the data from miRNA-marker assay were evaluated by software Statgraphics version 5.0. Comparison of expression levels of analysed miRNAs to the control was performed by ∆∆Ct method (Kenneth et al. 2001).

Results

MiRNA-based markers assay

For the analysis of the effect of cobalt-diglycyrrhizinate, a liquorice-based elicitor, on the wheat genome, two types of conserved miRNAs families have been chosen. The miR168 and miR395 families are considered as the biomarkers of plant stress response. Increasing concentration of applied elicitor statistically significantly affected the amplification profile of miR168 and miR395 marker in the roots and leaves comparing to the control sample. The genome response to exogenously applied elicitor was more sensitive in roots than in leaves although this tissue-specific effect was not statistically significant (P > 0.05). The genomic changes as a response of plants to elicitor treatment were evaluated by comparing the DNA fragment profiles of individual lines of electrophoreograms (Fig. 1) by the GeneTools software (Syngene), while the profiles are recorded on the basis of set threshold value. The polymorphism could be observed in (a) the amount, (b) spatial distribution and (c) more importantly, the intensity of amplified fragments represented by the covered area of individual peaks. In regard to control samples, tested variants with 1% (v/v) and 0.1% (v/v) concentration of elicitor were provenly distinguishable in term of the amount, spatial distribution and the intensity of amplified fragments. This pattern profile was recorded in leaves as well as in roots samples but root samples were characterized by a more sensitive reaction compared to the above-ground part of the plant.

Fig. 1
figure1

Profiles of miR168 loci in leaves of wheat seedlings after treatment by cobalt diglycyrrhizinate detected by GeneTool software (Syngene): A - control, B - E - various concentrations of fungicide (1%, 0.1%, 0.01% and 0.001% v/v)

MiRNA expression analysis by qRT-PCR

Expression analysis of miR168 performed in the study resulted in the average Cts of the analysed treatments ranged from 27.63 up to the 28.69 with the standard deviation ranged from the 0.24 up to the 0.66. Expression analysis of miR395 was lower with the average Cts of the analysed treatments ranged from the 34.86 up to the 35.52 with the standard deviation ranged from the 0.35 up to the 1.52.

In both of the analysed miRNAs, expression level was decreased for the treatment of 1% cobalt-diglycyrrhizinate (11.76% for miR168 and 1.5% for miR395). Treatment of the concentrations of cobalt-diglycyrrhizinate 0.1% and 0.01% oscillated compared with the control variants. Increasing of miRNAs expression level was obtained in the case of the lowest concentration of cobalt-diglycyrrhizinate, specifically in the level of 1.87% for miR168 and 9.52% for miR395 (Figs. 2 and 3).

Fig. 2
figure2

Changes of the expression levels of miR168 wheat leaves after treatment by cobalt diglycyrrhizinate calculated by ∆∆Ct method for various concentrations of fungicide (1%, 0.1%, 0.01% and 0.001% v/v)

Fig. 3
figure3

Changes of the expression levels of miR395 wheat leaves after treatment by cobalt diglycyrrhizinate calculated by ∆∆Ct method for various concentrations of fungicide (1%, 0.1%, 0.01% and 0.001% v/v)

Discussion

Based on the several studies (Bej and Basak 2014; Barciszewska-Pacak et al. 2015) as well as our previous research, where the role of stress-sensitive microRNAs markers (miR168 and miR395) to abiotic stress were confirmed at the molecular level (Hlavačková and Ražná 2015), we decided to apply these markers in characterization the effect of externally applied plant-derived elicitor on wheat genome. Short molecules of microRNA (20–24 nt) play critical roles in development and nutrient homeostasis and they are involved in plant immunity. They have important regulatory function in gene expression mechanism under biotic and abiotic stress (Barvkar et al. 2013; Baldrich et al. 2014; Erson-Bensan 2014). This idea was supported by Wiesel et al. (2014) who identified the most over-represented biological processes as a response to elicitor treatment. They include response to stimulus (elicitor treatment), multi-organism process and immune system process. The response to stimulus contained 36.5% of the elicitor responsive genes.

Another results showed that plants exposure to plant-derived elicitor affected the genome response. Molecular marker miR168 sensitively reflected to different concentrations of elicitor, and this response was tissue-specific, what was confirmed by several experiments (Xie et al. 2010; Jones-Rhoades et al. 2006; Ražná et al. 2015).

Observed polymorphism on the genomic level characterized by specific profile of individual miRNAs-DNA fragments allowed us to identify the abundance level of individual miRNAs markers. Our results support the propose of Fu et al. (2013) who declared that the primers based on miRNA-sequences combining with different places of the same stem-loop structure can produce fragments which allow distinguishing individual genotypes. On the other site, the observed polymorphism may indicate sequence changes in the miRNA loci, which may result in modification of regulation pattern of targeted processes (Fu et al. 2013; Htwe et al. 2015) by miR168 and miR395 in the context of applied elicitor. Based on our data we can conclude that marker miR168 is suitable for the mapping of plant genome response to native elicitors. As it was confirmed by several studied, the micro-RNA-based molecular markers approach is well established due to high conservation of microRNA sequences, high reproducibility, polymorphism, efficiency and good transferability across different species (Mondal and Ganie 2014; Yadav et al. 2014; Bošeľová et al. 2016; Ražná et al. 2018).

There are several studies dealing with the transcriptome analysis (Cluzet et al. 2004; Povero et al. 2011) and microRNA-mediated plant response considering externally applied elicitors (Qiu et al. 2009; Zhao et al. 2012; Baldrich et al. 2015). The specificity of some miRNAs families to individual abiotic and biotic stress factors has been revealed by many studies and experiments. Differential expression pattern of miR168 and miR395 applied in our research is corresponding to their role in plant processes regulatory mechanisms. The function of miR168 in plant is very extensive. One of the target sequences of miR168 family are sequences of cytochrome P450 which is involved in a wide range of biosynthetic reactions. The regulation role of miR168 in connection to ARGONAUTE1 (AGO1) protein is crucial for plant development (Vaucheret et al. 2006). AGO1 is the most important AGO protein in the miRNA pathway. It is responsible for the cleavage or inhibition of RNAs target sequences (Várallyay et al. 2010). However, it was found that miR168 family can be considered as the biomarker of plant stress response (Sunkar 2010; Begheldo et al. 2014; Bej and Basak 2014; Barcizsewska-Pacak et al. 2016; Melnikova et al. 2016). Markedly increased accumulation of miR168 in virus-infected plants observed by Várallyay et al. (2010) indicating its importance in virus-infection process.

Our results of quantitative Real-Time PCR demonstrated the up-regulation of miR168 under treatment by elicitor of concentrations lower than 1% (Fig. 2). These outputs are supported by the experiment of Garrido-Gala et al. (2014) where higher concentration (0.1%) of natural elicitor inhibited the gene expression of selected defence related genes, however lower concentration (0.05%) stimulated the gene expression. Based on observed negative correlation between the expression of miR168 and the level of elicitor concentration, we assumed that lower concentration of an elicitor is more suitable for plant immune system stimulation and its inappropriate concentrations may be toxic to the plant. Down-regulation of miR168 under 1% concentration of applied elicitor presented almost 12% compared to control. This level of sensitivity was much stronger than in miR395, where presented less than 2% (Fig. 3). This observation correlates with the research of Baldrich et al. (2014) who indentified elicitor responsive element (ERE; TTGACC) within promoter of MIR168 gene. It should also be noted that an important factor influencing the genome response will also be the duration of elicitor action on biological material. In our case the seeds were exposed to elicitor during two hours and after that they were placed on agarose cultivation medium, where after 5 days of cultivation were taken samples of leaves for nucleic acids extraction. In the study of the above-mentioned authors, the 5-days-old callus cell cultures were exposed to elicitor treatment and collected every 2 h for 0 to 8 h. The highest expression level was detected after 2 or 4 h depending on analysed gene. Baldrich et al. (2014) revealed increase on the accumulation of miR168 precursors (pre-miR168a and pre-miR168b) at 30 min of elicitor treatment. This information confirms that plant genome very sensitively reacts to elicitor stimuli and the question of the appropriate concentration and the time point of elicitor application are crucial.

MiR395 plays the crucial role in sulphate homeostasis through regulating the sulphate uptake, transport and assimilation (Liang and Yu 2010). Plant sulphur in its reduced form is found mainly in amino acids, peptides and proteins (Kruszka et al. 2012). Under sulphate starvation conditions is miR395 up-regulated (Jones-Rhoades and Bartel 2004). Our results showed almost 10% up-regulation of miR395 comparing to the control under the lowest (0.001%) concentration of elicitor treatment (Fig. 3). The observation corresponds to the results of Li et al. (2017) who confirmed the involvement of miR395 in stress response due to many stress-responsive cis-elements which were found in the promoter regions of MIR395 genes. The puzzle of miR395 behaviour towards the elicitor treatment might well be completed by the results of Melnikova et al. (2015), who reported statistically significant up-regulation for miR395 under excessive fertilizer. According to their findings the expression level of miR395 could be associated not only with excess of sulphur application, but also with redundancy of other macronutrients and micronutrients, which in our case was represented by the cobalt element in diglycyrrhizinate.

Our results showed the impact of plant-derived elicitor, cobalt-diglycyrrhizinate on plant genome in a way of plant response stimulation via expression of stress-related miRNAs markers. As a downstream effect of differentially expressed miRNAs can be observed plant protection response. Abiotic stress up-regulated miRNAs are expected to target negative regulators of stress responses or positive regulators of processes that are inhibited by the stress (Meyers and Green 2010). Indirect correlation between the abundance of miRNAs and the expression level of their target sequences is characteristic feature of some miRNAs families which include the miR168 and miR395 applied in this study (Neutelings et al. 2012; Barvkar et al. 2013).

Wiesel et al. (2014) mentioned that due to elicitor treatment of plants in the absence of pathogen, the chromatin modifications take place which can lead to increased expression of some transcription factors. Based upon existing knowledge, the transcription factors are one of the targeted sequences of microRNAs molecules (Meyers and Green 2010; Baldrich et al. 2015). Taken together, the up-regulation of miR168 observed due to elicitor effect is connected with the activation of responsive transcription factors related to plant stress response. The outputs of the research are also in line with the conclusions of Beldrich et al. (2014) who confirmed that miR168 gene is transcriptional regulated by fungal elicitors and hence functioning in the response of plants to fungal elicitors.

Glycyrrhizic acid is the major bioactive triterpene glycoside of licorice root extracts possessing a wide range of biological properties which make these extracts potential alternatives to synthetic fungicides (Wang et al. 2015). The positive effect of glycyrrhizin in plant defence response is supported by the transcriptome analysis of Glycyrrhiza uralensis Fisch. which has revealed 16 genes associated with biosynthesis of glycyrrhizic acid. Based on gene ontology annotations were characterized almost 46% of genes belonging to biological process category which included mainly genes incorporated in the plant response to different stimulus and immune system process (Liu et al. 2015). Obviously, there are several parameters which could be tested in order to improve plant defence response, such as contact time with elicitor for maximal response in terms of accumulation of necessary compounds (Baldi et al. 2009; Thakur and Sohal 2013). It is also important to take into account the concentration of elicitors which differ with the type and nature of elicitor (Baldi et al. 2009, Govindaraju and Indra Arulselvi 2016; Samota et al. 2017).

In conclusion, this study has found that both miRNAs markers (miR168 and miR395) are involved in response to plant-based elicitor stimuli. Our results confirmed the role of miR168 and miR395 as a functional marker sensitive to exogenously applied elicitors.

Abbreviations

miRNA:

MicroRNA

qRT-PCR:

Quantitative real-time polymerase chain reaction

CDCP:

Cell division control protein

TBE:

Tris-borate EDTA

PAGE:

Polyacrylamide gel electrophoresis

Ct:

Cycle threshold

References

  1. Badkhane Y, Yadav AS, Bajaj A, Sharma AK, Raghuwanshi DK (2014) Glycyrrhiza glabra L. a miracle medicinal herb. Indo am. j. pharm. res 4:5808–5816

    Google Scholar 

  2. Baldi A, Srivastava AK, Bisaria VS (2009) Fungal elicitors for enhanced production of secondary metabolites in plant cell suspension cultures. In: Varma A, Kharkwal AC (eds) Symbiotic Fungi: soil biology 18. Springer-Verlag, Berlin Heidelberg, pp 373–380

    Google Scholar 

  3. Baldrich P, Kakar K, Siré C, Moreno AB, Berger A, García-Chapa M, López-Moya JJ, Riechmann JL, Segundo BS (2014) Small RNA profiling reveals regulation of Arabidopsis miR168 and heterochromatic siRNA415 in response to fungal elicitors. BioMed Central Genomics 15:1083. https://doi.org/10.1186/1471-2164-15-1083

    CAS  Article  PubMed  Google Scholar 

  4. Baldrich P, Campo S, Wu MT, Liu TT, Hsing YIC, Segundo BS (2015) MicroRNA-mediated regulation of gene expression in the response of rice plants to fungal elicitors. RNA Biol 12:847–863. https://doi.org/10.1080/15476286.2015.1050577

    Article  PubMed  PubMed Central  Google Scholar 

  5. Baltina LA (2003) Chemical modification of glycyrrhizic acid as a route to new bioactive compounds for medicine. Curr Med Chem 10:155–171. https://doi.org/10.2174/0929867033368538

    CAS  Article  PubMed  Google Scholar 

  6. Baltina LA, Kondratenko RM, Baltina LA, Baschenko NZ, Pliasunova OA (2009) Synthesis and biological activity of new glycyrrhizic acid conjugates with aminoacids and dipeptides. Bioorg Khim 35:563–571. https://doi.org/10.1134/S1068162009040141

    CAS  Article  PubMed  Google Scholar 

  7. Barciszewska-Pacak M, Milanowska K, Knop K, Bielewicz D, Nuc P, Plewka P, Pacak AM, Vazquez F, Karlowski W, Jarmolowski A, Szweykowska-Kulinska Z (2015) Arabidopsis microRNA expression regulation in a wide range of abiotic stress responses. Front Plant Sci 6:140. https://doi.org/10.3389/fpls.2015.00410

    Article  Google Scholar 

  8. Barvkar VT, Pardeshi VC, Kale SM, Qiu S, Rollins M, Datla R, Gupta VS, Kadoo NY (2013) Genome-wide identification and characterization of microRNA genes and their targets in flax (Linum usitatissimum): characterization of flax miRNA genes. Planta 237:1149–1161. https://doi.org/10.1007/s00425-012-1833-5

    CAS  Article  PubMed  Google Scholar 

  9. Bej S, Basak J (2014) MicroRNAs: the potential biomarkers in plant stress response. Am J Plant Sci 5:748–759. https://doi.org/10.4236/ajps.2014.55089

    CAS  Article  Google Scholar 

  10. Begheldo M, Nonis A, Trevisan S, Ruperti B, Quaggiotti S (2014) The dynamic regulation of microRNAs circuits in plant adaptation to abiotic stresses: a survey on molecular, physiological and methodological aspects. Environ Exp Bot 144:65–79. https://doi.org/10.1016/j.envexpbot.2014.05.011

    CAS  Article  Google Scholar 

  11. Bošeľová D, Žiarovská J, Hlavačková L, Ražná K, Bežo M (2016) Comparative analysis of different methods of Hedera helix DNA extraction and molecular evidence of the functionality in PCR. Acta Fytotechn Zootechn 19:144–149. https://doi.org/10.15414/afz.2016.19.04.144-149

    Article  Google Scholar 

  12. Burketova L, Trda L, Ott PG, Valentova O (2015) Bio-based resistance inducers for sustainable plant protection against pathogens. Biotechnol Adv 33:994–1004. https://doi.org/10.1016/j.biotechadv.2015.01.004

    CAS  Article  PubMed  Google Scholar 

  13. Chandra JH, Gunasekaran H (2017) Screening of phytochemical, antimicrobial and antioxidant activity of Glycyrrhiz glabra root extract. J Environ Biol 138:161–165. https://doi.org/10.22438/jeb/38/1/MRN-441

    Article  Google Scholar 

  14. Cluzet S, Torregrosa C, Jacquet C, Lafitte C, Fournier J, Mercier L, Salamagne S, Briand X, Esquerré-Tugayé MT, Dumas B (2004) Gene expression profiling and protection of Medicago truncatula against a fungal infection in response to an elicitor from green algae Ulva spp. Plant Cell Environ 27:917–928. https://doi.org/10.1111/j.1365-3040.2004.01197.x

    CAS  Article  Google Scholar 

  15. Dalimov DM, Isaev YT, Askarov IR (1999) Synthesis of some biogenic metal diglycyrrhizinate derivatives and their complex compounds with ammonia and ethylendiamine. Uzb khim zh:24–25. https://doi.org/10.1080/10426500490463664

  16. Dalme M (2014) Glycyrrhiza glabra (Liquorice) - a potent medical herb. Int J Herb Med 2:132–136

    Google Scholar 

  17. Dean R, van Kan JAL, Pretorius ZA, Hammond-Kosack KE, Di Pietro A, Spanu PD, Rudd JJ, Dickman M, Kahmann R, Ellis J, Foster GD (2012) The top 10 fungal pathogens in molecular plant pathology. Mol Plant Pathol 13:414–430. https://doi.org/10.1111/j.1364-3703.2011.00783.x

    Article  PubMed  PubMed Central  Google Scholar 

  18. Erson-Bensan AE (2014) Introduction to MicroRNAs in biological systems. In: Yousef M, Allmer J (eds) MiRNomics: MicroRNA biology and computational analysis. Springer Science + Business Media, New York, pp 1–14

    Google Scholar 

  19. Fu D, Ma B, Mason AS, Xiao M, We L, An Z (2013) MicroRNA-based molecular markers: a novel PCR-based genotyping technique in Brassica species. Plant Breed 132:375–381. https://doi.org/10.1111/pbr.12069

    CAS  Article  Google Scholar 

  20. Garrido-Gala J, Frías V, Perdices-Hoyo M, Hernández-Ros JM, Rodríguez-Olmos Á, Copa-Patiño JL, Muñoz-Blanco J, Caballero JL (2014) Natural elictors of plant defense response in strawberry. J Berry Res 4:37–45. https://doi.org/10.3233/JBR-140064

    CAS  Article  Google Scholar 

  21. Gala GJ, Frías V, Hoyo MP, Hern JM, Ros A, Rodr A, Olmosb I, Pati JLC, Blanco JM, Caballero JL, Soliverib J (2014) Natural elicitors of plant defense response in strawberry. J Berry Res 4:37-45. https://doi.org/10.3233/JBR-140064

  22. Govindaraju S, Indra Arulselvi P (2016) Effect of cytokinin combined elicitors (l-phenylalanine, salicylic acid and chitosan) on in vitro propagation, secondary metabolites and molecular characterization of medicinal herb–Coleus aromaticus Benth (L). J Saudi Soc Agri Sci. https://doi.org/10.1016/j.jssas.2016.11.001

  23. Hlavačková L, Ražná K (2015) Polymorphism of specific miRNAs in the context of flax (Linum usitatissimum L.) genome adaptability to abiotic stress. In: Book of Abstracts. 22th Conference "MendelNet 2015". Mendelova univerzita, Brno, November 11–12, 2015. pp. 416–420.

  24. Htwe NMPS, Luo ZQ, Jin LG, Nadon B, Wang KJ, Qiu LJ (2015) Functional marker development of miR1511-InDel and allelic diversity within the genus Glycine. BMC Genomics 16:467. https://doi.org/10.1186/s12864-015-1665-3

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  25. Isaev YI, Dalimov DN, Askrov IR (1999) Synthesis of deglycyrrhizinates of some microelements. Chem prirod sed. Special edition. 71–72

  26. Jones-Rhoades MW, Bartel DP (2004) Computational identification of plant microRNAs and their targets, including a stress-induced miRNA. Mol Cell 14:787–799. https://doi.org/10.1016/j.molcel.2004.05.027

    CAS  Article  PubMed  Google Scholar 

  27. Jones-Rhoades MW, Bartel DP, Bartel B (2006) MicroRNAs and their regulatory roles in plants. Annu rev plant biol 57:19–53. https://doi.org/10.1146/annurev.arplant.57.032905.105218

    CAS  Article  PubMed  Google Scholar 

  28. Kruszka K, Pieczynski M, Windels D, Bielewicz D, Jarmolowski a, Szweykowska-Kulinska Z, Vazquez F (2012) role of microRNAs and other sRNAs of plants in their changing environments. J Plant Physiol 169:1664–1672. doi: https://doi.org/10.1016/j.jplph.2012.03.009

  29. Kruszka K, Pacak A, Swida-Barteczka A, Nuc P, Alaba S, Wroblewska Z, Karlowski W, Jarmolowski A, Szweykowska-Kulinska Z (2014) Transcriptionally and post-transcriptionally regulated microRNAs in heat stress response in barley. J Exp Bot 65:6123–6135. https://doi.org/10.1093/jxb/eru353

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  30. Kumar D, Dutta S, Singh D, Prabhu KV, Kumar M, Mukhopadhyay K (2017) Uncovering leaf rust responsive miRNAs in wheat (Triticum aestivum L.) using high-throughput sequencing and prediction of their targets through degradome analysis. Planta 245:161–182. https://doi.org/10.1007/s00425-016-2600-9

    CAS  Article  PubMed  Google Scholar 

  31. Lavanya SN, Niranjan-Raj S, Amruthesh KN (2016) Transcript profiling of vital defense proteins upregulated during 3, 5-dichloroanthranilic acid (DCA) mediated induced resistance against pearl millet downy mildew disease. Int J Life Sci 5:46–54

    Google Scholar 

  32. Li L, Yi H, Xue M, Yi M (2017) miR398 and miR395 are involved in response to SO2 stress in Arabidopsis thaliana. Ecotoxicology 26:1181–1187. https://doi.org/10.1007/s10646-017-1843-y

    CAS  Article  PubMed  Google Scholar 

  33. Liang G, Yu D (2010) Reciprocal regulation among miR395, APS and SULTR2;1 in Arabidopsis thaliana. Plant Signal Behav 5:1257–1259. https://doi.org/10.4161/psb.5.10.12608

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  34. Liu Y, Zhang P, Song M, Hou J, Qing M, Wang W, Liu C (2015) Transcriptome analysis and development of SSR molecular markers in Glycyrrhiza uralensis Fisch. PLoS One 10:e0143017. https://doi.org/10.1371/journal.pone.0143017

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  35. Medeiros F, Resende M, Medeiros F, Zhang H, Paré P (2009) Defense gene expression induced by a coffee-leaf extract formulation in tomato. Physiol Mol Plant Pathol 74:175–183. https://doi.org/10.1016/j.pmpp.2009.11.004

    CAS  Article  Google Scholar 

  36. Melnikova NV, Dmitriev AA, Belenikin MS, Speranskaya AS, Krinitsina AA, Rachinskaia AA, Lakunina VA, Krasnov GS, Snezhkina AV, Sadritdinova AF, Uroshlev LA, Koroban NV, Samatadze NV, Amosova AV, Zelenin AV, Muravenko OV, Bolsheva NL, Kudryavtseva AV (2015) Excess fertilizer response miRNAs revealed in Linum usitatissimum L. Biochemie 109:36–41. https://doi.org/10.1016/j.biochi.2014.11.017

    CAS  Article  Google Scholar 

  37. Melnikova NV, Dmitriev AA, Belenikin MS, Koroban NV, Speranskaya AS, Krinitsina AA, Krasnov GS, Lakunina VA, Snezhkina AV, Sadritdinova AF, Kishlyan NV, Rozhmina TA, Klimina KM, Amosova AV, Zelenin AV, Muravenko OV, Bolsheva NL, Kudryavtseva AV (2016) Identification, expression analysis, and target prediction of flax genotroph micrornas under normal and nutrient stress conditions. Front Plant Sci 7:399. https://doi.org/10.3389/fpls.2016.00399

    Article  PubMed  PubMed Central  Google Scholar 

  38. Meyers BC, Green PJ (Eds.) (2010) Plant MicroRNAs, Methods and Protocols. Humana Press, New York, NY, 267 p.

  39. Mondal TK, Ganie SA (2014) Identification and characterization of salt responsive miRNA-SSR markers in rice (Oryza sativa). Gene 535:204–209. https://doi.org/10.1016/j.gene.2013.11.033

    CAS  Article  PubMed  Google Scholar 

  40. Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tabacco tissue cultures. Physiol plant 15:473–497. https://doi.org/10.1111/j.1399-3054.1962.tb08052.x

    CAS  Article  Google Scholar 

  41. Neutelings G, Fénart S, Lucau-Danila A, Hawkins S (2012) identification and characterization of miRNAs and their potential targets in flax. J Plant Physiol 169:1754–1766. https://doi.org/10.1016/j.jplph.2012.06.011

    CAS  Article  PubMed  Google Scholar 

  42. Oliveira MDM, Varanda CMR, Félix MRF (2016) Induced resistance during the interaction pathogen x plant and the use of resistance inducers. Phytochem Lett 15:152–156. https://doi.org/10.1016/j.phytol.2015.12.011

    CAS  Article  Google Scholar 

  43. Patent CN104861016A. Glycyrrhizic acid metal complex preparation method. 2015. https://patents.google.com/patent/CN104861016A/en

  44. Povero G, Loreti E, Pucciariello C, Santaniello A, Di Tommaso D, Di Tommaso G, Kapetis D, Zolezzi F, Piaggesi A, Perata P (2011) Transcript profiling of chitosan-treated Arabidopsis seedlings. J Plant Res 124:619–629. https://doi.org/10.1007/s10265-010-0399-1

    CAS  Article  PubMed  Google Scholar 

  45. Qiu D, Pan X, Wilson IW, Li F, Liu M, Teng W, Zhang B (2009) High throughput sequencing technology reveals that the taxoid elicitor methyl jasmonate regulates microRNA expression in Chinese yew (Taxus chinensis). Gene 436:37–44. https://doi.org/10.1016/j.gene.2009.01.006

    CAS  Article  PubMed  Google Scholar 

  46. Ražná K, Nôžková J, Hlavačková L, Brutch N, Porokhovinova E, Shelenga T, Pavlov A (2015) Genotyping of flax genetic resources by miRNA-based molecular markers and morphology. Agriculture 61:129–138. https://doi.org/10.1515/agri-2015-0018

    Article  Google Scholar 

  47. Ražná K, Khasanova N, Ivanišová E, Davranov Q, Habán M (2018) Antioxidant properties of cumin (Bunium persicum Boiss.) extract and its protective role against ultrasound-induced oxidative stress tested by microRNA based markers. Potr S J F Sci 12:11–19. https://doi.org/10.5219/838

    Article  Google Scholar 

  48. Saghai-Maroof MA, Soliman KM, Jorgensen JA, Allard RW (1984) Ribosomal DNA spacer-length polymorphisms in barley: Mendelian inheritance, chromosomal location, and population dynamics. PNAS 81:8014–8018. https://doi.org/10.1073/pnas.81.24.8014

    CAS  Article  PubMed  Google Scholar 

  49. Samota MK, Sasi M, Awana M, Yadav OP, Mithra SVA, Tyagi A, Kumar S, Singh A (2017) Elicitor-induced biochemical and molecular manifestations to improve drought tolerance in rice (Oryza sativa L.) through seed-priming. Front plant Sci 8:934. https://doi.org/10.3389/fpls.2017.00934

    Article  PubMed  PubMed Central  Google Scholar 

  50. Shukla LI, Chinnusamy V, Sunkar R (2008) The role of microRNAs and other endogenous small RNAs in plant stress responses. Biochim Biophys Acta-Gene Regul Mech 1779:743–748. https://doi.org/10.1016/j.bbagrm.2008.04.004

    CAS  Article  Google Scholar 

  51. Sunkar R (2010) MicroRNAs with macro-effects on plant stress responses. Semin Cell Dev Biol 21:805–811. https://doi.org/10.1016/j.semcdb.2010.04.001

    CAS  Article  PubMed  Google Scholar 

  52. Thakur M, Sohal BS (2013) Role of elicitors in including resistance in plants against pathogen infection: a review. ISRN Biochem 2013:762412. https://doi.org/10.1155/2013/762412

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  53. Várallyay É, Válóczi A, Ágyi Á, Burgyán J, Havelda Z (2010) Plant virus-mediated induction of miR168 is associated with repression of ARGONAUTE1 accumulation. EMBO J 29:3507–3519. https://doi.org/10.1038/emboj.2010.215

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  54. Vaucheret H, Mallory AC, Bartel DP (2006) AGO1 homeostasis entails coexpression of MIR168 and AGO1 and preferential stabilization of miR168 by AGO1. Mol Cell 22:129–136. https://doi.org/10.1016/j.molcel.2006.03.011

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  55. Wang ZY, Athar M, Bickers DR (2000) Licorice in foods and herbal drugs. Chemistry, pharmacology, toxicology and uses. In: Mezza G, Oomah BD (eds) Herbs, Botanicals & Teas. Technomic Publishing Co. Inc, Lancaster, pp 321–353

    Google Scholar 

  56. Wang D, Pang YX, Wang WQ, Wan CY, Hou JL, Yu FL, Wang QL, Liu FB, Zhang XD (2013) Effect of molybdenum on secondary metabolic process of glycyrrhizic acid in Glycyrrhiza uralensis Fisch. Biochem Syst Ecol 50:93–100. https://doi.org/10.1016/j.bse.2013.03.045

    CAS  Article  Google Scholar 

  57. Wang L, Yang R, Yuan B, Liu Y, Liu C (2015) The antiviral and antimicrobial activities of licorice, a widely-used Chinese herb. Acta Pharm Sin B 5:310–315. https://doi.org/10.1016/j.apsb.2015.05.005

  58. Wiesel L, Newton AC, Elliott I, Booty D, Gilroy EM, Birch PRJ, Hein I (2014) Molecular effects of resistance elicitors from biological origin and their potential for crop protection. Front Plant Sci 5:655. https://doi.org/10.3389/fpls.2014.00655

    Article  PubMed  PubMed Central  Google Scholar 

  59. Wu F, Guo Q, Zhang W, Jin W (2015) Identification and analysis of powdery mildew-responsive miRNAs in wheat. J Phytopathol 163:264–270. https://doi.org/10.1111/jph.12315

    CAS  Article  Google Scholar 

  60. Xie Z, Khanna K, Ruan S (2010) Expression of microRNAs and its regulation in plants. Sem Cell Dev Biol 21:790–797. https://doi.org/10.1016/j.semcdb.2010.03.012

    CAS  Article  Google Scholar 

  61. Yadav CBY, Muthamilarasan M, Pandey G, Prasad M (2014) Development of novel microRNA-based genetic markers in foxtail millet for genotyping applications in related grass species. Mol Breed 34:2219–2224. https://doi.org/10.1007/s11032-014-0137-9

    CAS  Article  Google Scholar 

  62. Zhao JP, Jiang XL, Zhang BY, Su XH (2012) Involvement of microRNA-mediated gene expression regulation in the pathological development of stem canker disease in Populus trichocarpa. PLoS One 7:e44968. https://doi.org/10.1371/journal.pone.0044968

    CAS  Article  PubMed  PubMed Central  Google Scholar 

Download references

Funding

This work was supported by AgroBioTech Research Centre built in accordance with the project Building „AgroBioTech” Research Centre ITMS 26220220180, by project of Slovak ScientificAgency of Ministry of Education of the Slovak Republic, VEGA, No. 1/0849/18 and by project of The Slovak Research and Development Agency APVV-15-0156.

Author information

Affiliations

Authors

Corresponding author

Correspondence to Katarína Ražná.

Ethics declarations

Conflict of interest

The authors declare that they have no conflict of interest.

Additional information

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Ražná, K., Ablakulova, N., Žiarovská, J. et al. Molecular characterization of the effect of plant-based elicitor using microRNAs markers in wheat genome. Biologia (2020). https://doi.org/10.2478/s11756-020-00546-3

Download citation

Keywords

  • Plant elicitor
  • miR168; miR395
  • qRT-PCR
  • Triticum aestivum L