Advertisement

Molecular Medicine

, Volume 13, Issue 9–10, pp 542–550 | Cite as

Differences in Extracellular Matrix Production and Basic Fibroblast Growth Factor Response in Skin Fibroblasts from Sporadic and Familial Alzheimer’s Disease

  • Catia Bellucci
  • Cinzia Lilli
  • Tiziano Baroni
  • Lucilla Parnetti
  • Sandro Sorbi
  • Carla Emiliani
  • Eleonora Lumare
  • Paolo Calabresi
  • Stefania Balloni
  • Maria Bodo
Open Access
Research Article

Abstract

Extracellular matrix (ECM) molecules and growth factors, such as fibroblast growth factor (FGF), play a crucial role in Alzheimer’s disease (AD). The purpose of this investigation was to determine whether phenotypic alterations in ECM production are present in non-neuronal AD cells associated with different FGF expression and response. Synthesis of glycosaminoglycans (GAG) and collagen were measured in skin fibroblasts from patients with familial, sporadic AD (FAD and SAD respectively), and from age-matched controls by radiolabeled precursors. Proteoglycans (PG), metalloprotease (MMP)-1, and FGF gene expressions were measured by reverse transcription-polymerase chain reaction. The results showed different ECM neosynthesis and mRNA levels in the two AD fibroblast populations. FAD accumulated more collagen and secreted less GAG than SAD. Biglycan PG was upregulated in FAD while betaglycan, syndecan, and decorin were markedly downregulated in SAD fibroblasts. We found a significant decrease of MMP1, more marked in FAD than in SAD fibroblasts. Constitutive FGF expression was greatly reduced in both pathological conditions (SAD > FAD). Moreover, an inverse high affinity/low affinity FGF receptor ratio between SAD and FAD fibroblasts was observed. FGF treatment differently modulated ECM molecule production and gene expression in the two cell populations. These observations in association with the changes in FGF gene expression and in the FGF receptor number, suggest that cellular mechanisms downstream from FGF receptor binding are involved in the two different forms of AD.

Introduction

Alzheimer’s disease (AD) accounts for about 50 to 70 percent of dementia disorders. It is pathologically characterized by intracellular neurofibrillary tangles as the result of hyperphosphorylated microtubule-associated protein tau accumulation, as well as extracellular amyloid deposits, called senile plaques (1), with a progressive accumulation of insoluble amyloid in brain parenchyma and vasculature. Senile plaques are mainly composed of β-amyloid (Aβ) peptide which is generated by the anomalous endoproteolytic processing of the amyloid precursor protein (APP). The characteristic extracellular histopathological lesions due to the amyloid fibrils are the main cause of neurodegeneration. Only about ten percent of AD cases appear to be related to mutations in the APP gene or in the presenilin genes, PS1 or PS2 (2). The majority of adult onset AD cases are not genetically transmitted and are considered multifactorial sporadic type (SAD).

Great attention has been focused on the extracellular matrix (ECM) components present in the amyloid deposits. ECM is a complex network composed of an array of macromolecules important for the regulation of cell functions and tissue architecture. Its constituents such as laminin, collagen, fibronectin, glycosaminoglycans (GAG), proteoglycans (PGs), and metalloproteases (MMP) are involved in the formation of neuritic plaques because they regulate the amount of the amyloid precursor protein and its amyloidogenic fragments (3, 4, 5, 6, 7). In particular, fibronectin enhanced APP secretion, whereas laminin and collagen caused a decrease of accumulation of cellular mature APP and APP fragments (8). Laminin and type IV collagen have all been localized within the senile plaque as punctuate deposits (9). Several studies report that sulphated glycosaminoglycans also may be a key factor in the formation of neurofibrillary lesions in AD. Heparan sulphate PGs (HSPGs), in fact, act as nucleating agents in the formation of the diffuse amyloid deposits involved in the formation of the neuritic plaque in the brain of AD patients (10). HSPG and hyperphosphorylated tau co-exist in neurons at the earliest stages of neurofibrillary pathology. Furthermore, amyloidoses have been correlated with disordered processing of basement membrane heparan sulphate proteoglycans (11, 12, 13) and neuritic plaques were shown to be associated with immunoreactivity for dermatan sulphate, keratan sulphate, and chondroitin sulphate (14,15).

In the brain of AD patients, neurons and glial cells participate in a local inflammatory cascade by releasing cytokines such the tumor necrosis factor (TNF)-α, interleukin (IL)-1, transforming growth factor (TGF)-β, fibroblast growth factor (FGF) and other molecules such as metalloproteases, complement proteins, acute phase reactants, and oxygen radicals (16,17). An aberrant production of cytokines and growth factors by activated glial cells might result in facilitating the amyloidogenic pathway, leading to an overproduction of β-amyloid peptide (Aβ) in AD brains (18).

The basic fibroblast growth factor (bFGF or FGF2) possesses several effects on nervous and glial cells and it is presumed to play an important role in the development, maintenance, and wound healing in the brain (19). It activates the glial reaction in the injured brain, thus influencing the regulation of ECM components in the brain inflammatory process (20,21)

In the central nervous system, FGF is found in the cytoplasm and nucleus of neurons and astrocytes (22,23) and exerts its biological action through the binding with FGF receptors (FGFRs), identified as low- and high-affinity receptors (24). FGF2 was shown to be elevated in Alzheimer’s disease and localized in the plaques and neurofibrillary tangles (25). It enhances the basal level of promoter activity of the APP gene (26), moreover, FGF-HSPG binding plays a role in transforming normal soluble tau protein into insoluble paired helical filaments present in the neurofibrillary tangles (27), thus confirming the importance of the interaction between FGF and ECM in AD physiopathology.

Altered metabolic behavior in nonneuronal cells also has been demonstrated in AD patients (28). High levels of APP, for example, are found to be expressed in non-neural cell types, including skin fibroblasts, suggesting that a wide variety of non-neuronal cells are also capable of processing APP to produce β-amyloid (29). As a result of interaction between APP and ECM components, it has been suggested the possibility that the nucleation process in amyloid genesis might disturb the process of basement membrane formation, a phenomenon which is consistently found in amyloid deposits of non-nervous tissues such as skin (30), hepatic and splenic vasa (31), cardiac tissue, and medullary carcinoma (32), where abnormalities in ECM structure have occurred.

In addition, it has been suggested that amyloid fibril accumulation is only in part responsible for the neurodegeneration observed in AD. Other disease mechanisms include in fact apoptosis, aberrant calcium signaling and other disordered intracellular signaling such as the catenin/Wnt pathway in somatic cells from AD patients (33, 34, 35, 36, 37). For example, cultured skin fibroblasts from PS1 and PS2 mutation carriers showed altered calcium signaling (38), a greater DNA damage induced by oxidative injury (39), and higher spontaneous and chemically induced cytogenetic alterations (40) when compared with the control group.

In the light of these data, it was of interest to investigate whether AD may be associated also with changes in components of peripheral connective tissue. For this reason we performed an in vitro study on skin fibroblasts obtained from SAD and FAD Alzheimer patients and evaluated alterations in neosynthesis of ECM components (GAG, collagen, and PGs) and their phenotype, according to FGF2 treatment.

Quantitative monitoring of levels of mRNA encoding for FGF2, proteoglycans and metalloprotease (MMP)-1 was performed by RT-PCR analysis. The data were discussed in relation to the high and low-affinity FGF receptor numbers determined in both cell populations by a binding assay.

Methods

Cell Cultures

Primary human fibroblast cultures were obtained from skin biopsies of AD patients and from normal subjects at the Department of Neurology, University of Florence after informed consent was given from all subjects or, where appropriate, from their caregivers. Clinical assessment was done according to published guidelines (The Dementia Study Group of the Italian Neurological Society). AD patients included ten FAD patients (age range 60–75 years) bearing the PS-1 (Leu392Val) missense mutation and ten age-matched SAD subjects. As controls, skin biopsies obtained from ten age-matched normal subjects, carefully assessed to exclude any neurological disorder, were analyzed (41).

Primary cultures were performed in Department of Neurological and Psychiatric Sciences (Florence). Briefly, skin biopsies (3 mm punch) were collected from the volar side of the forearm. Each biopsy was cut into small pieces (around 0.5 mm) and seeded in 25 cm2 flasks. When the flasks became confluent, subcultures were made by seeding 150,000 cells/T25 flask (42).

For experimental procedure, human fibroblasts were cultured in serum free Dulbecco’s modified Eagle’s medium for 24 h (a culture interval needed to reach approximately 70 to 80 percent of confluence), with and without 20 ng/mL basic FGF (FGF2, Sigma Chemical Company, St. Louis, MO, USA).

The viability of the cells was estimated by examining their ability to exclude Trypan Blue (0.1 percent Trypan Blue in 0.9 percent NaCl).

Cell Number

To determine cell number, fibroblasts were harvested with PBS, sedimented by centrifugation at 450g and resuspended in 1 mL of medium. Tripan Blue was added to the cell suspension to obtain a final concentration of 2 mg/mL. Cells were incubated for five minutes at room temperature and the number of stained cells determined by counting with Burker’s camera.

GAG Synthesis

Control, SAD, and FAD fibroblasts were labeled with 5 nCi/mL of 3H-glucosamine hydrochloride (s.a. 29 Ci/mmol, Amersham Biosciences, Little Chalfont, UK) after being maintained for 24 h in serum-free DMEM with and without 20 ng/mL recombinant human FGF2. At the end of incubation, media was recovered separately and processed. Aliquots of 3H-labeled GAG from media were applied to a DE-52 cellulose anion exchange column. Individual GAGs were identified by their enzymatic susceptibility (43). Testicular hyaluronate lyase (beef, Miles Italiana S.p.A., Milano, Italy), streptomyces hyaluronate lyase (Streptomyces hyalurolyticus) (Seikagaku Kogyo Company, Tokyo), chondroitin AC-II lyase (Arthrobacter aurescens) (Seikagaku Kogyo Company) digestions were performed. Standard GAG (Sigma) were then added and precipitated with three volumes of five percent potassium acetate in ethanol. Radioactivity was measured in both supernatants (digested GAG) and pellet. Results are expressed as cpm/105 cells.

Collagen Synthesis

Control, SAD, and FAD fibroblasts were cultured for 24 h in serum-free DMEM with 50 µg/mL ascorbic acid and 50 µg/mL β-aminoproprionitrile fumarate with and without 20 ng/mL recombinant human FGF2 in the presence of 2 µCi/mL of 3H-labeled proline (s.a. 29 Ci/mmol, Amersham Biosciences). Collagen was extracted as described elsewhere (44). Results are expressed as cpm/105 cells. The specificity of the assay was verified by monitoring the susceptibility of precipitates to purified bacterial collagenase (Calbiochem-Novabiochem Co., CA, USA).

Detection of mRNA Levels for Betaglycan, Decorin, Syndecan, Biglycan, MMP1, and FGF2 by Real-Time PCR Analysis

Total RNA was isolated from control, SAD, and FAD fibroblasts by lysing the cells with Trizol reagent (Invitrogen, Paisley, Great Britain). The RNA was treated immediately with DNAse I (Invitrogen) and the integrity of the treated RNA was examined by detection of ribosomal RNA bands (28S and 18S) in ethidium bromide stained agarose gels. RNA was quantified by reading the optical density at 260 nm. One microgram of total RNA was subjected to reverse transcription (RT) in a final volume of 50 mL. Real-time PCR was performed using 1 mL of the cDNA prepared by the RT reaction (Table 1).
Table 1

Oligonucleotides Used for Real Time RT-PCR

MRNA

Sequence (5′-3′)

Product (bp)

GenBank Accession No.

betaglycan (sense)

CCTGTCATTCCCAGCATACAAT

363

XM001924

betaglycan (reverse)

ATCACCTGACTCCAGATCTTCATA

  

Decorin (sense)

GGCCACTATCATCCTCCTT

270

NM133503

Decorin (reverse)

TTGTTGTTTTGCAGGTCTAGC

  

syndecan (sense)

TCTGACAACTTCTCCGGCTC

210

NM001006946

syndecan (reverse)

CCACTTCTGGCAGGACTACA

  

biglycan (sense)

GCTCCGACCTGGGTCTGCTGAA

306

NM001711

biglycan (reverse)

ACTCCCTTGGGCACCTTGC

  

MMP-1 (sense)

CTCATGCTTTTCAACCAGGC

370

X05231

MMP-1 (reverse)

GTGCGCATGTAGAATCTGTC

  

FGF2 (sense)

AGTGTGTGCTAACCGTTACC

214

NM002006

FGF2 (reverse)

AAGTATAGCTTTCTGCCCAGG

  

β-actin (sense)

ACCTTCTACAATGAGCTGCG

197

NM001101

b-actin (reverse)

TCCATCACGATGCCAGTGGTA

  

Real-time PCR was carried out in an M×3000P cycler (Stratagene, Amsterdam, Netherlands) using FAM for detection and ROX as a reference dye. One step PCR was performed in 25 µl of Brilliant SYBR Green QPCR Master Mix (Stratagene) according to the manufacturer’s instructions. Product formation was monitored continuously with the fluorescent double-stranded DNA binding dye SYBR Green I at each annealing step. Immediately following the PCR, a melting curve was undertaken by raising the incubation temperature from 55° to 95°C to confirm amplification specificity. All samples and the templates for the standard curves were run in triplicate. The mRNA level for each sample was normalized against β-actin mRNA and expressed as fold changes versus the level observed in untreated control fibroblasts.

FGF2 Binding Assay

FGF2 receptor binding was performed as described elsewhere (45,46). Briefly, control, SAD, and FAD fibroblasts were incubated for two hours at 37°C in serum free DMEM with 0.15 percent gelatin before each experiment. Cells then were washed twice with cold phosphate-buffered saline (PBS) and 200 mL of cold MEM containing 25 mM Hepes pH 7.5 0.15 percent gelatin. Increasing concentration of [125I] FGF2 (0.1–10 ng/mL, Amersham Biosciences) were added to each well. Cells were incubated for two hours at 4°C on an orbital shaker.

To determine low affinity binding of FGF2, the cells were incubated twice for five minutes with cold PBS pH 7.5 containing 2 M NaCl and the cell extract was counted in a γ counter (Canberra Packard Central Europe GmbH, Schwadorf, Austria). Non-specific binding was estimated in the presence of 100-fold excess of unlabeled recombinant human FGF2 and subtracted from all data.

High affinity bound FGF2 was determined by sodium acetate 20 mM, NaCl 2 M pH 4.0 extraction. Receptor binding was normalized with respect to cell number, and analyzed with Scatchard method (47).

Statistical Analysis

Results reported in figures were the mean ± SD (standard deviation) of three independent experiments each performed in triplicate or quintuplicate (see legends) for n = 10 subjects for group. Statistical analysis was performed by analysis of variance (2-WAY ANOVA) followed by the Sheffe F-test.

Results

Cell Count

After 24 h of in vitro maintenance, there was an increase of cell number both in SAD and FAD fibroblasts (FAD > SAD) with respect to the controls (Figure 1). FGF treatment significantly enhanced cell number only in control and SAD fibroblasts (+52 percent and +31 percent respectively).
Figure 1

Cell number and FGF2 effects (+) on control (C), sporadic (SAD) and familial (FAD) Alzheimer’s disease fibroblasts. Fibroblasts were mantained in serum-free MEM for 24h with and without FGF2 (20 ng/ml). The values were the mean ± SD of three independent experiments each performed in quintuplicate for n=10 subjects for group. Data were analyzed by ANOVA. Differences vs. respective control; *F-test significant at 99%. Differences vs. respective untreated group; §F-test significant at 99%; ns = not significant.

GAG Synthesis

Total GAG production was considerably less both in SAD and FAD fibroblasts with respect to the control group (−72 percent about in both cell lines) (Figure 2). No significant differences were observed in total GAG synthesis between the two pathological populations, but there was a different GAG redistribution between the extracellular (secreted) and cellular compartment. SAD fibroblasts showed a greater content of cellular GAG (+126 percent), while FAD fibroblasts produced greater amounts of secreted GAG (+173 percent). FGF treatment strongly decreased cellular and secreted GAG in FAD fibroblasts (−41 percent and −75 percent, respectively) and increased GAG secretion in SAD fibroblasts (+35 percent), but it did not affect their total GAG production. In control group, cellular GAG was significantly upregulated by FGF which did not induce significant differences in total GAG production.
Figure 2

Cellular, secreted and total GAG production from control (C), sporadic (SAD) and familial (FAD) Alzheimer’s disease fibroblasts and FGF2 effects (+). The values were the mean ± SD of three independent experiments each performed in quintuplicate for n=10 subjects for group. Data were analyzed by ANOVA. Differences vs. respective control; *F-test significant at 99%. Differences vs. respective untreated group; §F-test significant at 99%; §§F-test significant at 95%; ns = not significant.

Collagen Synthesis

FAD fibroblasts produced significantly more collagen than control (+108 percent) and SAD fibroblasts (+211 percent) (Figure 3). FGF increased only the content of cellular collagen in SAD (+64 percent) without significantly affecting total collagen production and markedly increased the content of secreted collagen in FAD fibroblasts (+59 percent).
Figure 3

Cellular, secreted and total collagen production from control (C), sporadic (SAD) and familial (FAD) Alzheimer’s disease fibroblasts and FGF2 effects (+). The values were the mean ± SD of three independent experiments each performed in quintuplicate for n=10 subjects for group. Data were analyzed by ANOVA. Differences vs. respective control: *F-test significant at 99%; NS = not significant. Differences vs. respective untreated group: §st significant at 99%; §§F-test significant at 95%; ns = not significant.

Quantitation of Proteoglycans, MMP-1, and FGF2 Transcription by Real-Time PCR

To analyze proteoglycan, MMP-1, and FGF gene expression, total RNA samples were obtained from unstimulated and FGF-stimulated fibroblasts (see methods). Genes were analyzed by qRT-PCR and the results are shown in Figure 4.
Figure 4

Expression data (mRNA levels) for betaglycan, decorin, syndecan, biglycan, MMP1 and FGF2 obtained from control (C), sporadic (SAD) and familial (FAD) Alzheimer’s disease fibroblasts treated or not with FGF2 (+). The mRNA levels were quantified by real-time quantitative PCR. Values were the mean ± SD of three independent experiments each performed in triplicate for n=10 subjects for group. Data were analyzed by ANOVA. The results were expressed as fold change in β-actin normalized mRNA values. Differences vs. mRNA levels in each respective control; *F-test significant at 99%; **F-test significant at 95%; NS = not significant. Differences vs. mRNA levels in each untreated group; §F-test significant at 99%; ns = not significant

Adownregulation in expression of betaglycan and decorin was detected in SAD fibroblasts, while no significant differences were observed between FAD and control fibroblasts. Messenger RNA expression for syndecan was down regulated in both SAD and FAD fibroblasts. Biglycan expression was upregulated only in FAD fibroblasts. FGF treatment markedly decreased decorin and biglycan in SAD fibroblasts, and reduced betaglycan level in FAD fibroblasts. Syndecan expression was significantly downregulated in both SAD and FAD fibroblasts after FGF treatment.

MMP-1 expression was detectable in lower concentration in FAD fibroblasts when compared with control and SAD fibroblasts. FGF treatment induced a decrease of MMP-1 signal in control and FAD fibroblasts, and a three-fold increase of the MMP1 transcript level in SAD fibroblasts.

FGF2 mRNA showed a maximal downregulation in SAD fibroblasts when compared with control and FAD fibroblasts, being markedly upregulated by the addition of exogenous FGF On the contrary, FGF expression was significantly decreased in FGF-treated control and FAD groups.

Quantitative Analysis of FGF Receptors by Binding Assay

The Scatchard analysis shows the presence of a high affinity and a low affinity binding site. The low affinity receptor number (Figure 5) was +26 percent in SAD and about two-fold in FAD fibroblasts compared with control. FGF treatment induced an increase of the low affinity receptor density in the control and SAD fibroblasts, while it led to a clear decrease of these receptors’ density in FAD fibroblasts.
Figure 5

Scatchard analysis of 125I-FGF2 binding to low affinity receptors in control, sporadic (SAD) and familial (FAD) fibroblasts, and FGF2 effect. Specifically bound (B) anf free (F) ligands were measured as described in Materials and Methods. Values were the mean ±SD of three independent experiments each performed in triplicate for n=10 subjects for group. Difference vs. number of receptors in each respective control: *F-test significant at 99%. Differences vs. number of receptors in respective untreated group: §F-test significant at 99%; §§F-test significant at 95%.

Accordingly, the high affinity receptor/cell ratio showed a different trend (Figure 6). It was strongly enhanced in both pathological cell populations (SAD > FAD), increased by FGF in control group and decreased in both SAD and FAD fibroblasts.
Figure 6

Scatchard analysis of 125I-FGF2 binding to high affinity receptors in control, sporadic (SAD) and familial (FAD) fibroblasts, and FGF2 effect. Specifically bound (B) and free (F) ligands were measured as described in Materials and Methods. Values were the mean ± SD of three independent experiments each performed in triplicate for n=10 subjects for group. Difference vs. number of receptors in each respective control: *F-test significant at 99%. Differences vs. number of receptors in respective untreated group: §F-test significant at 99%; §§F-test significant at 95%.

Discussion

ECM components and FGF have been implicated in the formation of neurite plaques in Alzheimer’s disease (48,49). Different components of the ECM, such as HSPGs (9,10), laminin, fibronectin (50), and collagen (10) bind in fact secreted APP stimulating fibril nucleation and, acting as “seed molecules” (3), promote senile plaque formation. In addition, FGF-ECM binding regulates the amount of APP and its processing to amyloidogenic fragments in neuronal and non-neuronal cells (51).

Previous reports showed that lysosomal alterations were detectable not only in neurons but also in skin fibroblasts and lymphoblasts obtained from AD patients (41,52,53). In this report we carried out an investigation on ECM components using as cell model primary fibroblast cultures established from FAD patients mutated on PS1 gene, SAD cases, and cognitively normal controls.

The observed differences between each patient group and FGF effects are reported in the schematic Table 2.
Table 2

Summary of the Results

 

Control

SAD

FAD

Control +

SAD +

FAD +

Cell number

18,300

27,100

39,350

27,800

35,500

37,380

  

c.p.m./cell number × 105

   

Total GAG

30,700

8,420

8,350

33,230

8,808

3,050

Total Collagen

1,790

1,196

3,718

1,406

1,370

4,976

  

fold change

   

MMP1

1

0.31

0.058

0.505

1.12

0.059

Biglycan

1

1.07

1.38

0.69

0.533

1.88

Decorin

1

0.48

0.911

1.37

0.278

0.385

Betaglycan

1

0.63

0.932

0.63

0.69

0.33

Syndecan

1

0.401

0.57

1.12

0.495

0.455

FGF2

1

0.139

0.417

0.239

0.178

0.268

  

FGF2 receptor number

   

Low Affinity Receptor

308,781

396,178

625,076

378,663

483,859

422,697

High Affinity Receptor

5,435

11,640

7,476

7,267

8,920

5,980

The scheme summarizes the overall results discussed in the text.

Both pathological groups showed a greater proliferative rate compared with the control fibroblasts, but FAD evidenced about two-fold increase of cell number with respect to control and +45 percent than SAD fibroblasts. Total GAG were strongly decreased in SAD and FAD cells when compared with controls, with a cellular/secreted GAG ratio in favor of cell accumulation in SAD fibroblasts.

Collagen production was different in mutant and sporadic AD fibroblasts: SAD cells produced significantly less collagen, while FAD accumulated and secreted more collagen than controls.

MMP1 expression was decreased in both pathological populations but the decrease was more evident in FAD cells.

Adifferent regulation in PG expression also was detected and measured by realtime PCR. In SAD fibroblasts, decorin, betaglycan, and syndecan PGs appeared downregulated. Biglycan expression was not affected in SAD, but resulted upregulated in FAD fibroblasts.

We also provide evidence that mutant and wild type AD fibroblasts react differently to FGF treatment. FGF exerted a stimulating proliferative effect only in SAD fibroblasts, significantly reduced GAG production, and favored collagen synthesis only in FAD fibroblasts.

In light of our data, we suggest that changes in GAG production not only cause a reduced adhesiveness of skin fibroblasts (54), but also modulate APP effects on neuronal plasticity and Aβ neurotoxicity (4). The greater collagen production by FAD is another finding of interest because it has been reported that collagen can cause a decrease in secretion and accumulation of cellular mature APP (10).

Because biglycan and decorin are two PGs strictly related to collagen fibrillogenesis (55), the increase in collagen production that we observed in FAD fibroblasts could be mainly due to two mechanisms: the reduced expression of MMP-1 collagenase and biglycan upregulation. On the contrary, the decrease in collagen production observed in SAD fibroblasts might be associated with the reduced decorin expression.

Syndecans and betaglycan are cell surface HSPGs capable of binding ECM molecules via their covalently attached heparan sulfate chains. The different expression of syndecan and betaglycan in SAD and FAD cells also could be related to severity of AD. It has been suggested that sulphated PGs might have a neuroprotective effect, because it has been demonstrated that neurons and cortical areas show low susceptibility to neurofibrillary changes if high proportions of aggregating chondroitin sulphate proteoglycans are present in the neural microenvironment (4). The CSPGs content, for example, is inversely correlated with the amount of hyperphosphorylated tau in the brains of AD patients (56).

The above findings may be related to the different endogenous FGF expression and to FGF receptor number in the two pathological cell populations.

FGF2 mRNA constitutive level was differently expressed in SAD and FAD fibroblasts, being more expressed in FAD fibroblasts. The role of FGF in AD development is suggested by several contradictory reports. It has been demonstrated that FGF increases APP mRNA levels (57,58) but it protects neurons expressing mutant PS1 from exposures to excitotoxins, Aβ and reactive oxygen species (59, 60, 61, 62, 63). The different endogenous FGF expression that we observed in SAD and FAD fibroblasts might cause an imbalance within this protective system, thus explaining the biological differences between SAD and FAD degenerative processes (64).

Finally, while only FGF low affinity receptor numbers were more expressed in FAD cells, high affinity receptors were significantly higher in SAD and FAD cell when compared with controls. This result, in association with the finding that HSPG syndecan is reduced in SAD and FAD fibroblasts, could explain their higher proliferating state. Other authors showed a stimulating proliferative effect of HSPG on epithelial cells and a decreasing effect on mesenchymal cells (65).

Betaglycan and syndecan also are closely associated with FGF receptor. This spatial and functional relationship is very important for stabilizing FGF binding (66,67), modulating FGF activity, and transforming normal soluble proteins into insoluble paired helical filaments in AD (68,69) The different content in HSPGs that we observed in SAD and FAD fibroblasts could modulate FGF receptor binding differently and consequently could induce significant effects on neuroprotective action induced by PGs.

FGF treatment decreased both low and high affinity binding receptors in FAD fibroblasts, while it had a decreasing effect only in high affinity receptors in SAD cells. In FAD fibroblasts, a reduced neuro-protective action of FGF could be due to its parallel decreasing effect on both high and low affinity receptors.

Taken together, our data show for the first time a different ECM production in sporadic and familial Alzheimer’s disease skin fibroblasts, suggesting a link with connective tissue disease. The different effects of FGF on FAD and SAD fibroblast phenotype might involve molecular mechanisms downstream from FGF receptor binding. Together, the data provide new insight into the complex FGF response involved in the development of AD.

Notes

Acknowledgments

Supported by fundings from the University of Perugia, by the Italian Ministry of Instruction, University and Research (Grant 2005051707–005 and 2005062887–004) and by the Cassa di Risparmio of Florence (Grant 2003.1764).

References

  1. 1.
    Smith MA. (1998) Alzheimer disease. Int. Rev. Neurobiol. 42:1–54.CrossRefGoogle Scholar
  2. 2.
    Hardy J. (1997) Amyloid, the presenilins and Alzheimer’s disease. Trends Neurosci. 20:154–9.CrossRefGoogle Scholar
  3. 3.
    Castillo GM, Ngo C, Cummings J, Wight TN, Snow AD. (1997) Perlecan binds to the β-amyloid proteins (Aβ) of Alzheimer’s disease, accelerates Aβ fibril formation, and maintains Aβ fibril stability. J. Neurochem. 69:2452–65.CrossRefGoogle Scholar
  4. 4.
    Bruckner G, Hausen D, Harting W, Drlicek M, Arendt T, Brauer K. (1999) Cortical areas abundant in extracellular matrix chondroitin sulphate proteoglycans are less affected by cytoskeletal changes in Alzheimer’s disease. Neuroscience 92:791–805.CrossRefGoogle Scholar
  5. 5.
    Gerst JL et al. (2000) Altered cell-matrix associated ADAM proteins in Alzheimer disease. J. Neurosc. Res. 59:680–4.CrossRefGoogle Scholar
  6. 6.
    Ge YW, Lahiri DK. (2002) Regulation of promoter activity of the APP gene by cytokines and growth factors: implications in Alzheimer’s disease. Ann. N. Y. Acad. Sci. 973:463–7.CrossRefGoogle Scholar
  7. 7.
    Gilad GM, Kagan HM, Gilad VH. (2005) Evidence for increased lysyl oxidase, the extracellular matrix-forming enzyme, in Alzheimer’s disease brain. Neurosci. Lett. 376:210–4.CrossRefGoogle Scholar
  8. 8.
    Monning U, Sandbrink R, Weidemann A, Banati RB, Masters CL, Beyreuther K. (1995) Extracellular matrix influences the biogenesis of amyloid precursor protein in microglial cells. J. Biol. Chem. 270:7104–10.CrossRefGoogle Scholar
  9. 9.
    Berzin TM et al. (2000) Agrin and microvascular damage in Alzheimer’s disease. Neurobiol. Aging. 21:349–55.CrossRefGoogle Scholar
  10. 10.
    Van Horssen J et al. (2002) Collagen XVIII: a novel heparan sulfate proteoglycan associated with vascular amyloid depositions and senile plaques in Alzheimer’s disease brains. Brain Pathol. 12:456–62.CrossRefGoogle Scholar
  11. 11.
    Snow AD, Sekiguchi RT, Nochlin D, Kalaria RN, Kimata K. (1994) Heparan sulfate proteoglycan in diffuse plaques of hippocampus but not of cerebellum in Alzheimer’s disease brain. Am. J. Pathol. 144:337–47.PubMedPubMedCentralGoogle Scholar
  12. 12.
    Snow AD et al. (1995) Differential binding of vascular cell-derived proteoglycans (perlecan, biglycan, decorin and versican) to the beta amyloid protein of Alzheimer’s disease. Arch. Biochem. Biophys. 320:84–95.CrossRefGoogle Scholar
  13. 13.
    Snow AD, Wight TN. (1989) Proteoglycans in the pathogenesis of Alzheimer’s disease and other amyloidoses. Neurobiol. Aging. 10:481–97.CrossRefGoogle Scholar
  14. 14.
    DeWitt DA, Silver J, Canning DR, Perry G. (1993) Chondroitin sulfate proteoglycans are associated with the lesions of Alzheimer’s disease. Exp. Neurol. 121:149–52.CrossRefGoogle Scholar
  15. 15.
    Snow AD, Castillo GM. (1997) Specific proteoglycans as potential causative agents and relevant targets for therapeutic intervention in Alzheimer’s disease and other amyloidoses. Amyloid: Int. J. Exp. Clin. Invest. 4:135–41.CrossRefGoogle Scholar
  16. 16.
    Mattson MP et al. (1997) Cellular signaling roles of TGFβ, TNFα, and βAPP in brain injury responses and Alzheimer’s disease. Brain Res. Rev. 23:47–61CrossRefGoogle Scholar
  17. 17.
    Griffin WS et al. (1998) Glial-neuronal interactions in Alzheimer’s disease: the potential role of a “cytokine cycle” in disease progression. Brain Pathol. 8:65–72.CrossRefGoogle Scholar
  18. 18.
    Satoh J, Kuroda Y. (2000) Amyloid precursor proteinβ-secretase (BACE) mRNA expression in human neural cell lines following induction of neuronal differentiation and exposure to cytokines and growth factors. Neuropathology. 20: 289–96.CrossRefGoogle Scholar
  19. 19.
    Eckenstein FP. (1994) Fibroblast growth factors in the nervous system. J. Neurobiol. 25:1467–80.CrossRefGoogle Scholar
  20. 20.
    Eckenstein FP, Andersson C, Kuzis K, Woodward WR. (1994) Distribution of acidic and basic fibroblast growth factors in the mature, injured and developing rat nervous system. Prog. Brain Res. 103:55–64.CrossRefGoogle Scholar
  21. 21.
    Reier PJ, Houle J. (1988). The glial scar: its bearing on axonal elongation and transplantation approaches to CNS repair. Adv. Neurol. 47:87–138.PubMedGoogle Scholar
  22. 22.
    Ecklancher F, Kehrli P, Labourdette G, Sensenbrenner M. (1996) Basic fibroblast growth factor (bFGF) injection activates the glial reaction in the injured adult rat brain. Brain Res. 737:201–14.CrossRefGoogle Scholar
  23. 23.
    Kuzis K, Reed S, Cherry NJ, Woodward WR, Eckenstein FP. (1995) Developmental time course of acidic and basic fibroblast growth factors’ expression in distinct cellular populations of the rat central nervous system. J. Comp. Neurol. 358: 142–53.CrossRefGoogle Scholar
  24. 24.
    Johnson DE, Williams LT. (1993) Structural and functional diversity in the FGF receptor multigene family. Adv. Cancer Res. 60:1–41.PubMedGoogle Scholar
  25. 25.
    Stopa EG et al. (1990) Basic fibroblast growth factor in Alzheimer’s disease. Biochem. Biophys. Res. Commun. 171:690–6.CrossRefGoogle Scholar
  26. 26.
    Lahiri DK, Nall C. (1995) Promoter activity of the gene encoding the beta-amyloid precursor protein is up-regulated by growth factors, phorbol ester, retinoic acid and interleukin-1. Brain Res. Mol. Brain Res. 32:233–40.CrossRefGoogle Scholar
  27. 27.
    Perry G et al. (1991) Association of heparan sulfate proteoglycan with the neurofibrillary tangles of Alzheimer’s disease. J. Neurosci. 11:3679–83.CrossRefGoogle Scholar
  28. 28.
    Matsumoto A, Fujiwara Y. (1993) Aberrant proteolysis of the β-amyloid precursor protein in familial Alzheimer’s disease lympho-blastoid cells. Eur. J. Biochem. 217:21–7.CrossRefGoogle Scholar
  29. 29.
    Fukumoto H, Tomita T, Matsunaga H, Ishibashi Y, Saido TC, Iwatsubo T. (1999) Primary cultures of neuronal and non-neuronal rat brain cells secrete similar proportions of amyloid beta peptides ending at A beta40 and A beta42. Neuroreport. 10:2965–9.CrossRefGoogle Scholar
  30. 30.
    Horiguchi Y, Fine JD, Leigh IM, Yoshiki T, Ueda M, Imamura S. (1992) Lamina densa malformation involved in histogenesis of primary localized cutaneous amyloidosis. J. Invest. Dermatol. 99:12–8.CrossRefGoogle Scholar
  31. 31.
    Schultz RT, Pitha J. (1985) Relation of the hepatic and splenic microcirculations to the development of lesions in experimental amyloidosis. Am. J. Pathol. 119:127–37.PubMedPubMedCentralGoogle Scholar
  32. 32.
    Young ID, Willmer JP, Kisilevsky RI. (1989) The ultrastructural localization of sulfated proteoglycans is identical in the amyloids of Alzheimer’s disease and AA, AL, senile cardiac and medullary carcinoma-associated amyloidosis. Acta Neuropathol. 78:202–9.CrossRefGoogle Scholar
  33. 33.
    Czech C, Tremp G, Pradier L. (2000) Presenilins and Alzheimer’s disease: biological functions and pathogenic mechanisms. Prog. Neurobiol. 60:363–84.CrossRefGoogle Scholar
  34. 34.
    Hardy J, Selkoe DJ. (2002) The amyloid hypothesis of Alzheimer’s disease: progress and problems on the road to therapeutics. Science. 297:353–6.CrossRefGoogle Scholar
  35. 35.
    De Strooper B. (2003) Aph-1, Pen-2, and Nicastrin with Presenilin generate an active gamma-Secretase complex. Neuron. 38:9–12.CrossRefGoogle Scholar
  36. 36.
    Thinakaran G, Parent AT. (2004) Identification of the role of presenilins beyond Alzheimer’s disease. Pharmacol. Res. 50:411–8.CrossRefGoogle Scholar
  37. 37.
    Bertram L et al. (2005) Family-based association between Alzheimer’s disease and variants in UBQLN1. N. Engl. J. Med. 352:884–94.CrossRefGoogle Scholar
  38. 38.
    Li D et al. (2006) Mutations of presenilin genes in dilated cardiomyopathy and heart failure. Am. J. Hum. Genet. 79:1030–9.CrossRefGoogle Scholar
  39. 39.
    Uberti D et al. (2002) Selective impairment of p53-mediated cell death in fibroblasts from sporadic Alzheimer’s disease patients. J. Cell Sci. 115: 3131–8.PubMedGoogle Scholar
  40. 40.
    Trippi F et al. (2001) Spontaneous and induced chromosome damage in somatic cells of sporadic and familial Alzheimer’s disease patients. Mutagenesis. 16:323–7.CrossRefGoogle Scholar
  41. 41.
    Emiliani C et al. (2003) Up-regulation of glycohydrolases in Alzheimer’s disease fibroblasts correlates with Ras activation. J. Biol. Chem. 278:38453–60.CrossRefGoogle Scholar
  42. 42.
    Cecchi C et al. (2007) Increased susceptibility to amyloid toxicity in familial Alzheimer’s fibroblasts. Neurobiol. Aging. 28:863–76.CrossRefGoogle Scholar
  43. 43.
    Conrad GW, Hamilton C, Haynes E. (1977) Differences in glycosaminoglycans synthesized by fibroblast-like cells from chick cornea, heart, and skin. J. Biol. Chem. 252:6861–70.PubMedGoogle Scholar
  44. 44.
    Webster DF, Harvey W. (1979) A quantitative assay for collagen synthesis in microwell fibroblasts cultures. Anal. Biochem. 96:220–4.CrossRefGoogle Scholar
  45. 45.
    Moscatelli D. (1987) High and low affinity binding sites for basic fibroblast growth factor on cultured cells: absence of a role for low affinity binding in the stimulation of plasminogen activator production by bovine capillary endothelial cells. J. Cell Physiol. 131:123–30.CrossRefGoogle Scholar
  46. 46.
    Yayon A, Klagsbrun M, Esko JD, Leder P, Ornitz DM. (1991) Cell surface, heparin-like molecules are required for binding of basic fibroblast growth factor to his high affinity receptor. Cell. 64:841–8.CrossRefGoogle Scholar
  47. 47.
    Scatchard G. (1949) The attractions of proteins for small molecules and ions. Ann. NY Acad. Science. 51:660–72.CrossRefGoogle Scholar
  48. 48.
    Magnus JH, Stenstad T. (1997) Proteoglycans and the extracellular matrix in amyloidosis. Amyloid: Int. J. Exp. Clin. Invest. 4:121–34.CrossRefGoogle Scholar
  49. 49.
    Deininger MH, Fimmen BA, Thal DR, Schluesener HJ, Meyermann R. (2002) Aberrant neuronal and paracellular deposition of endostatin in brains of patients with Alzheimer’s disease. J. Neuroscience. 22:10621–6.CrossRefGoogle Scholar
  50. 50.
    Narindrasorasak S, Lowery DE, Altman RA, Gonzales DP, Greenberg B, Kisilevsky R. (1992) Characterization of high affinity binding between laminin and Alzheimer’s disease amyloid precursor proteins. Lab. Invest. 67:643–52.PubMedGoogle Scholar
  51. 51.
    Matsumoto A, Enomoto T, Fujiwara Y, Baba H, Matsumoto R. (1996) Enhanced aggregation of beta-amyloid-containing peptides by extracellular matrix and their degradation by the 68 kDa serine protease prepared from human brain. Neurosc. Lett. 220:159–62CrossRefGoogle Scholar
  52. 52.
    Cecchi C et al. (1999) Gluthatione level is altered in lymphoblasts from patients with familial Alzheimer’s disease. Neurosci. Lett. 275:152–4.CrossRefGoogle Scholar
  53. 53.
    Bagnoli S et al. (2002) Cathepsin D polymorphism in Italian sporadic and familial Alzheimer’s disease. Neurosci. Lett. 328:273–6.CrossRefGoogle Scholar
  54. 54.
    Fillit H, Leveugle B. (1995) Disorders of the extracellular matrix and the pathogenesis of senile dementia of the Alzheimer’s type. Lab. Invest. 72:249–53.PubMedGoogle Scholar
  55. 55.
    Kahari VM, Larjava H, Uitto J. (1991) Differential regulation of extracellular matrix proteoglycan (PG) gene expression. Transforming growth factor-beta 1 up-regulates biglycan (PGI), and versican (large fibroblast PG) but down-regulates decorin (PGII) mRNA levels in human fibroblasts in culture. J. Biol. Chem. 266:10608–15.PubMedGoogle Scholar
  56. 56.
    Stichel CC, Kappler J, Junghans U, Koops A, Kresse H, Muller HW. (1995) Differential expression of the small chondroitin/dermatan sulfate proteoglycans decorin and biglycan after injury of the adult rat brain. Brain Res. 704:263–74.CrossRefGoogle Scholar
  57. 57.
    Cosgaya JM, Latasa MJ, Pascual A. (1996) Nerve growth factor and ras regulate beta-amyloid precursor protein gene expression in PC12 cells. J. Neurochem. 67:98–104.CrossRefGoogle Scholar
  58. 58.
    Abe K, Saito H. (2001) Effects of basic fibroblast growth factor on central nervous system functions. Pharmacol. Res. 43:307–12.CrossRefGoogle Scholar
  59. 59.
    Furukawa K, Fu W, Li Y, Witke W, Kwiatkowski DJ, Mattson MP. (1997) The actin-severing protein gelsolin modulates calcium channel and NMDA receptor activities and vulnerability to excitotoxicity in hippocampal neurons. J. Neurosci. 17: 8178–86.CrossRefGoogle Scholar
  60. 60.
    Thorns V, Masliah E, (1999) Evidence for neuroprotective effects of acidic fibroblast growth factor in Alzheimer disease. J. Neuropathol. Exp. Neurol. 58:296–306.CrossRefGoogle Scholar
  61. 61.
    Masliah E et al. (1997) Amyloid precursor proteins protect neurons of transgenic mice against acute and chronic excitotoxic injuries in vivo. Neuroscience. 78:135–46.CrossRefGoogle Scholar
  62. 62.
    Guo Q et al. (1999) Neurotrophic factors (activity-dependent neurotrophic factor (ADNF) and basic fibroblast growth factor (bFGF)) interrupt excitotoxic neurodegenerative cascades promoted by a PS1 mutation. Proc. Natl. Acad. Sci. U. S. A. 96: 4125–30.CrossRefGoogle Scholar
  63. 63.
    Tsukamoto E, Hashimoto Y, Kanekura K, Niikura T, Aiso S, Nishimoto I. (2003) Characterization of the toxic mechanism triggered by Alzheimer’s amyloid-beta peptides via p75 neurotrophin receptor in neuronal hybrid cells. J. Neurosci. Res. 73:627–36.CrossRefGoogle Scholar
  64. 64.
    Mosconi L et al. (2003) Brain metabolic differences between sporadic and familial Alzheimer’s disease. Neurology. 61:1138–40.CrossRefGoogle Scholar
  65. 65.
    Flint N, Cove FL, Evans GS. (1994) Heparin stimulates the proliferation of intestinal epithelial cells in primary culture. J. Cell Sci. 107:401–11.PubMedGoogle Scholar
  66. 66.
    Klagsbrun M, Baird A. (1991) Adual receptor system is required for basic fibroblast growth factor activity. Cell. 67:229–31.CrossRefGoogle Scholar
  67. 67.
    Aviezer D et al. (1994) Differential structural requirements of heparin and heparin sulfate proteoglycans that promote binding of basic fibroblast growth factor to its receptor. J. Biol. Chem. 269:114–21.PubMedGoogle Scholar
  68. 68.
    Leveugle B et al. (1997) Heparin promotes betasecretase cleavage of the Alzheimer’s amyloid precursorprotein. Neurochem. Int. 30:543–8.CrossRefGoogle Scholar
  69. 69.
    Leveugle B et al. (1998) Heparin oligosaccharides that pass the blood-brain barrier inhibit β-amyloid precursor protein secretion and heparin binding to β-amyloid peptide. J. Neurochem. 70:736–44.CrossRefGoogle Scholar

Copyright information

© Feinstein Institute for Medical Research 2007

Authors and Affiliations

  • Catia Bellucci
    • 1
  • Cinzia Lilli
    • 1
  • Tiziano Baroni
    • 1
  • Lucilla Parnetti
    • 2
  • Sandro Sorbi
    • 3
  • Carla Emiliani
    • 1
  • Eleonora Lumare
    • 4
  • Paolo Calabresi
    • 2
  • Stefania Balloni
    • 1
  • Maria Bodo
    • 2
  1. 1.Department of Experimental Medicine and Biochemical SciencesUniversity of PerugiaPerugiaItaly
  2. 2.Department of Specialistic Medicine and Public Health, Neuroscience Clinical sectionUniversity of PerugiaPerugiaItaly
  3. 3.Department of Neurologic and Psychiatric SciencesUniversity of FirenzeFirenzeItaly
  4. 4.Forensic Medicine InstituteUniversity of PerugiaPerugiaItaly

Personalised recommendations