Table 1 List of Primers Used in Targeting Genes Encoding Efflux Pump and Biofilm Forming Ability

From: Molecular and phenotypic characterization of efflux pump and biofilm in multi-drug resistant non-typhoidal Salmonella Serovars isolated from food animals and handlers in Lagos Nigeria

Primer Sequence (5′-3′) Product Size (bp) Reference
acrA-FW
acrA -RV
CTCTCAGGCAGCTTAGCCCTAA
AACAGTCAAAACTGAACCTCTGCA
106 [14]
acrB-FW
acrB-RV
GGTCGATTCCGTTCTCCGTTA
ATGACGTTTACTTCCAGGTAG
104 [14]
acrD-FW
acrD-RV
AATTGTGCGTGAAGCGGT
GCTACAGCGCCATAGTAA
100 [15]
tolC-FW
tolC-RV
AAGCCGAAAAACGCAACCT
GATGGTCACTTACCGACTCTG
100 [14]
csgA-FW
csgA-RV
GCAATCGTATTCTCCGGTAG
GATGAGCGGTCGCGTTGTTA
418 [16]