Table 2 The primers used in this study

From: Direct RBS Engineering of the biosynthetic gene cluster for efficient productivity of violaceins in E. coli

Primer Characteristic Source
Vio-pETduet-PF gcgatcgctgacgtcggtaccATGAAGCATTCTTCCGATATCTGC This study
Vio-pETduet-PR tttaccagactcgagggtaccCTAGCGCTTGGCGGCGAAG This study
dVio-PR CGGTTCCCGGTTTTCCATCAGTTGACCCTCCCTATC This study
dVio-PF GATAGGGAGGGTCAACTGATGGAAAACCGGGAACCG This study
vioB-RBSm-PF1 CATGACCGTTCGGGGAGCACATGAGC This study
vioB-RBSm-PR1 AATGCTCATGTGCTCCCCGAACGGTC This study
vioB -RBSm-PF2 CATGACCGTTCAAGAAACACATGAGC This study
vioB-RBSm-PR2 AATGCTCATGTGTTTCTTGAACGGTC This study
vioB-RBSm-PF3 CATGACCGTTCAAGGAGCACATGAGC This study
vioB-RBSm-PR3 AATGCTCATGTGCTCCTTGAACGGTC This study
vioC-RBSm-PF TCTAGAGAGGCCTGATGAAAAGAGCAATC This study
vioC-RBSm-PR GATTGCTCTTTTCATCAGGCCTCTCTAGA This study
vioD-RBSm-PF1 TACAAGATAGGGAGGAACTGATGAAGATTC This study
vioD-RBSm-PR1 GAATCTTCATCAGTTCCTCCCTATCTTGTA This study
vioD-RBSm-PF2 TACAAGATAGGGAGGTGATGAAGATTCTGG This study
vioD-RBSm-PR2 CCAGAATCTTCATCACCTCCCTATCTTGTA This study
vioE-RBSm-PF GCTGCAACGCTGAAGGAGCCGCATGGAAAAC This study
vioE-RBSm-PR GTTTTCCATGCGGCTCCTTCAGCGTTGCAGC This study
tnaA-KO-us arm-PF TTGAGTATTATACTGTAG This study
tnaA-KO-us arm-PR GGTCGACGGATCCCCGGAATTGCCACCATTTTGCTGCG This study
tnaA-KO-PF GGATCGCAGCAAAATGGTGGCAATTCCGGGGATCCGTCGACC This study
tnaA-KO-PR CGCCAATCTCTTCCAGACCATCTGTAGGCTGGAGCTGCTTC This study
tnaA -KO-ds arm-PF GAAGCAGCTCCAGCCTACAGATGGTCTGGAAGAGATTG This study
tnaA-KO-ds arm-PR GGTGTTACCGATTAAATC This study
tnaA-KOV-PF TTGAGTATTATACTGTAG This study
tnaA-KOV-PR GCGTGATAGCCCAAATTC This study