Table 1 Primers used for real-time PCR

From: Chronic intermittent hypoxia promoted lung cancer stem cell-like properties via enhancing Bach1 expression

Genes Forward (5′-3′) Reverse (5′-3′)
GAPDH GCACCGTCAAGGCTGAGAAC TGGTGAAGACGCCAGTGGA
CD44
Sox2
Nanog
Oct4
CD133
GCATTGCAGTCAACAGTCGAAGA
GACAGTTACGCGCACATGAA
GTGATTTGTGGGCCTGA AGA
GGTATTCAGCCAAACGA CCA
GAACAGGGCTACTCGCAAAG
CCTTGTTCACCAAATGCACCA
TAGGTCTG CGAGCTGGTCAT
ACACAGCTGGGTGGAAGAGA
CACACTCGGACCACATCCTT
AAAGG GCAGTTGACGGAAC