Skip to main content

Table 1 Mini type I-F-carrying Tn7 R-end and L end attachment sites

From: CRISPR-Cas systems are present predominantly on mobile genetic elements in Vibrio species

Species/strain Insertion locus Right end (R) Left end (L) Tn7 size Cargo genes
V. cholerae
 DRAKES2103 SRP-RNA atctgtgtcgctgaaagcataaagtgtccaattta cgcataggacatcttatgctttcagcgacaatctg 27-kb RM1 system
 TP SRP-RNA tctgatgtttgcaaaataagttcgcataaattgca gctatgcagacttatgctgcaagcatcacatctga 35-kb RM1 system
 L15 SRP-RNA tctgatgtttgcaaaataagttcgcataaattgca   Short contig RM2 system
 HE-45 IMPDH acatttgttgatacaaccataaaatgataattaca attaaatatcactttatggttgcatcaacaacatt 36-kb RM3 system
V. parahaemolyticus
 RIMD2210633 yciA gagtttgtaaatacaaccatacattgcaacaatac tataaatgtcactttatggttgtatcaacagagtt 80-kb T3SS-2α
 BB22OP yciA gagtttgtaaatacaaccatacattgcaacaatac tataaatgtcactttatggttgtatcaacagagtt 80-kb T3SS-2α
 TH3996 yciA gagtttgtaaatacaaccatacattgcaacaatac tataaatgtcactttatggttgtatcaacagagtt 98-kb T3SS-2β
 MAVP-Q yciA tgagttgttgatacaaccataaaatgataattaca tataaatatcactttatggttgtatcaacatgagt 107-kb T3SS-2γ
 ISF-25-6 IMPDH aataatgttgaaacaaccataaattgatatttaca tacaattatcaatttatggttgtttcaacaaataa 35-kb RM4 system
 UCM-V493 SRP-RNA ctttatgaagcctgcaatatatgttcgcataaatt ggactatgctaaattacgttgcaggcatcacttta 20-kb  
 CFSAN007439 SRP-RNA ctttatgaagcctgcaatatatgttcgcataaatt ggactatgctaaattacgttgcaggcatcacttta 23-kb  
 CDC_K4762   ctttatgaagcctgcaatatatgttcgcataaatt   Short contig TA system
V. navarrensis
 ATCC 51183 SRP-RNA gagcttgaagaacgatgctgttgttcgcactctct tgtggcgaccaacttgccacaacccggtcagagct 51-kb RM system Type I-C CRISPR-Cas