Skip to main content

Table 1 List of primers for genes used in q-PCR analysis to validate RNA-seq data

From: Gene expression profiling of postnatal lung development in the marsupial gray short-tailed opossum (Monodelphis domestica) highlights conserved developmental pathways and specific characteristics during lung organogenesis

Gene Title Forward Primer Reverse Primer
MYOT GCCTCAGATGCAGGAACTTAT CCAGAATATCTTTGGTGGAGGT
DSG1 AAACTACCTCGAGTGGCGTG AACAGGCTCAAAGCCTCCTC
CA3 GCTTCACCTGGTTCACTGGA AAGCCGGGAAAAGGCAAGAT
SPINK5 GTGACCCTGTACGTGATGCT TGACTGGGTCACTCTCTCGT
SERPINC1 AGCAGCTCATGGAGGTGTTC AGCTTGGCTCCATATACCGC
18S CCCGAGAAGTTCCAGCACAT TGATAGTGATCACGCGCTCC
RPL19 GTATGGCTTGACCCCAACGA CTTCTCAGGCATACGGGCAT
PPIL4 ACAATGGCAGTGATCAACATGG AAGCCAGCTGGGTCATCAAA
ARSF ACATTCGCAGCCACCCTAAA AGGATCTGGCCAACAAGAGC
FGA CCCTCACAGAGAAGCAAGCA CATCATCACAGTCTCGGGCA
HPX CCGACGGTTTAACCCTGTGA CATCCCTCCCTGAGTCCAGA
HTRA1 CAGTAGCGAGCCGGTGTG TGGAAAAGGGTAGCTTGCGA
TNC GGCTTTAGCACACACCCTCT GGGTTTCAGCTTGGAGGTCA