Skip to main content

Table 4 Sequences and GenBank accession numbers of re-designed primers used for qPCR analysis during experiment 4.

From: Sequential analysis of global gene expression profiles in immature and in vitro matured bovine oocytes: potential molecular markers of oocyte maturation

Gene Forward 5'-3' Reverse 5'-3' Product size (bp) GenBank
ANXA1 ATGGTATCTGAATTCCTCAAGCAG TGCAAGGCCTCAACATCC 149 NM_175784
H2AFZ CGGAAAGGCCAAGACAAAG CTGAAATCTAGGACGACTAGCCAT 103 NM_174809
Luciferase TCCTCCAGGGATACGACAAG GGTATCCAGATCCACAACCTTC 139 EU684088
LUM CGAAAGCAGGGTCAAGACAG TGATGACCTCCCATACAGTGC 158 NM_173934
MAOA TGGCGGACCATGGATAAC AAACTGCCGAGCAGTCTTTG 138 NM_181014
PLAT TGTGGAGCTGTCTTCACGTC CGTGTTGGCGGTACGTC 118 NM_174146
PLAU CTGTGCCCTGGTCGTGAG GCAACTGCATCGCTGAATG 136 XM_174147
PPIA CCACCGTGTTCTTCGACATC CCAAATCCTTTCTCTCCAGTGC 130 NM_178320
SDHA GGGAGGACTTCAAGGAGAGG TCAACGTAGGAGAGCGTGTG 112 NM_174178
SERPINE1 CAGGCGGACTTCTCCAGTT CATTCGGGCTGAGACTACAAG 135 NM_174137
STC1 GTGACACAGATGGGATGTACGAC CGAATGGCCAGGAAGACC 142 NM_176669
TGFB2 AGGCCGAGTTCAGAGTCTTTC TGTAGCGCTGGGTTGGAG 117 NM_001113252
YWHAZ GCAGATGGCTCGAGAATACAG GAAGCGTTGGGGATCAAG 102 NM_174814