Skip to main content

Table 3 Sequences and GenBank accession numbers of primers used for qPCR analysis during experiment 2 and 3.

From: Sequential analysis of global gene expression profiles in immature and in vitro matured bovine oocytes: potential molecular markers of oocyte maturation

Gene Forward 5'-3' Reverse 5'-3' Product size (bp) GenBank
ANXA1 GAGGAAGTTGTTTTGGCTCTATTGA TGGCAGCACGGAGCTCTT 67 NM_175784
CDK1 TGGACAGTCAAATTAAGAAGATGTAGCT GTACAATTATCTGCTCTTGACACAACAC 72 NM_174016
CDK5 CCTGCTCATCAACAGGAATGG AAA GGC GCG AGC CAAAC 61 NM_174017
CDK8 CCCAGCAGCCTCCACAGTA TGT CCG ACG CAG CTC AGT AC 57 XM_583707
CHMP1A CAGCCCTGGGACTCTTCTTCT ACTCACCCTGTAGGGCACAGA 62 NM_001037584
H2AFZ TCCGGAAAGGCCAAGACA GAACTGCAAACCGGCTCTCT 57 NM_174809
HSPA2 AGAACCAGGTGGCCATGAAC TCCGACCAATCAGCCTCTTG 63 NM_174344
LUM TTCAAAGCATTCGCCAAAATG CCGCCAATTAATGCCAAGAG 62 NM_173934
MAD2L2 GTCTACCCGGTGGGCATCT CAT CTG GAC AGG CAC GTT GT 57 NM_001045946
MAOA GGGCCAGATGTTCGACGTAGT AGCTAAGAGTTTCGCAGCAGATAA 69 NM_181014
MAPK14 GCT GTC GAC CTG CTG GAG AAG ATG TCG TCG TCA GGA TCG TGG TAC TGG 110 NM_001102
MLH1 TCCGGGAGATGCTGCATAA CAA GGC CCA CTG AGG ATT CA 59 NM_001075994
MX1 GAGCAGTATGACTCCCGACTGTTT TTCTCAACCACAGCACTCCATTT 71 NM_173940
NUDC CCCCAGATCAAAGAACTGACTGA GGC ATC CTT TTT CTG GTC AATT 72 NM_001075607
PLAU CGCCACACACTGCTTCATTG GCCGTGACTGACCCAAGTAGAC 68 NM_174147
PPP3CA CCTCATCCATACTGGCTTCC AATCCATCTTCTTCTGACCC 140 NM_174787
RBP1 TGCGCGCGCTGGAT GCTTCAGCAAGTTGGCGATT 54 NM_001025343
SERPINE1 GGACTTCTCCAGTTTTTCAGATCAAG CAGCGTGCCGCTCTCATT 91 NM_174137
SERPINA14 ACCCTGAGGACCTGAAACTTGAG CGTGGACCAGAGGCTGTAAGTACT 69 NM_174797
SIPA1 GCCCATTATTCGGTGACACAGT GAAGTCCCCTTTTCTCCACAGA 72 NM_001101895
SSSCA1 TGACTGCGGGACGATCCT TGA CAA GCC ACG CAG TAG ATT T 60 NM_001038528
STC1 TTTGCAATGGCGGCATT TCCCGAGGAGAGGCATAGAG 60 NM_176669
TFDP2 GGTGCCACCTTGTCCCAAT CTA AGG CCA CTT CAG CAT CCA 64 NM_001075241
TGFB2 TCTCCAACCCAGCGCTACA TTCACCCTCTGCTCTGGTTTTC 57 NM_001113252
TSC2 CAGAGGGCAAACAGACTGAGTTTAT GCG ATT ATT GAG GCC ACA TTC 80 XM_581197
TXNL4B TGGTAATCGTGATGCATGGAA GGC TGG TTG CCT CAT GGT 58 NM_001014897