Advertisement

Zoological Letters

, 5:22 | Cite as

Correction to: An efficient system for homology-dependent targeted gene integration in medaka (Oryzias latipes)

  • Yu Murakami
  • Satoshi Ansai
  • Akari Yonemura
  • Masato KinoshitaEmail author
Open Access
Correction
  • 46 Downloads

Correction to: Zoological Lett

https://doi.org/10.1186/s40851-017-0071-x

Please note that there are two errors present in the tables of the published article [1].

Firstly, the value ‘3’ is missing from the 5th row of the ‘GFP+’ column of Table 1.
Table 1

Comparison of integrate efficiency among each of donor plasmids

Length of homology arms

Bait sequences

Survival at 4 dpf

No GFP

GFP+

Integrate efficiency (%)

500 bp

+

70

53

17

24.3

500 bp

62

56

6

9.7

40 bp

+

64

61

3

4.7

20 bp

+

110

108

2

1.9

Secondly, the gene sequence given for ‘Candidate #28’ in Additional file 6: Table S3 is incorrect. The gene sequence should be ‘TCTTCGGCCTAGACTGCGAGG’.

Supplementary material

40851_2019_139_MOESM1_ESM.xlsx (11 kb)
Additional file 6: Table S3. Potential off-target sites of 7 candidates of bait sequence that selected in the first screening and previously reported bait sequences. Potential off-target sites are defined as genomic sequence harboring up to 2 bp mismatches in the total 18 bp sequences and a NGG PAM. (XLSX 10 kb)

Reference

  1. 1.
    Murakami, et al. An efficient system for homology dependent targeted gene integration in medaka (Oryzias latipes). 2017;3:10.  https://doi.org/10.1186/s40851-017-0071-x.

Copyright information

© The Author(s). 2019

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors and Affiliations

  • Yu Murakami
    • 1
  • Satoshi Ansai
    • 1
    • 2
  • Akari Yonemura
    • 1
  • Masato Kinoshita
    • 1
    Email author
  1. 1.Division of Applied Bioscience, Graduate School of AgricultureKyoto University, Kitashirakawa-Oiwake-choKyotoJapan
  2. 2.Present address: Division of Ecological Genetics, Department of Population GeneticsNational Institute of GeneticsShizuokaJapan

Personalised recommendations