Streamlined, PCR-based testing for pfhrp2- and pfhrp3-negative Plasmodium falciparum
Abstract
Background
Rapid diagnostic tests (RDTs) that detect histidine-rich protein 2 (PfHRP2) are used throughout Africa for the diagnosis of Plasmodium falciparum malaria. However, recent reports indicate that parasites lacking the pfhrp2 and/or histidine-rich protein 3 (pfhrp3) genes, which produce antigens detected by these RDTs, are common in select regions of South America, Asia, and Africa. Proving the absence of a gene is challenging, and multiple PCR assays targeting these genes have been described. A detailed characterization and comparison of published assays is needed to facilitate robust and streamlined testing approaches.
Results
Among six pfhrp2 and pfhrp3 PCR assays tested, the lower limit of detection ranged from 0.01 pg/µL to 0.1 ng/µL of P. falciparum 3D7 strain DNA, or approximately 0.4–4000 parasite genomes/µL. By lowering the elongation temperature to 60 °C, a tenfold improvement in the limit of detection and/or darker bands for all exon 1 targets and for the first-round reaction of a single exon 2 target was achieved. Additionally, assays targeting exon 1 of either gene yielded spurious amplification of the paralogous gene. Using these data, an optimized testing algorithm for the detection of pfhrp2- and pfhrp3-negative P. falciparum is proposed.
Conclusions
Surveillance of pfhrp2- and pfhrp3-negative P. falciparum requires careful laboratory workflows. PCR-based testing methods coupled with microscopy and/or antigen testing serve as useful tools to support policy development. Standardized approaches to the detection of pfhrp2- and pfhrp3-negative P. falciparum should inform efforts to define the impact of these parasites.
Keywords
Rapid diagnostic tests False-negative Diagnostic resistance Histidine-rich protein hrp2 hrp3 RDT Deletion Malaria Plasmodium falciparumBackground
Diagnostic testing is a core component of recent malaria control efforts. In Africa, where the majority of deaths due to malaria occur, rapid diagnostic tests (RDTs) are the most commonly employed malaria diagnostic strategy, accounting for 74% of diagnostic testing among suspected malaria cases [1]. The most commonly used RDTs in Africa rely upon detection of PfHRP2, a Plasmodium falciparum-specific antigen expressed by the histidine-rich protein 2 (pfhrp2) gene. However, recent reports from select locations in South America, Asia, and Africa of P. falciparum parasites lacking pfhrp2 and/or the histidine-rich protein 3 (pfhrp3) gene, which produces an antigen that cross reacts with some PfHRP2-based RDTs, raise concerns about the effectiveness of PfHRP2-based RDTs in affected regions [2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18]. In response, the World Health Organization (WHO) has prioritized efforts to address parasites with deletions of the pfhrp2 and/or pfhrp3 (pfhrp2/3) genes [19, 20].
The methods required to identify and confirm pfhrp2/3 gene deletions are challenging, due to the difficulty of proving the absence of a gene. While PCR assays that target pfhrp2/3 are expected to yield negative results when applied to parasites lacking the gene(s), PCR failure can occur for other reasons. Testing of parasites with intact pfhrp2/3 genes may yield false-negative results due to DNA concentrations below the assay’s limit of detection, poor quality DNA, variable reagent performance, or other factors.
Cheng et al. published useful guidelines to standardize the reporting of pfhrp2/3 gene deletions [21]. However, the specific methods employed for the detection and confirmation of deletions continue to vary between laboratories, and recent evidence suggests that atypical elongation temperatures may improve amplification of AT-rich regions of both genes [14, 22]. This manuscript seeks to address these issues by comparing the performance of published PCR assays for pfhrp2 and pfhrp3, exploring the impact of reduced elongation temperatures on assay sensitivity, assessing assay specificity, and describing a streamlined testing algorithm.
Methods
Published pfhrp2/3 primer sequences, limits of detection, and optimized conditions
Assay # | Target | Primer sequences (5′→3′) | Reaction conditions | Cycling parameters | LOD,* ng/µL (genomes/µL) | Ref |
---|---|---|---|---|---|---|
1 | pfhrp2 (exon 1/2) | Outer: For: GGTTTCCTTCTCAAAAAATAAAG Rev: TCTACATGTGCTTGAGTTTCG Optional—inner: For: GTATTATCCGCTGCCGTTTTTGCC Rev: CTACACAAGTTATTATTAAATGCGGAA | 200 nM each primer HotStarTaq MM (Qiagen, Venlo, Netherlands) 3 μL template DNA or 100 × diluted first-round product 25 μL reaction vol | 95 °C × 15 min; 40 cycles of 94 °C × 1 min, 50 °C × 1 min for outer primers or 55 °C × 1 min for inner primers, 60 °C × 1 min; 60 °C × 10 min | 10−5 (~ 0.4) | [3] |
2 | pfhrp2 (exons 1/2) | For: TATCCGCTGCCGTTTTTGCC Rev: AGCATGATGGGCATCATCCTA | 400 nM each primer HotStarTaq MM 3 μL template DNA 25 μL reaction vol | 95 °C × 15 min; 40 cycles of 94 ° × 1 min, 57 °C x 1 min, 60 °C × 1 min; 60 °C × 10 min | 10−1 (~ 4000) | [9] |
3 | pfhrp2 (exon 2) | For: ATTCCGCATTTAATAATAACTTGTGTAGC Rev: ATGGCGTAGGCAATGTGTGG | 400 nM each primer HotStarTaq MM 3 μL template DNA 25 μL reaction vol | 95 °C × 15 min; 40 cycles of 94 °C × 1 min, 59 °C × 1 min, 72 °C × 1 min; 72 °C × 10 min | 10−4 (~ 4) | [5] |
4 | pfhrp2 (exon 2) | Outer: For: CAAAAGGACTTAATTTAAATAAGAG Rev: AATAAATTTAATGGCGTAGGCA Optional—inner (hemi-nested): For: ATTATTACACGAAACTCAAGCAC Rev: AATAAATTTAATGGCGTAGGCA | 400 nM each primer HotStarTaq MM 3 μL template DNA or 100× diluted first-round product 25 μL reaction vol | 95 °C × 15 min; 40 cycles of 94 °C × 1 min, 57 °C × 1 min for outer primers or 62 °C for inner primers, 60 °C × 1 min; 60 °C × 10 min | 10−4 (~ 4) | [23] |
5 | pfhrp3 (exons 1/2) | For: TATCCGCTGCCGTTTTTGCTTCC Rev: TGCATGATGGGCATCACCTG | 400 nM primers HotStarTaq MM 3 μL template DNA 25 μL reaction vol | 95 °C × 15 min; 40 cycles of 94 °C × 1 min, 60 °C × 1 min, 60 °C × 1 min; 60 °C × 10 min | 10−4 (~ 4) | [9] |
6 | pfhrp3 (exon 2) | Outer: For: AATGCAAAAGGACTTAATTC Rev: TGGTGTAAGTGATGCGTAGT Optional—inner (hemi-nested): For: AAATAAGAGATTATTACACGAAAG Rev: TGGTGTAAGTGATGCGTAGT | 400 nM primers HotStarTaq MM 3 μL template DNA or 100 × diluted first-round product 25 μL reaction vol | 95 °C × 15 min; 40 cycles of 94 °C × 1 min, 55 °C × 1 min, 60 °C × 1 min; 60 °C × 10 min | 10−4 (~ 4) | [23] |
7 | pfldh (initial qPCR) | For: ACGATTTGGCTGGAGCAGAT Rev: TCTCTATTCCATTCTTTGTCACTCTTTC Probe: FAM-GTAATAGTAACAGCTGGATTTACCAAGGCCCCA-TAMRA | 200 nM primers 100 nM probe Probe Master qPCR Mix (Roche Diagnostics, Indianapolis, IN) 2 μL template DNA 12 μL reaction vol | 50 °C × 2 min; 95 °C × 10 min; 40 cycles of 95 °C × 15 s, 60 °C × 1 min | 10−4 (~ 4) | [31] |
8 | Pf -tubulin (confirmatory) | For: AATAAATCATAATGATGTGCGCAAGTGATCC Rev: AATAAATCATAATCCTTTGTGGACATTCTTCCTC | 300 nM primers FastStart Universal SYBR Green MM (Roche Diagnostics) 3 µL template DNA 25 µL reaction volume | 50 °C × 2 min; 95 °C × 10 min; 40 cycles of 95 °C × 15 s, 60 °C × 1 min; Dissociation analysis | 10−3 (~ 40) |
The specificity of the best performing assays, including those with targets spanning exon 1 and 2 (exon 1/2) and exon 2 alone, was then evaluated. Assays were performed using control DNA from P. falciparum Dd2 (MRA-150G) and HB3 (MRA-155G) strain parasites, which lack pfhrp2 and pfhrp3, respectively. Control DNA was obtained from the Malaria Research and Reference Reagent Resource Center ([MR4], BEI Resources, Manassas, Virginia) and diluted to a concentration of 0.1 ng/µL after initial quantification using Qubit as above. For assays that yielded an unexpected result using optimized reaction conditions (i.e. bands from a pfhrp2 assay performed using pfhrp2-deleted Dd2 DNA or bands from a pfhrp3 assays performed using pfhrp3-deleted HB3 DNA), amplicons were sequenced using Sanger sequencing at Eton Bioscience (Research Triangle Park, NC), and assays were repeated at the other elongation temperatures (60, 65, and/or 72 °C). For PCR products with multiple bands appreciated by gel electrophoresis, individual bands were excised, and DNA was extracted using the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) before sequencing. Gel extraction was performed according to the manufacturer’s instructions, with the exception of the final DNA elution step, in which we performed two separate elutions using 30 µL aliquots of Buffer EB through the column, followed by a final elution step using the combined 60 µL initial eluate to maximize DNA yield. Raw sequence reads were processed using Sequencher 5.4 (Gene Codes Corporation, Ann Arbor, MI), trimming bidirectional sequences based on confidence values and visual inspection of the chromatograms. We used EMBOSS Water for pairwise nucleotide alignments to the 3D7 (v3.0) pfhrp2 and pfhrp3 reference sequences. Sequence identification was based on sequence homology and alignment score, using default settings (DNAfull matrix, gap open penalty 10, gap extend penalty 0.5) [24].
Results
Assay performance
Reduced elongation temperatures improved the sensitivity of five of the six assays (Additional file 1: Figures S1, S2). An elongation temperature of 60 °C reduced the LOD by tenfold and/or produced darker bands for all exon 1/2 targets and for the first-round reaction of a single exon 2 target (assay 4). Using optimized elongation temperatures and under our lab conditions, the LOD of published PCR assays for pfhrp2 and pfhrp3 varied, with lower limits ranging from approximately 0.01 pg/µL to 0.1 ng/µL of 3D7 DNA, or approximately 0.4–4000 parasite genomes/µL (Table 1). Additionally, while adding a second round of amplification in the best performing nested PCR for pfhrp2 exon 1/2 (assay 1) resulted in darker bands, the assay’s LOD was unchanged.
Amplification of paralogous genes by exon 1/2 assays
Pfhrp2 and pfhrp3 gene sequence homology. Alignment of reference sequences from the consensus 3D7 (v3.0) genome, 5′→3′, with expected binding sites for pfhrp2 assays (white boxes) and pfhrp3 assays (gray boxes). The reverse primer sequence for Assay 2 includes an a single-base insertion (cytosine) at the location indicated by an asterisk (*). Identical bases are indicated by a period (.), missing bases by a dash (-), substitutions by the discordant base, and non-coding regions by lower case font
Sequencing results confirmed amplification of pfhrp3 by the pfhrp2 exon 1/2 assay, and vice versa. With Dd2 strain (pfhrp2-deleted) template, the pfhrp2 exon 1/2 assay (assay 1) unexpectedly produced a single band with a fragment length of approximately 300 bp. The amplicon’s sequence aligned to the pfhrp3 gene with 92% sequence homology (Additional file 1: Figure S5). With HB3 strain (pfhrp3-deleted) template, the pfhrp3 exon 1/2 assay (assay 5) unexpectedly produced two clear bands with fragment lengths of approximately 300 and 800 bp and a faint band at approximately 400 bp. Sequences generated using DNA extracted from each band aligned to the pfhrp2 gene, with 98, 99, and 97% sequence homology for the 300, 400, and 800 bp fragments, respectively (Additional file 1: Figure S6). However, when applied to 3D7 strain (pfhrp2/3-positive) control template, both exon 1/2 assays produced the expected result: a single band with a sequence that aligned to pfhrp2 with 96% homology or pfhrp3 with 99% sequence homology (for assays 1 and 5, respectively).
Streamlined testing algorithm
Proposed testing pipeline. Single-step assays are favoured to reduce the risk of contamination, and assays should be performed in duplicate. In addition to positive P. falciparum (e.g. 3D7 strain) DNA and no template controls, either *pfhrp2-negative (e.g. Dd2 strain) or **pfhrp3-negative (e.g. HB3 strain) P. falciparum DNA controls should be used
Discussion
By lowering the LOD and employing assays that distinguish pfhrp2 from pfhrp3, this testing algorithm provides an improved approach to PCR-based detection of pfhrp2/3-negative P. falciparum. Importantly, PCR-based approaches for identification of pfhrp2- and pfhrp3-negative parasites must be coupled with verification of P. falciparum parasitaemia and confirmation that parasite DNA is present at concentrations above the LODs of the pfhrp2 and pfhrp3 assays. These goals were achieved by employing assays targeting two P. falciparum-specific, single-copy genes, lactate dehydrogenase (pfldh) and P. falciparum beta tubulin (PfBtubulin), as the initial and final steps of the testing pipeline.
Lowering the elongation temperature improved the LOD of all published assays with exon 1/2 targets on either gene. This finding likely represents improved amplicon extension across the AT-rich intron between the exons as suggested by previous reports [22]. Unexpected amplification of paralogous gene targets by the pfhrp2 and pfhrp3 exon 1/2 assays was observed, presumably due to sequence homology at the primer binding sites. In regions where co-existing pfhrp2 and pfhrp3 deletions are common, the impact of non-specific amplification is expected to be reduced [25, 26, 27]. Additionally, the absence of paralogous amplification of 3D7 control DNA suggests that the availability of abundant, completely homologous primer binding sites early in PCR cycling reduces the likelihood of exponential amplification after mispriming. To reduce the risk of unintentional amplification of paralogous genes, this testing algorithm uses assays targeting exon 2 of both genes. This approach also permits analysis of the repetitive sequences that encode epitopes recognized by anti-PfHRP2 antibodies [28].
A broad range of LOD results was observed for published pfhrp2 and pfhrp3 assays, spanning over 4 orders of magnitude under the laboratory conditions employed during this study. These differences were addressed in the resulting testing pipeline (Fig. 2) by defining an initial threshold DNA concentration tenfold higher than the LOD of the downstream pfhrp2 and pfhrp3 assays. In addition, a stringent, final single-copy-gene PCR that meets the same LOD requirement was included, providing confirmation that sample degradation has not occurred during the testing process. The typical workflow employed in this laboratory includes assays 3 and 6 for pfhrp2 and pfhrp3 testing, respectively, performed in duplicate. For discordant results (i.e. one of two replicates positive), samples are called positive if there is a clear band of appropriate fragment length. If not, the assay is repeated, and the final call is based on the third result. Because the first-round of the nested assays achieved LODs below the initial and final confirmatory, falciparum-specific assays, their use as single-step assays is favoured in this laboratory to reduce the risk of contamination and improve work flow.
In settings where real-time PCR is not feasible, the proposed initial lactate dehydrogenase (pfldh) quantitative PCR assay and the final confirmatory P. falciparum beta tubulin (PfBtubulin) assays could be replaced with traditional PCR assays with LODs above the LOD of the pfhrp2 and pfhrp3 assays. Because assay performance can vary from laboratory to laboratory and with different reagents or equipment, it is essential to confirm the LOD of each assay using the reagents and laboratory infrastructure at hand.
In addition to PCR-based testing, current guidelines recommend independent confirmation of P. falciparum parasitaemia using microscopy or a non-PfHRP2-based RDT, such as an RDT that detects P. falciparum lactate dehydrogenase (pf-pLDH), before making deletion calls [19, 21]. Quantification of circulating PfHRP2 antigen is also a valuable tool that can be particularly useful for assessing PfHRP2-RDT-negative but pfhrp2/3-PCR-positive isolates with impaired protein expression [29]. Additionally, novel assays under development such as those targeting regionally specific deletion breakpoints or employing droplet digital PCR, have potential to improve throughput [30].
Conclusions
Surveillance of pfhrp2- and pfhrp3-negative P. falciparum requires careful laboratory workflows. PCR-based testing methods, coupled with microscopy and/or antigen testing, serve as useful tools to support policy development. Standardized approaches to the detection of pfhrp2- and pfhrp3-negative P. falciparum should inform efforts to define the impact of these parasites [20, 21].
Notes
Authors’ contributions
JBP designed the study. OA and JBP performed the laboratory analyses, analysed and interpreted the data and drafted the manuscript. SRM and JJJ made substantial contributions to its conception and design. All authors read and approved the final manuscript.
Acknowledgements
The authors wish to thank Andreea Waltmann for helpful advice and Kyaw Thwai for assistance with the assays. The following reagents were obtained through BEI Resources, NIAID, NIH: Genomic DNA from Plasmodium falciparum, Strain HB3, MRA-155G, contributed by Thomas E. Wellems; Genomic DNA from Plasmodium falciparum, Strain Dd2, MRA-150G, contributed by David Walliker.
Competing interests
The authors declare that they have no competing interests.
Availability of data and materials
Representative gel images can be found in the Additional file. Upload of Sanger sequencing contigs to GenBank was not permitted due to their short < 200 bp fragment length. Sequence alignments are displayed in Additional file 1: Figures S5 and S6, and raw sequencing reads are provided in a combined FASTA file (Additional file 2). Otherwise, data sharing is not applicable to this article, as no datasets were generated or analysed during the current study.
Consent for publication
Not applicable.
Ethics approval and consent to participate
Not applicable.
Funding
This work was supported by the National Institute of Allergy and Infectious Diseases [5R01AI107949 to SRM], the American Society of Tropical Medicine and Hygiene-Burroughs Wellcome Fund to JBP, and the Thrasher Research Fund to JBP. The funders had no role in the study design, data collection and interpretation, writing, or the decision to submit the work for publication.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary material
References
- 1.WHO. World malaria report 2016. Geneva: World Health Organization; 2016.Google Scholar
- 2.Abdallah JF, Okoth SA, Fontecha GA, Torres RE, Banegas EI, Matute ML, et al. Prevalence of pfhrp2 and pfhrp3 gene deletions in Puerto Lempira, Honduras. Malar J. 2015;14:19.CrossRefPubMedPubMedCentralGoogle Scholar
- 3.Akinyi S, Hayden T, Gamboa D, Torres K, Bendezu J, Abdallah JF, et al. Multiple genetic origins of histidine-rich protein 2 gene deletion in Plasmodium falciparum parasites from Peru. Sci Rep. 2013;3:2797.CrossRefPubMedPubMedCentralGoogle Scholar
- 4.Baldeviano GC, Okoth SA, Arrospide N, Gonzalez RV, Sanchez JF, Macedo S, et al. Molecular epidemiology of Plasmodium falciparum malaria outbreak, Tumbes, Peru, 2010–2012. Emerg Infect Dis. 2015;21:797–803.CrossRefPubMedPubMedCentralGoogle Scholar
- 5.Koita OA, Doumbo OK, Ouattara A, Tall LK, Konare A, Diakite M, et al. False-negative rapid diagnostic tests for malaria and deletion of the histidine-rich repeat region of the hrp2 gene. Am J Trop Med Hyg. 2012;86:194–8.CrossRefPubMedPubMedCentralGoogle Scholar
- 6.Murillo Solano C, Akinyi Okoth S, Abdallah JF, Pava Z, Dorado E, Incardona S, et al. Deletion of Plasmodium falciparum histidine-rich protein 2 (pfhrp2) and histidine-rich protein 3 (pfhrp3) genes in Colombian parasites. PLoS ONE. 2015;10:e0131576.CrossRefPubMedPubMedCentralGoogle Scholar
- 7.Wurtz N, Fall B, Bui K, Pascual A, Fall M, Camara C, et al. Pfhrp2 and pfhrp3 polymorphisms in Plasmodium falciparum isolates from Dakar, Senegal: impact on rapid malaria diagnostic tests. Malar J. 2013;12:34.CrossRefPubMedPubMedCentralGoogle Scholar
- 8.Kumar N, Pande V, Bhatt RM, Shah NK, Mishra N, Srivastava B, et al. Genetic deletion of HRP2 and HRP3 in Indian Plasmodium falciparum population and false negative malaria rapid diagnostic test. Acta Trop. 2013;125:119–21.CrossRefPubMedGoogle Scholar
- 9.Gamboa D, Ho MF, Bendezu J, Torres K, Chiodini PL, Barnwell JW, et al. A large proportion of P. falciparum isolates in the Amazon region of Peru lack pfhrp2 and pfhrp3: implications for malaria rapid diagnostic tests. PLoS ONE. 2010;5:e8091.CrossRefPubMedPubMedCentralGoogle Scholar
- 10.Li P, Xing H, Zhao Z, Yang Z, Cao Y, Li W, et al. Genetic diversity of Plasmodium falciparum histidine-rich protein 2 in the China-Myanmar border area. Acta Trop. 2015;152:26–31.CrossRefPubMedPubMedCentralGoogle Scholar
- 11.Amoah LE, Abankwa J, Oppong A. Plasmodium falciparum histidine rich protein-2 diversity and the implications for PfHRP 2: based malaria rapid diagnostic tests in Ghana. Malar J. 2016;15:101.CrossRefPubMedPubMedCentralGoogle Scholar
- 12.Bharti PK, Chandel HS, Ahmad A, Krishna S, Udhayakumar V, Singh N. Prevalence of pfhrp2 and/or pfhrp3 gene deletion in Plasmodium falciparum population in eight highly endemic states in India. PLoS ONE. 2016;11:e0157949.CrossRefPubMedPubMedCentralGoogle Scholar
- 13.Berhane A, Russom M, Bahta I, Hagos F, Ghirmai M, Uqubay S. Rapid diagnostic tests failing to detect Plasmodium falciparum infections in Eritrea: an investigation of reported false negative RDT results. Malar J. 2017;16:105.CrossRefPubMedPubMedCentralGoogle Scholar
- 14.Parr JB, Verity R, Doctor SM, Janko M, Carey-Ewend K, Turman BJ, et al. Pfhrp2-Deleted Plasmodium falciparum parasites in the Democratic Republic of the Congo: a national cross-sectional survey. J Infect Dis. 2017;216:36–44.CrossRefPubMedGoogle Scholar
- 15.Rachid Viana GM, Akinyi Okoth S, Silva-Flannery L, Lima Barbosa DR, Macedo de Oliveira A, Goldman IF, et al. Histidine-rich protein 2 (pfhrp2) and pfhrp3 gene deletions in Plasmodium falciparum isolates from select sites in Brazil and Bolivia. PLoS ONE. 2017;12:e0171150.CrossRefPubMedPubMedCentralGoogle Scholar
- 16.Beshir KB, Sepulveda N, Bharmal J, Robinson A, Mwanguzi J, Busula AO, et al. Plasmodium falciparum parasites with histidine-rich protein 2 (pfhrp2) and pfhrp3 gene deletions in two endemic regions of Kenya. Sci Rep. 2017;7:14718.CrossRefPubMedPubMedCentralGoogle Scholar
- 17.Kozycki CT, Umulisa N, Rulisa S, Mwikarago EI, Musabyimana JP, Habimana JP, et al. False-negative malaria rapid diagnostic tests in Rwanda: impact of Plasmodium falciparum isolates lacking hrp2 and declining malaria transmission. Malar J. 2017;16:123.CrossRefPubMedPubMedCentralGoogle Scholar
- 18.Gupta H, Matambisso G, Galatas B, Cistero P, Nhamussua L, Simone W, et al. Molecular surveillance of pfhrp2 and pfhrp3 deletions in Plasmodium falciparum isolates from Mozambique. Malar J. 2017;16:416.CrossRefPubMedPubMedCentralGoogle Scholar
- 19.WHO. P. falciparum hrp2/3 gene deletions: conclusions and recommendations of a technical consultation. Geneva: World Health Organization; 2016.Google Scholar
- 20.WHO. False-negative RDT results and implications of new P. falciparum histidine-rich protein 2/3 gene deletions. Geneva: World Health Organization; 2016.Google Scholar
- 21.Cheng Q, Gatton ML, Barnwell J, Chiodini P, McCarthy J, Bell D, et al. Plasmodium falciparum parasites lacking histidine-rich protein 2 and 3: a review and recommendations for accurate reporting. Malar J. 2014;13:283.CrossRefPubMedPubMedCentralGoogle Scholar
- 22.Su XZ, Wu Y, Sifri CD, Wellems TE. Reduced extension temperatures required for PCR amplification of extremely A + T-rich DNA. Nucleic Acids Res. 1996;24:1574–5.CrossRefPubMedPubMedCentralGoogle Scholar
- 23.Baker J, McCarthy J, Gatton M, Kyle DE, Belizario V, Luchavez J, et al. Genetic diversity of Plasmodium falciparum histidine-rich protein 2 (PfHRP2) and its effect on the performance of PfHRP2-based rapid diagnostic tests. J Infect Dis. 2005;192:870–7.CrossRefPubMedGoogle Scholar
- 24.Li W, Cowley A, Uludag M, Gur T, McWilliam H, Squizzato S, et al. The EMBL-EBI bioinformatics web and programmatic tools framework. Nucleic Acids Res. 2015;43:W580–4.CrossRefPubMedPubMedCentralGoogle Scholar
- 25.Berhane A, Mihreteab S, Mohammed S, Embaye G, Hagos F, Zehaie A, et al. PfHRP2 detecting malaria RDTs: alarming false-negative results in Eritrea (Poster #879). Annual meeting of the American Society of Tropical Medicine and Hygiene. 2016; Atlanta, Georgia, USA.Google Scholar
- 26.Gamboa D, Ho MF, Bendezu J, Torres K, Chiodini PL, Barnwell JW, et al. A large proportion of P. falciparum isolates in the Amazon region of Peru lack pfhrp2 and pfhrp3: implications for malaria rapid diagnostic tests. PLoS ONE. 2010;5:e0008091.CrossRefGoogle Scholar
- 27.Menegon M, L’Episcopia M, Nurahmed AM, Talha AA, Nour BYM, Severini C. Identification of Plasmodium falciparum isolates lacking histidine-rich protein 2 and 3 in Eritrea. Infect Genet Evol. 2017;55:131–4.CrossRefPubMedGoogle Scholar
- 28.Lee N, Gatton ML, Pelecanos A, Bubb M, Gonzalez I, Bell D, et al. Identification of optimal epitopes for Plasmodium falciparum rapid diagnostic tests that target histidine-rich proteins 2 and 3. J Clin Microbiol. 2012;50:1397–405.CrossRefPubMedPubMedCentralGoogle Scholar
- 29.Rogier E, Plucinski M, Lucchi N, Mace K, Chang M, Lemoine JF, et al. Bead-based immunoassay allows sub-picogram detection of histidine-rich protein 2 from Plasmodium falciparum and estimates reliability of malaria rapid diagnostic tests. PLoS ONE. 2017;12:e0172139.CrossRefPubMedPubMedCentralGoogle Scholar
- 30.Koepfli C, Badu K, Lo E, Hemming-Schroeder E, Yan G. High-throughput screening of P. falciparum hrp2 deletion for monitoring of RDT efficacy for malaria diagnosis (Poster #290). Annual meeting of the American Society of Tropical Medicine and Hygiene. 2017; Baltimore, Maryland, USA.Google Scholar
- 31.Pickard AL, Wongsrichanalai C, Purfield A, Kamwendo D, Emery K, Zalewski C, Kawamoto F, Miller RS, Meshnick SR. Resistance to antimalarials in Southeast Asia and genetic polymorphisms in pfmdr1. Antimicrob Agents Chemother. 2003;47:2418–23.CrossRefPubMedPubMedCentralGoogle Scholar
- 32.Price RN, Uhlemann AC, Brockman A, McGready R, Ashley E, Phaipun L, et al. Mefloquine resistance in Plasmodium falciparum and increased pfmdr1 gene copy number. Lancet. 2004;364:438–47.CrossRefPubMedPubMedCentralGoogle Scholar
- 33.Afonina I, Ankoudinova I, Mills A, Lokhov S, Huynh P, Mahoney W. Primers with 5′ flaps improve real-time PCR. Biotechniques. 2007;43:770–4.CrossRefPubMedGoogle Scholar
Copyright information
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.