Journal of Analysis and Testing

, Volume 1, Issue 4, pp 306–314 | Cite as

Polystyrene Microspheres Coupled with Hybridization Chain Reaction for Dual-Amplified Chemiluminescence Detection of Specific DNA Sequences

Original Paper
  • 222 Downloads

Abstract

We report on a highly sensitive chemiluminescence (CL) assay for the detection of specific DNA sequence, where streptavidin-modified polystyrene microspheres (PS–SA) coupled with hybridization chain reaction (HCR) were employed as dual amplification platform. Briefly, a “sandwich-type” detection strategy was proposed in our design, which involved capture probe DNA immobilized on the surface of carboxyl-terminated magnetic beads (MB) and the reporter DNA combined with the HCR trigger immobilized on the surface of PS–SA. After that, two hairpin-type monomers were added to initiate the HCR. In the detection system, CL signal was obtained via the instantaneous derivatization reaction between 3,4,5-trimethoxylphenylglyoxal (TMPG) and guanine bases in the target and the HCR complex binding on the magnetic beads. As compared to traditional sandwich type (capture/target/reporter) assays, this dual-amplified strategy for sequence-specific DNA detection showed better specificity, lower detection limit and wider linear response range (linear range of 0.01 fmol–10 pmol and a low detection limit of 5 amol). Moreover, this approach could be easily extended to detect a wide range of specific DNA sequences by modification of the hybridization region. We believe this simple technique will present a significant step towards early diagnoses of diseases.

Keywords

Chemiluminescence HCR Polystyrene microspheres Dual amplification 

1 Introduction

Increasing interest has been focused on the development of simple and ultrasensitive detection of sequence-specific DNA in recent decades, allowing early and precise diagnosis of diseases [1, 2, 3, 4, 5, 6, 7]. Up to now, a broad range of strategies such as optical (fluorescence [8, 9, 10, 11], chemiluminescence (CL) [12, 13, 14, 15, 16], colorimetry [17, 18], dynamic light scattering [19] surface plasmon resonance [20, 21], etc.), piezoelectric [22] and electronic transduction techniques [23, 24] have been developed. Among the many methods devised for the detection of sequence-specific DNA, amplification is one of the most important concepts since it permits the highest analytical sensitivity [25, 26, 27, 28, 29, 30]. For example, hybridization chain reaction (HCR) amplification was first demonstrated by Pierce and Dirks and a detailed discussion was given in the references [31, 32, 33]. In the HCR process, two complementary stable species of hairpins coexist in solution until the introduction of initiator strands triggers a cascade of hybridization events to yield nicked double helices analogous to alternating copolymers [34, 35]. Competing with other amplification methods, such as polymerase chain reaction (PCR) [36, 37], enzyme amplification [38, 39, 40] and rolling circle amplification (RCA) [41, 42, 43], HCR shows its superiority that it allows for selective and specific extension at room temperature without enzymes. Recently, our group has reported a label-free CL platform where the reporter is amplified via HCR, offering significant amplification for the detection of target DNA or microRNA [44, 45]. Moreover, the integration of two different signal amplification routes into one single assay can further push down the detection limit and significantly improve the sensitivity [46, 47, 48]. These methods, however, require extra signal molecular labels, such as fluorescence and enzyme, which increases the cost and complexity of the assay protocols. Consequently, it is yet highly desired to develop a low-cost and much simpler label-free approach, which also conducts high sensitivity and selectivity.

Herein, we employed a HCR-based sandwich-type detection strategy for the quantitative assay of specific DNA sequence, by taking advantage of magnetic beads as preconcentration carriers and polystyrene microspheres which assembled multiple biotinylated reporter DNA and HCR triggers on the surface as a dual-amplification platform. CL signal could be sensitively detected via an instantaneous derivatization reaction between TMPG and the guanine (G) domain on the target DNA and HCR products. When target DNA presents, it connects the capture DNA immobilized on the MB and the reporter DNA immobilized on the PS–SA through complementary base pairing. Thanks to this capture–target–reporter “sandwich-type” strategy, a single MB is loaded with plenty of PS–SA, while each PS–SA is linked with a great many HCR triggers. Then the HCR process was initiated by the trigger with the addition of two monomers, extending the G nucleotide-rich long-chain complex and presents a significant enhancement of CL signal. Inspiringly, this dual-amplification platform can be easily extended for use with other nucleic acids by redesigning the hybridization sequence of capture and reporter DNA, thus representing a versatile detection scheme.

2 Experimental

2.1 Apparatus Monitoring

The CL detection was carried out with a BPCL CL analyzer (Beijing, China). Absorbance was determined by a HITACHI U-2900 Spectrophotometer (Hitachi, Ltd., Japan).

2.2 Materials and Reagents

All chemicals were of analytical grade and used as provided. All of the solutions were prepared with ultrapure water from a Millipore Milli-XQ system (Millipore, Bedford, MA, USA). Carboxyl-terminated magnetic beads (MB, 1.0 μm, 20 mg mL−1) were purchased from polysciences (Warrington, PA). Streptavidin-coated polystyrene nanoparticles (PS–SA, 130 and 490 nm, 10 mg mL−1) were purchased from Bangs Laboratories, Inc. (Fishers, IN, USA). 1-Ethyl-3-(3-dimethylamino-propyl) carbodiimide (EDC) was purchased from Sigma-Aldrich, TMPG was synthesized as described previously [45], bovine serum albumin (BSA) was bought from Sino-American Biotechnology Co. (Shanghai, China). All oligonucleotides (Table 1) were obtained from Sangon Biotechnology Co., Ltd. (Shanghai, China), and used as provided after dissolving in water. Target DNA was a 35 base sequence that contains complementary sequences to both capture DNA and a part of reporter DNA. Buffer A (20 mM Tris–HCl, pH 8.0 and 0.5 M NaCl) and wash buffer (7 mM Tris–HCl, pH 8.0, 0.17 M NaCl and 0.05% Tween 20).
Table 1

DNA sequences used in this work

Name

Sequence (5′ to 3′)

Abbrev.

Capture DNA

NH2-(A)20 ACCTTTAACCTAATCTCCTC

Capture

Target DNA

TGGGAGGAGTTGGGGGAGGAGATTAGGTTAAAGGT

Target

Reporter

CCCCAACTCCTCCCAAAAAAAAAAA-biotin

Reporter

Trigger

Biotin-AAAAAAAAAACAAAGTAGTCTAGGATTCGGCGTG

Trigger

Hairpin 1

AGTCTAGGATTCGGCGTGGGTTAACACGCCGAATCCTAGACTACTTTG

H1

Hairpin 2

TTAACCCACGCCGAATCCTAGACTCAAAGTAGTCTAGGATTCGGCGTG

H2

Mismatch A

TGGGAGGAGTTGGGGGAGGAGATTAGGATAAAGGT

Ms A

Mismatch C

TGGGAGGAGTTGGGGGAGGAGATTAGGTTAAAAGT

Ms C

Mismatch T1

TGGGAGGAGTTGGGGGAGGAGATTTGGTTAAAGGT

Ms T1

Mismatch T2

TGGGAGGAGTTGGGGGAGTAGATTAGGTTAAAGGT

Ms T2

2.3 Immobilization of Capture DNA onto MB

In a typical experiment, 360 μg of the carboxyl-terminated MB were washed three times with 200 μL of 0.1 M imidazole buffer (pH 6.0) and then activated in 200 μL of imidazole buffer containing 0.1 M EDC with gentle shaking for 20 min. Then 180 pmol of capture DNA was added and incubated with the activated beads for 1 h at 37 °C. The bead-captured DNA was washed three times with 150 μL of wash buffer and resuspended in 1.2 mL of buffer A containing 10% BSA for 1 h to minimize nonspecific adsorption effects. After that, the supernatant was aspirated and discarded, and then the conjugates were resuspended in 1.2 mL of buffer A before use.

2.4 Hybridization Assay with the Targets

The above-prepared MB conjugates were divided equally into 12 wells (100 μL per well) and transferred into a microtube, and then different concentrations of target or mismatched sequences were added into each microtube (100 μL per tube, in buffer A). Following 1 h incubation with gentle mixing at 37 °C, the resultant MB capture–target conjugates were washed three times with 150 μL of wash buffer.

2.5 Preparation of PS–SA Complex

PS–SA complex were synthesized via the well-known streptavidin–biotin chemistry as follows. Briefly, 720 μg of PS–SA was washed with 200 μL of wash buffer, centrifuged to discard the supernatant and then resuspended in 200 μL of buffer A. After that, 360 pmol reporter DNA and 180 pmol HCR trigger were added into the solution of PS–SA and allowed to self-assemble onto the surface of the PS–SA for 1 h in 100 mL of buffer A at 37 °C. The resultant conjugates (PS–SA complex) were washed three times and resuspended in 1.2 mL of buffer A (1% BSA) before use.

2.6 PS–SA Complex-Based CL Assay

In a typical experiment, 50 μL of the above-prepared MB conjugates were transferred into a microtube, and then different concentrations of PS–SA complex were added into each microtube. Following a 1-h incubation with gentle mixing at 37 °C, the resultant MB–PS conjugates were washed three times with 150 μL of wash buffer.

2.7 Solution-Based Extension of Oligonucleotide Chains by HCR

The hairpin oligonucleotides were heated to 95 °C for 2 min and then cooled to room temperature for 1 h before use. 360 pmol H1 and 1440 pmol H2 in 100 μL of buffer A (pH 8.0) were added to the above-prepared MB–PS conjugates and shaken at 37 °C for 1 h.

2.8 HCR-Based CL Assay

The MB–PS conjugates were then allowed to react with 100 μL of the above-prepared HCR chains for 1 h at 37 °C. Before detection, the hybrid-conjugated beads were washed three times with wash buffer and transferred into 14 × 40 mm glass tubes with 90 μL of TMPG (30 mM in DMF). In the non-HCR protocol, the MB capture–target conjugates only hybridized with the reporter DNA (10 pmol per well, 100 mL) at 37 °C for 1 h.

3 Results and Discussion

3.1 Assay Principle of the Detection Strategy

Scheme 1 represents the assay process of the “sandwich-type” detection strategy where capture DNA is immobilized on the MB surface and reporter DNA combined with multiple HCR triggers are linked on PS–SA. Since target DNA was a 35 base sequence that contains complementary sequences to both capture DNA and a part of reporter DNA, it is easy to form a capture–target–reporter sandwich structure, ultimately the reporter DNA brings the PS–SA complex proximal to the MB surface when the target DNA presents. Eventually a single MB is loaded with a great many HCR triggers. The HCR process was subsequently initiated with the addition of two monomers (H1, H2), CL signal could be sensitively detected via an instantaneous derivatization reaction between TMPG and the guanine (G) nucleotides of DNA sequence on the MB surface. Previous reports showed that CL intensity could be proportional to the number of G nucleotides on the detection platform [45]. By taking advantage of the HCR amplification occurring on the PS–SA, numerous guanine nucleotides were brought to the surface of MB and turns to a significant CL signal. In contrast, the sandwich complex cannot be formed without target DNA, leaving the capture probe unhybridized and resulting in a relatively weak background for the designed capture DNA without guanine nucleotide.
Scheme 1

Schematic representation of the HCR-based amplification system coupled to PS–SA for the highly selective and sensitive detection of specific sequence of DNA

3.2 Characteristics and Control Tests

To realize our design on the dual amplification strategy, two important issues should be investigated and evaluated: (1) whether the HCR polymerization could be initiated only in the presence of HCR trigger DNA, H1 and H2, and also target DNA and reporter DNA did not affect the hybridization of three strands; (2) whether the extended HCR product could be linked to the MB to form the capture–target–reporter sandwich structure and turns into CL signal. Thus, the mixtures of various components were investigated using gel electrophoresis (Fig. 1). Lane 5 shows the mixture of the two monomers (H1, H2), and in lane 6 the HCR trigger was added. Comparison between lane 5 and lane 6 demonstrates that the hairpins could polymerize only when the trigger DNA, H1 and H2 all exist in the solution. In lane 7 the target DNA was further added in the HCR reaction system, indicating that the target DNA did not affect the hybridization of three strands. In a similar way was the reporter DNA (lane 8). On the basis of these results, we might make a preliminary conclusion that our designed strategy should be feasible for the high-sensitivity detection of target DNA.
Fig. 1

Native gel electrophoresis of the HCR. (1) 1 pmol target DNA in 100 μL reaction buffer; (2) 10 pmol HCR trigger DNA in 100 μL reaction buffer; (3) 20 pmol H1 in 100 μL reaction buffer; (4) 20 pmol H2 in 100 μL reaction buffer; (5) 20 pmol H1 and 20 pmol H2 in 100 μL reaction buffer; (6) 10 pmol HCR trigger DNA, 20 pmol H1 and 20 pmol H2 in 100 μL reaction buffer; (7) 10 pmol reporter DNA, 10 pmol HCR trigger, 20 pmol H1 and 20 pmol H2 in 100 μL reaction buffer and (8) 1 pmol target DNA, 10 pmol reporter DNA, 10 pmol HCR trigger, 20 pmol H1 and 20 pmol H2 in 100 μL reaction buffer

To classify the second issue, two HCR protocols named protocols A and B were carried out in parallel as follows: protocol A: the PS–SA complex was first hybridized with target DNA already on the MB surface and then the HCR procedure was carried out directly on the MB surface. Protocol B: HCR was carried out in solution and then the HCR product was hybridized with target DNA on the MB surface. CL intensities of different protocols are shown in Fig. 2. CL intensity for protocol A was higher than that for protocol B, indicating that protocol A was better than protocol B. We assume that the long-strand HCR product immobilized on PS–SA increased the steric hindrance on the reaction of short-strand reporter on the PS and target on the MB, consequently reducing the hybridization efficiency. Thus, we employed protocol A for subsequent work.
Fig. 2

CL intensity vs. different protocols of HCR. Experimental conditions (both protocols A and B): MB, capture, target, PS–SA, reporter, HCR trigger, and H1/H2 were 20 μg, 20 pmol, 500/100/0 fmol, 40 μg, 40 pmol, 10 pmol and 40/40 pmol, respectively

As described above, the steric hindrance effect might be a key issue to be considered, so two different diameters of the PS–SA (130 and 490 nm) were comparatively investigated. Theoretically, one 490-nm-diameter PS–SA approximately bears 46,371 biotinylated aptamer sequences whereas one 130-nm-diameter PS–SA only binds 2756 sequences, indicating that the CL intensity per 490-nm-diameter particle should be 16.8 times higher than that per 130-nm-diameter particle [49]. However, Fig. 3 clearly shows that the CL intensity of the 130-nm PS–SA was two times higher than that of the 490-nm PS–SA. We attribute this phenomenon to the effect of steric hindrance of particle size. The particle size per 490-nm-diameter PS–SA is about 53-fold bigger than that per 130-nm-diameter particle PS–SA on the same MB surface because of the confined binding space on MB surface. Thus, subsequent experiments employed 130-nm PS–SA.
Fig. 3

CL intensity vs. the diameter of PS–SA. Experimental conditions: MB, capture, target, PS–SA, reporter, HCR trigger, and H1/H2 were 20 μg, 20 pmol, 1000/100/10/1 fmol, 40 μg, 40 pmol, 10 pmol and 40 pmol, respectively

3.3 Optimization of Reaction Parameters

To achieve an optimal analytical performance, several experimental parameters were investigated and evaluated, including the amounts of capture DNA, reporter DNA, HCR trigger, H1, H2, MB, and PS–SA.

The effect of the capture amounts on CL intensity was first investigated (Fig. 4). As the amounts of capture DNA increased, CL intensity increased at the beginning and reached a maximum at 20 pmol of capture DNA, and then decreased rapidly, possibly due to the high density of capture DNA that reduced the hybridization reaction. Thus, 15 pmol of capture DNA was employed for use in further studies. When it comes to the PS–SA complex, the amounts of not only reporter DNA but also the HCR trigger can influence the amplification efficiency in a synergistical way, and thus the effect of their amounts was subsequently optimized. First, CL intensity increased in the range of 10–30 pmol of reporter DNA and then decreased (Fig. 5a). Second, CL intensity increased with an increasing amount of trigger DNA under 15 pmol, and then decreased (Fig. 5b), indicating that a relatively high density of reporter DNAs do good to the formation of PS–SA complex. Thus, 30 pmol of reporter DNA and 15 pmol of trigger DNA were selected in further studies. In the HCR process, CL intensity increased as the amount of H1 increased from 5 to 30 pmol (Fig. 6a) and that of H2 enhanced from 30 to 120 pmol (Fig. 6b). Hence, 30 pmol of H1 and 120 pmol H2 were selected for subsequent experiments. In addition, the amount of MB and PS–SA was also optimized, as shown in Fig. 7, 40 μg MB and 60 μg of PS–SA were the optimal amounts. The above optimal experimental conditions were employed in the subsequent DNA detection.
Fig. 4

CL intensity vs. the amount of capture DNA. Experimental conditions: MB, target, PS–SA, reporter, HCR trigger and H1/H2 were 40 μg, 500 fmol, 40 μg, 40 pmol, 10 pmol and 40 pmol/40 pmol, respectively

Fig. 5

a CL intensity vs. the amount of reporter. Experimental conditions: MB, capture, target, PS–SA, HCR trigger and H1/H2 were 40 μg, 20 pmol, 500 fmol, 60 μg, 10 pmol and 40 pmol/40 pmol, respectively; b CL intensity vs. the amount of HCR trigger. Experimental conditions: MB, capture, target, PS–SA, reporter and H1/H2 were 40 μg, 20 pmol, 500 fmol, 60 μg, 30 pmol and 40 pmol/40 pmol, respectively

Fig. 6

a CL intensity vs. the H1 amount. Experimental conditions: MB, capture, target, PS–SA, reporter, HCR trigger and H2 were 40 μg, 20 pmol, 500 fmol, 60 μg, 30 pmol, 15 pmol and 40 pmol, respectively; b CL intensity vs. the H2 amount. Experimental conditions: MB, capture, target, PS–SA, reporter, HCR trigger and H1 were 40 μg, 20 pmol, 500 fmol, 60 μg, 30 pmol, 15 pmol and 30 pmol, respectively

Fig. 7

a CL intensity vs. the MB amount. Experimental conditions: capture, target, PS–SA, reporter, HCR trigger and H1/H2 were 20 pmol, 500 fmol, 40 μg, 40 pmol, 10 pmol and 40 pmol/40 pmol, respectively; b CL intensity vs. the 130-nm PS–SA amount. Experimental conditions: MB, capture, target, reporter, HCR trigger and H1/H2 were 40 μg, 20 pmol, 500 fmol, 40 pmol, 10 pmol and 40 pmol/40 pmol, respectively

3.4 DNA Assay Performance

Under the optimal conditions, the quantitative behavior of this method was assessed by monitoring the dependence of CL intensity on the concentration of target DNA. As shown in Fig. 8, a calibration graph in the amount range of 0.01 fmol–10 pmol showed an approximately linear correlation between the amount of target DNA and the CL intensity (represented by lg I = 0.4464C + 3.3856, R 2 = 0.9782, while I is the CL intensity and C is the amount of target DNA).The calculated limit of detection was estimated to be 5 amol (0.05 pM), which compares favorably with other DNA detection schemes (Table 2).
Fig. 8

Log–log calibration data for target DNA. Experimental conditions: MB, capture, PS–SA, reporter, HCR trigger and H1/H2 were 40 μg, 20 pmol, 60 μg, 30 pmol, 15 pmol and 30 pmol/120 pmol, respectively. The reaction temperature was 37 °C and the procedure was carried out as described in Sect. 2. The error bars represent one standard deviation for at least three measurements

Table 2

Comparison of sensitivity for detecting DNA based on different methods

Analytical methods

Label

No. of target bases

LOD

QCM-D

Label free

24

0.1 nM [50]

Colorimetric detection

Au NPs

30

10 nM [51]

SPR

Au NPs

30

1 pM [52]

Scanometric

Au NPs

27

0.5 pM [53]

SERS

Label free

29

0.1 nM [54]

Electrochemical detection

Ferrocene

30

3.4 pM [55]

Electrochemical detection

HRP

22

17 pM [56]

Fluorescence imaging

Label free

23

36 pM [57]

Fluorescence

FRET

45

10 pM [58]

CL detection

UCNPs

18

5 pM [59]

CL detection (this work)

Label free

35

0.05 pM

3.5 Discrimination of Single-Base Mismatched DNA Sequences

Assay specificity was examined by measuring a full complementary target and four kinds of single-base mismatched targets. The results indicate that the HCR-based DNA detection platform exhibits an excellent capability in differentiating a single-base mismatch in the target sequence, which demonstrated the good selectivity of this platform. Therefore, the proposed technique is particularly attractive for the CL detection of specific DNA sequences (Fig. 9).
Fig. 9

CL intensity vs. different DNA sequences. Experimental conditions: MB, capture, PS–SA, reporter, HCR trigger and H1/H2, were 40 μg, 20 pmol, 60 μg, 30 pmol, 15 pmol, and 30 pmol/120 pmol, respectively; both target and mismatched DNA were 500 fmol

4 Conclusions

In summary, we have demonstrated a novel and universal amplification system for label-free and quantitative DNA detection, based on merging the function of HCR and PS–SA amplification. Compared with the conventional sandwich-type assay, the reporter DNA immobilized on the PS–SA was combined with many HCR triggers, generating a cascade of nicked double helices analogous to alternating copolymers by opening the two-locked hairpin DNA. What’s more, since there loaded plenty of trigger sequences on the surface of PS–SA, a single target DNA could read out several HCR events, and further improved the sensitivity. Good results (e.g., wider linear response range, lower detection limit, and higher specificity) were obtained in this dual-amplification system. Besides, this platform can be easily extended for use with other nucleic acids by turning the hybridization region of capture and reporter sequences. Thus, this HCR-based CL recognition platform holds great potential in the field of DNA diagnostics and clinical analysis.

Notes

Acknowledgements

This work was supported by the Natural Science Foundation of China (Nos. 21375025 and 21675030).

References

  1. 1.
    Schena M, Shalon D, Davis RW, Brown PO. Quantitative monitoring of gene expression patterns with a complementary DNA microarray. Science. 1995;70:467–70.CrossRefGoogle Scholar
  2. 2.
    Husale S, Persson HH, Sahin O. DNA nanomechanics allows direct digital detection of complementary DNA and microRNA targets. Nature. 2009;462:1075–8.CrossRefGoogle Scholar
  3. 3.
    Lam B, Das J, Holmes RD, Live L, Sage A, Sargent EH, Kelley SO. Solution-based circuits enable rapid and multiplexed pathogen detection. Nat Commun. 2013;4:2001–8.Google Scholar
  4. 4.
    Xiao HJ, Hak HC, Kong DM, Shen HX. Sequence-specific detection of nucleic acids utilizing isothermal enrichment of G-quadruplex DNAzymes. Anal Chim Acta. 2012;729:67–72.CrossRefGoogle Scholar
  5. 5.
    Li C, Karadeniz H, Canavar E, Erdem A. Electrochemical sensing of label free DNA hybridization related to breast cancer 1 gene at disposable sensor platforms modified with single walled carbon nanotubes. Electrochim Acta. 2012;82:137–42.CrossRefGoogle Scholar
  6. 6.
    Nascimento JM, Garcia S, Saia-Cereda VM, Santana AG, Brandao-Teles C, Zuccoli GS, Junqueira DG, Reis-de-Oliveira G, Baldasso PA, Cassoli JS, Martins-de-Souza D. Proteomics and molecular tools for unveiling missing links in the biochemical understanding of schizophrenia. Proteom Clin Appl. 2016;10:1148–58.CrossRefGoogle Scholar
  7. 7.
    Ye KH, Manzano M, Muzzi R, Gin KYH, Saeidi N, Goh SG, Tok AIY, Marks RS. Development of a chemiluminescent DNA fibre optic genosensor to Hepatitis A Virus (HAV). Talanta. 2017;174:401–8.CrossRefGoogle Scholar
  8. 8.
    Zou B, Ma Y, Wu H, Zhou G. Signal amplification by rolling circle amplification on universal flaps yielded from target-specific invasive reaction. Analyst. 2012;137:729–34.CrossRefGoogle Scholar
  9. 9.
    Wang X, Lou X, Wang Y, Guo Q, Fang Z, Zhong X, Mao H, Jin Q, Wu L, Zhao H, Zhao J. QDs-DNA nanosensor for the detection of hepatitis B virus DNA and the single-base mutants. Biosens Bioelectron. 2010;25:1934–40.CrossRefGoogle Scholar
  10. 10.
    Chen XH, Roloff A, Seitz O. Consecutive signal amplification for DNA detection based on de novo fluorophore synthesis and host–guest chemistry. Angew Chem Int Ed. 2012;51:4479–83.CrossRefGoogle Scholar
  11. 11.
    Niu S, Jiang Y, Zhang S. Fluorescence detection for DNA using hybridization chain reaction with enzyme-amplification. Chem Commun. 2010;46:3089–91.CrossRefGoogle Scholar
  12. 12.
    Qi YY, Xiu FR, Li BX. One-step homogeneous non-stripping chemiluminescence metal immunoassay based on catalytic activity of gold nanoparticles. Anal Biochem. 2014;449:1–8.CrossRefGoogle Scholar
  13. 13.
    Cai S, Lau CW, Lu JZ. Sequence-specific detection of short-length DNA via template-dependent surface-hybridization events. Anal Chem. 2010;82:7178–84.CrossRefGoogle Scholar
  14. 14.
    Qi Y, Li B. A sensitive, label-free, aptamer-based biosensor using a gold nanoparticle-initiated chemiluminescence system. Chem Eur J. 2011;17:1642–8.CrossRefGoogle Scholar
  15. 15.
    Bi S, Zhao T, Luo B. A graphene oxide platform for the assay of biomolecules based on chemiluminescence resonance energy transfer. Chem Commun. 2012;48:106–8.CrossRefGoogle Scholar
  16. 16.
    Wang HQ, Liu WY, Wu Z, Tang LJ, Xu XM, Yu RQ, Jiang JH. Homogeneous label-free genotyping of single nucleotide polymorphism using ligation-mediated strand displacement amplification with DNAzyme-based chemiluminescence detection. Anal Chem. 2011;83:1883–9.CrossRefGoogle Scholar
  17. 17.
    Li J, Deng T, Chu X, Yang R, Jiang J, Shen G, Yu R. Rolling circle amplification combined with gold nanoparticle aggregates for highly sensitive identification of single-nucleotide polymorphisms. Anal Chem. 2010;82:2811–6.CrossRefGoogle Scholar
  18. 18.
    Liu Y, Wu Z, Zhou G, He Z, Zhou X, Shen A, Hu J. Simple, rapid, homogeneous oligonucleotides colorimetric detection based on non-aggregated gold nanoparticles. Chem Commun. 2012;48:3164–6.CrossRefGoogle Scholar
  19. 19.
    Vezocnik V, Rebolj K, Sitar S, Otaa K, Znidari MT, Strus J, Sepci K, Pahovnik D, Macek P, Zagar E. Size fractionation and size characterization of nanoemulsions of lipid droplets and large unilamellar lipid vesicles by asymmetric-flow field-flow fractionation/multi-angle light scattering and dynamic light scattering. J Chromatogr A. 2015;1418:185–91.CrossRefGoogle Scholar
  20. 20.
    Branch SD, Lines AM, Lynch J, Bello JM, Heineman WR, Bryan SA. Optically transparent thin-film electrode chip for spectroelectrochemical sensing. Anal Chem. 2017;89:7324–32.CrossRefGoogle Scholar
  21. 21.
    Chuang TL, Wei CS, Lee SY, Lin CW. A polycarbonate based surface plasmon resonance sensing cartridge for high sensitivity HBV loop-mediated isothermal amplification. Biosens Bioelectron. 2012;32:89–95.CrossRefGoogle Scholar
  22. 22.
    Zhai J, Cui H, Yang R. DNA based biosensors. Biotechnol Adv. 1997;15:43–58.CrossRefGoogle Scholar
  23. 23.
    Park SJ, Taton TA, Mirkin CA. Array-based electrical detection of DNA with nanoparticle probes. Science. 2002;295:1503–6.CrossRefGoogle Scholar
  24. 24.
    Zhang Y, Pothukuchy A, Shin W, Kim Y, Heller A. Detection of approximately 10(3) copies of DNA by an electrochemical enzyme-amplified sandwich assay with ambient O(2) as the substrate. Anal Chem. 2004;76:4093–7.CrossRefGoogle Scholar
  25. 25.
    Caruana DJ, Heller A. Enzyme-amplified amperometric detection of hybridization and of a single base pair mutation in an18-base oligonucleotide on a 7-mm-diameter microelectrode. J Am Chem Soc. 1999;121:769–74.CrossRefGoogle Scholar
  26. 26.
    Patolsky F, Lichtenstein A, Willner I. Detection of single-base DNA mutations by enzyme-amplified electronic transduction. Nat Biotechnol. 2001;19:253–7.CrossRefGoogle Scholar
  27. 27.
    Shimron S, Wang F, Orbach R, Willner I. Amplified detection of DNA through the enzyme-free autonomous assembly of hemin/G-quadruplex DNAzyme nanowires. Anal Chem. 2012;84:1042–8.CrossRefGoogle Scholar
  28. 28.
    Chai Y, Tian D, Wang W, Cui H. A novel electrochemiluminescence strategy for ultrasensitive DNA assay using luminol functionalized gold nanoparticles multi-labeling and amplification of gold nanoparticles and biotin–streptavidin system. Chem Commun. 2010;46:7560–2.CrossRefGoogle Scholar
  29. 29.
    Zhou X, Xing D, Zhu D, Jia L. Magnetic bead and nanoparticle based electrochemiluminescence amplification assay for direct and sensitive measuring of telomerase activity. Anal Chem. 2009;81:255–61.CrossRefGoogle Scholar
  30. 30.
    Authier L, Grossiord C, Brossier P, Limoges B. Gold nanoparticle-based quantitative electrochemical detection of amplified human cytomegalovirus DNA using disposable microband electrodes. Anal Chem. 2001;73:4450–6.CrossRefGoogle Scholar
  31. 31.
    Dirks RM, Pierce NA. Triggered amplification by hybridization chain reaction. Proc Natl Acad Sci USA. 2004;101:15275–8.CrossRefGoogle Scholar
  32. 32.
    Huang J, Wu Y, Chen Y, Zhu Z, Yang Y, Yang CJ, Wang K, Tan W. Pyrene-excimer probes based on the hybridization chain reaction for the detection of nucleic acids in complex biological fluids. Angew Chem Int Ed. 2011;50:401–4.CrossRefGoogle Scholar
  33. 33.
    Song WQ, Zhu KL, Cao ZJ, Lau CW, Lu JZ. Hybridization chain reaction-based aptameric system for the highly selective and sensitive detection of protein. Analyst. 2012;137:1396–401.CrossRefGoogle Scholar
  34. 34.
    Wang XZ, Jiang AW, Hou T, Li HY, Li F. Enzyme-free and label-free fluorescence aptasensing strategy for highly sensitive detection of protein based on target-triggered hybridization chain reaction amplification. Biosens Bioelectron. 2015;70:324–9.CrossRefGoogle Scholar
  35. 35.
    Hao YL, Guo QQ, Wu HY, Guo LQ, Zhong LS, Wang J, Lin TR, Fu FF, Chen GN. Amplified colorimetric detection of mercuric ions through autonomous assembly of G-quadruplex DNAzyme nanowires. Biosens Bioelectron. 2014;52:261–4.CrossRefGoogle Scholar
  36. 36.
    Kojima E, Ohba Y, Kai M, Ohkura Y. Phenylglyoxal and glyoxal as fluorogenic reagents selective for N-terminal tryptophan-containing peptides. Anal Chim Acta. 1993;280:157–62.CrossRefGoogle Scholar
  37. 37.
    Yu CY, Yin BC, Ye BC. A universal real-time PCR assay for rapid quantification of microRNAs via the enhancement of base-stacking hybridization. Chem Commun. 2013;49:8247–9.CrossRefGoogle Scholar
  38. 38.
    Yin BC, Liu YQ, Ye BC. One-step, multiplexed fluorescence detection of microRNAs based on duplex-specific nuclease signal amplification. J Am Chem Soc. 2012;134:5064–7.CrossRefGoogle Scholar
  39. 39.
    Zuo X, Xia F, Xiao Y, Plaxco KW. Sensitive and selective amplified fluorescence DNA detection based on exonuclease III-aided target recycling. J Am Chem Soc. 2010;132:1816–8.CrossRefGoogle Scholar
  40. 40.
    Shi M, Zheng J, Tan Y, Tan J, Li J, Li Y, Li X, Zhou Z, Yang R. Ultrasensitive detection of single nucleotide polymorphism in human mitochondrial DNA utilizing ion-mediated cascade surface-enhanced Raman spectroscopy amplification. Anal Chem. 2015;87:2734–40.CrossRefGoogle Scholar
  41. 41.
    Ge J, Zhang LL, Liu SJ, Yu RQ, Chu X, Chen A. A highly sensitive target primed rolling circle amplification (TPRCA) method for fluorescent in situ hybridization detection of microRNA in tumor cells. Anal Chem. 2014;86:1808–15.CrossRefGoogle Scholar
  42. 42.
    Deng R, Tang L, Tian Q, Wang Y, Lin L, Li J. Toehold-initiated rolling circle amplification for visualizing individual microRNAs in situ in single cells. Angew Chem Int Ed. 2014;53:2389–93.CrossRefGoogle Scholar
  43. 43.
    Cao ZJ, Peng QW, Qiu X, Liu CY, Lu JZ. Highly sensitive chemiluminescence technology for protein detection using aptamer-based rolling circle amplification platform. J Pharceutical Anal. 2011;1:159–65.CrossRefGoogle Scholar
  44. 44.
    Wang X, Lau CW, Kai M, Lu JZ. Hybridization chain reaction-based instantaneous derivatization technology for chemiluminescence detection of specific DNA sequences. Analyst. 2013;138:2691–7.CrossRefGoogle Scholar
  45. 45.
    Cai S, Cao ZJ, Lau CW, Lu JZ. Label-free technology for the amplified detection of microRNA based on the allosteric hairpin DNA switch and hybridization chain reaction. Analyst. 2014;139:6022–7.CrossRefGoogle Scholar
  46. 46.
    Su J, Zhang HJ, Jiang BY, Zheng HZ, Chai YQ, Yuan R, Xiang Y. Dual signal amplification for highly sensitive electrochemical detection of uropathogens via enzyme-based catalytic target recycling. Biosens Bioelectron. 2011;29:184–8.CrossRefGoogle Scholar
  47. 47.
    Takalkar S, Baryeh K, Liu GD. Fluorescent carbon nanoparticle-based lateral flow biosensor for ultrasensitive detection of DNA. Biosens Bioelectron. 2017;98:147–54.CrossRefGoogle Scholar
  48. 48.
    Zhong D, Yang KC, Wang YY, Yang XM. Dual-channel sensing strategy based on gold nanoparticles cooperating with carbon dots and hairpin structure for assaying RNA and DNA. Talanta. 2017;175:217–23.CrossRefGoogle Scholar
  49. 49.
    Peng QW, Cao ZJ, Lau CW, Kai M, Lu JZ. Aptamer-barcode based immunoassay for the instantaneous derivatization chemiluminescence detection of IgE coupled to magnetic beads. Analyst. 2011;136:140–7.CrossRefGoogle Scholar
  50. 50.
    Tang W, Wang D, Xu Y, Li N, Liu F. A self-assembled DNA nanostructure-amplified quartz crystal microbalance with dissipation biosensing platform for nucleic acids. Chem Commun. 2012;48:6678–80.CrossRefGoogle Scholar
  51. 51.
    Elghanian R, Storhoff JJ, Mucic RC, Letsinger RL, Mirkin CA. Selective colorimetric detection of polynucleotides based on the distance-dependent optical properties of gold nanoparticles. Science. 1997;277:1078–81.CrossRefGoogle Scholar
  52. 52.
    Taton TA, Lu G, Mirkin CA. Two-color labeling of oligonucleotide arrays via size-selective scattering of nanoparticle probes. J Am Chem Soc. 2001;123:5164–5.CrossRefGoogle Scholar
  53. 53.
    Nam JM, Stoeva SI, Mirkin CA. Bio-bar-code-based DNA detection with PCR-like sensitivity. J Am Chem Soc. 2004;126:5932–3.CrossRefGoogle Scholar
  54. 54.
    Feng X, Luoa XT, Hsing IM. Sensitive immobilization-free electrochemical DNA sensor based on isothermal circular strand displacement polymerization reaction. Biosens Bioelectron. 2012;35:230–4.CrossRefGoogle Scholar
  55. 55.
    Gao FL, Lei JP, Ju HX. Label-free surface-enhanced Raman spectroscopy for sensitive DNA detection by DNA-mediated silver nanoparticle growth. Anal Chem. 2013;85:11788–93.CrossRefGoogle Scholar
  56. 56.
    Zhang ZP, Zhou JY, Tang AA, Wu ZY, Shen GL, Yu RQ. Scanning electrochemical microscopy assay of DNA based on hairpin probe and enzymatic amplification biosensor. Biosens Bioelectron. 2010;25:1953–7.CrossRefGoogle Scholar
  57. 57.
    Zhao C, Wu L, Ren J, Qu X. A label-free fluorescent turn-on enzymatic amplification assay for DNA detection using ligand-responsive G-quadruplex formation. Chem Commun. 2011;47:5461–3.CrossRefGoogle Scholar
  58. 58.
    Mei Z, Tang L. Surface-plasmon-coupled fluorescence enhancement based on ordered gold nanorod array biochip for ultrasensitive DNA analysis. Anal Chem. 2017;89:633–9.CrossRefGoogle Scholar
  59. 59.
    Alonso-Cristobal P, Vilela P, El-Sagheer A, Lopez-Cabarcos E, Brown T, Muskens OL, Rubio-Retama J, Kanaras AG. Highly sensitive DNA sensor based on upconversion nanoparticles and graphene oxide. ACS Appl Mater Interfaces. 2015;7:12422–9.CrossRefGoogle Scholar

Copyright information

© The Nonferrous Metals Society of China and Springer Nature Singapore Pte Ltd. 2017

Authors and Affiliations

  1. 1.School of PharmacyFudan UniversityShanghaiChina

Personalised recommendations