Advertisement

Fungal Diversity

, Volume 90, Issue 1, pp 1–84 | Cite as

Biodiversity of fungi on Vitis vinifera L. revealed by traditional and high-resolution culture-independent approaches

  • Ruvishika S. Jayawardena
  • Witoon Purahong
  • Wei Zhang
  • Tesfaye Wubet
  • XingHong Li
  • Mei Liu
  • Wensheng Zhao
  • Kevin D. Hyde
  • JianHua Liu
  • Jiye Yan
Open Access
Article

Abstract

This study is unique as it compares traditional and high-resolution culture-independent approaches using the same set of samples to study the saprotrophic fungi on Vitis vinifera. We identified the saprotrophic communities of table grape (Red Globe) and wine grape (Carbanate Gernischet) in China using both traditional and culture-independent techniques. The traditional approach used direct observations based on morphology, single spore isolation and phylogenetic analysis yielding 45 taxa which 19 were commonly detected in both cultivars. The same set of samples were then used for Illumina sequencing which analyzed ITS1 sequence data and detected 226 fungal OTUs, of which 176 and 189 belong to the cultivars Carbanate Gernischet and Red Globe, respectively. There were 139 OTUs shared between the two V. vinifera cultivars and 37 and 50 OTUs were specific to Carbanate Gernischet and Red Globe cultivars respectively. In the Carbanate Gernischet cultivar, Ascomycota accounted for 77% of the OTUs and in Red Globe, almost all sequenced were Ascomycota. The fungal taxa overlap at the genus and species level between the traditional and culture-independent approach was relatively low. In the traditional approach we were able to identify the taxa to species level, while in the culture-independent method we were frequently able to identify the taxa to family or genus level. This is remarkable as we used the same set of samples collected in China for both approaches. We recommend the use of traditional techniques to accurately identify taxa. Culture-independent method can be used to get a better understanding about the organisms that are present in a host in its natural environment. We identified primary and secondary plant pathogens and endophytes in the saprotrophic fungal communities, which support previous observations, that dead plant material in grape vineyards can be the primary sources of disease. Finally, based on present and previous findings, we provide a worldwide checklist of 905 fungal taxa on Vitis species, which includes their mode of life and distribution.

Keywords

Checklist Grapevine Mycobiome Next generation sequencing Pathogens Saprotrophs 

Introduction

Vitis (family Vitaceae) is a plant genus that includes the economically important grapes, and thus because of its importance, its pathogens have received a considerable amount of attention during the past decade (Yan et al. 2015; Chethana et al. 2017). The importance of this fruit is associated with its multiple uses; as a source of nutrition, health and medicinal value, as well as its high economical significance (Dohadwala and Vita 2009; Bokulich et al. 2014). About 90% of cultivated grapes in the world are V. vinifera, which comprises wine, as well as table grapes. This genus comprises 79 accepted species of perennial woody and herbaceous vines. There are thousands of cultivars of V. vinifera that has been grown successfully around the globe (Terral et al. 2009). Species of Vitis are valued for their decorative foliage providing ornamental value for the genus. Their ability to cover walls and arches, as well as providing shade has made them important in domestic cultivation.

Numerous diseases of grapes have been identified which reduce the yield and quality of this fruit crop (Úrbez-Torres et al. 2009). Among various pathogens known on grapevine, the damage caused by fungi is significant (Úrbez-Torres 2011). Most studies on fungal pathogens in grape have focused on their pathogenic phase, which relies on direct observation and isolations of fungal pathogens from infected grape material. Fungi that may live within the host tissue are known as endophytes and are considered to cause symptomless infections (Lane and Kirk 2012). Plant pathogenic fungi can survive by changing their biotrophic mode from pathogenic to saprotrophic or at least can remain dormant on the decaying plant materials and become active when suitable conditions for infection exist (Hoppe et al. 2016; Purahong et al. 2018). For example, Botrytis cinerea causing gray mold disease in grape is able to live as a parasite in green tissues and as a saprotroph in dead plant material (Armijo et al. 2016). Unfortunately, our knowledge on saprotrophic fungal community associated with V. vinifera is limited, especially those obtained by high-resolution culture-independent techniques. The percentage of potential fungal pathogens hidden in saprotrophic community is still unclear.

Saprotrophs are organisms that derive nourishment from dead or decaying organic matter (Hyde et al. 2007). Saprotrophs are heterotrophic organisms that break down the complex compounds of dead organisms (Deighton 2016). They play an important role as decomposers of dead organic matter in natural ecosystems by releasing enzymes from hyphal tips (Duarte et al. 2006; Bucher et al. 2004). Saprotrophic fungi can be either macrofungi (Agaricus sp., Phallus sp.) (García et al. 1998) or microfungi (Aspergillus sp., Dothiorella sp., Mucor sp., Neomassaria sp., Rhizopus sp.) (Vohník et al. 2011; Hyde et al. 2016). Hyde et al. (2007) and Purahong et al. (2018), provided evidence that some plants accommodate large numbers of saprotrophic taxa and that some might be host- or organ-specific. Other than being decomposers, saprotrophs can also provide other eco-system services, such as soil formation, defence against pathogens, as a food source and modification of pollutants (Deighton 2016). Promputtha et al. (2007, 2010) provided evidence that not only fungal pathogens, but also fungal endophytes, can switch lifestyles to saprotrophs. Thus, the study of saprotrophic fungal communities associated with V. vinifera can provide information on strict saprotrophism as well as potential endophytes and pathogens with saprotrophic ability.

Fungal species identification has traditionally been based on direct observation, microscope examination, culture dependent isolation and phylogenetic analysis (Cai et al. 2011; Hyde et al. 2010, 2017; Rastogi and Sani 2011; Fadrosh et al. 2014, Tibpromma et al. 2017). Such studies have investigated the microbial ecology of various environments (Rastogi and Sani 2011). However, it has been recognized that the actual number of microbes in nature, often exceed the number of microbes identified by traditional methods (Fadrosh et al. 2014). Traditional approaches rely on growing the organisms in media, but many of the microbes in the environment may not be cultivatable (Stewart 2012). Artificial medium typically allows growth of only a small fraction of, often fast growing organisms. Therefore, traditional techniques do not provide a total community resolution (Hoppe et al. 2016).

During the past decade, microbial research made a shift from phylogenetic analyses to experimental characterization of communities through the use of complex experimental designs (Kozich et al. 2013). This shift focused on relatively inexpensive next-generation sequencing approaches (NGS) and powerful bio-informatics tools to analyse the microbial ecology (Carraro et al. 2011; Rastogi and Sani 2011). High-throughput DNA sequencing allows us to understand the presence of microbes and how their communities are structured in complex ecosystems. Microbiome analysis is a culture-independent technique which requires a low quantity of sample, but with a high sequencing depth. The term microbiome refers to the entire habitat including the microorganisms, their genomes and the surrounding environment. It is characterized by the application of one or combinations of metagenomics, metabonomics, metatranscriptomics and metaproteomics (Marchesi and Ravel 2015). Analysis of the plant microbiome involves linking microbial ecology and the plants biology and functions, and at the same time viewing microorganisms as a reservoir of additional genes and functions for their host (Vandenkoornhuyse et al. 2015). Mycobiome refers to the fungal component in a habitat (Underhill and Iliev 2014). However, these techniques may also have disadvantages. For example, the conditions that we select to do the PCR can give us biased results. Sometimes it is difficult to understand whether the fungi identified by this technique actually exist in the natural system (Mitchell and Zuccaro 2006). Therefore, in order to obtain a better resolution in species identification, richness and distribution patterns of microbes, a combination of both approaches (i.e. traditional and culture-independent) are needed. However, we are aware of no studies that have been conducted using both these approaches.

There have been many studies of major pathogens from Vitis using both morphology and phylogeny (Úrbez-Torres et al. 2012, 2013a, b; Dissanayake et al. 2015; Jayawardena et al. 2015, 2016a; Chethana et al. 2017). Even though a number of sexual and asexual fungi have been reported on Vitis species, updated information of the taxa present in this genus is lacking. Only some have good illustrations and gene sequence data. Our knowledge on saprotrophic fungal communities associated with V. vinifera is limited and data based on high-resolution culture-independent technique is lacking. Besides the percentage of potential fungal pathogens hidden in saprotrophic community is still unknown.

In this study, we aim to (i) provide taxonomic information on the saprotrophic microfungi collected from China, Italy, Thailand and Russia, (ii) compare traditional and culture-independent approaches for characterizing the saprotrophic fungal communities associated with two cultivars of V. vinifera in China, (iii) quantify plant pathogens and endophytes hidden in the saprotrophic fungal community and (iv) provide a worldwide checklist for the fungi on Vitis species based on previous and current research.

Materials and methods

Study site, sampling and isolation of fungi

Fungal species associated with Vitis sp. were collected from China (Beijing, Sichuan and Yunnan Province), Italy (Province of Forlì-Cesena), Russia (Rostov Region) and Thailand (Chiang Sean) (Tables 1, 2). Shoots, leaves, inflorescences, bark and root samples of Vitis vinifera were used for isolation. The same set of samples from Beijing (Red Globe cultivar) and Yunnan Province (Carbanate Gernischet cultivar) were used for the mycobiome analysis to establish the fungal communities (Fig. 1). The sample sets were randomly split into two subsamples to employ the two approaches at the same time. Specimens were incubated in a moist chamber for 3–7 days at 25 °C, if they did not sporulate. Fungi were isolated by a modified single spore/conidial isolation method (Chomnunti et al. 2014) from the samples. Growth rate, colony characteristics and sexual/asexual morph morphology were determined from cultures grown on potato-dextrose agar (PDA) at 25 °C, under 12 h light/12 h dark. Fungal mycelia and spores were examined by differential interference contrast (DIC) and photographed with an axio Imager Z2 photographic Microscope (Carl Zeiss Microscopy, Germany) (Supplementary Figs. S1a–S1d, S2). Forty conidial measurements were taken for each isolate. All microscopic measurements were recorded with ZeM PRo 2012 software. Representative herbariums are deposited in the herbarium of Mae Fah Luang University, Chiang Rai, Thailand (MFU) and in Kunming, China (KIB). Representative cultures were deposited at Mae Fah Luang Culture Collection (MFLUCC), Beijing Academy of Agriculture and Forestry Sciences, China (JZB) and Kunming Culture Collection (KUMCC).
Table 1

Taxa identified in China, Russia, Italy and Thailand by directly observing specimens

Family

Species

Country

Amorosiaceae

Angustimassarina populi

Italy

Botryosphaeriaceae

Botryosphaeria dothidea

China, Italy

Botryosphaeriaceae

Diplodia seriata

Italy

Botryosphaeriaceae

Dothiorella iberica

Italy

Botryosphaeriaceae

Dothiorella sarmentorum

China, Italy

Botryosphaeriaceae

Neofusicoccum italicum

Italy

Botryosphaeriaceae

Neofusicoccum parvum

Italy

Cantharellales Incertae sedis

Minimedusa sp.

China

Chaetomiaceae

Chaetomium globosum

Italy

Chaetosphaeriaceae

Pseudolachnea hispidula

Italy

Cladosporiaceae

Cladosporium cladosporioides

China, Italy

Cladosporiaceae

Cladosporium cucumerinum

Italy

Diaporthaceae

Diaporthe ampelina

Italy

Diaporthaceae

Diaporthe rudis

Italy

Diaporthaceae

Diaporthe eres

China

Diatrypaceae

Cryptovalsa ampelina

Italy

Didymellaceae

Didymella negriana

Italy

Didymellaceae

Didymella pomorum

China

Didymellaceae

Epicoccum nigrum

Italy

Didymosphaeriaceae

Pseudocamarosporium propinquum

Italy

Glomerellaceae

Colletotrichum dematium

Russia

Glomerellaceae

Colletotrichum godetiae

Italy

Glomerellaceae

Colletotrichum hebeiense

China

Glomerellaceae

Colletotrichum siamense

Italy

Glomerellaceae

Colletotrichum viniferum

China

Glomerellaceae

Colletotrichum truncatum

China

Hypocreaceae

Trichoderma atroviride

China

Hypocreaceae

Trichoderma lixii

China

Hypocreaceae

Trichoderma harzianum

China

Hypocreales genera insertae sedis

Alfaria cyperi-esculenti

Italy

Hypocreales genera insertae sedis

Alfaria vitis

Italy

Lophiostomataceae

Lophiostoma macrostomum

Italy

Massariaceae

Neomassaria fabacearum

Italy

Mucoraceae

Actinomucor elegans

China

Mucoraceae

Mucor racemosus

China

Mucoraceae

Mucor circinelloides

China

Mycosphaerellaceae

Pseudocercospora vitis

Thailand

Peniophoraceae

Peniophora sp.

China

Sporocadaceae

Neopestalotiopsis clavispora

China

Sporocadaceae

Neopestalotiopsis vitis

China

Sporocadaceae

Pestalotiopsis chamaeropis

Italy

Sporocadaceae

Pestalotiopsis sp.

Italy

Sporocadaceae

Pseudopestalotiopsis camelliae-sinensis

Italy

Pleosporaceae

Alternaria alternata

China, Italy

Pleosporaceae

Alternaria italic

Italy

Pleosporaceae

Alternaria vitis

China

Pleosporaceae

Bipolaris maydis

China

Pythiaceae

Pythium sp.

China

Saccotheciaceae

Aureobasidium pullulans

Italy

Schizoparmaceae

Coniella vitis

China

Sclerotiniaceae

Botrytis cinerea

China

Sporocadaceae

Seimatosporium vitis

Italy

Stachybotryaceae

Albifimbria verrucaria

China

Stachybotryaceae

Albifimbria viridis

China

Teichosporaceae

Floricola viticola

Italy

Aspergillaceae

Aspergillus aculeatus

China

Aspergillaceae

Aspergillus niger

China

Aspergillaceae

Penicillium brevicompactum

China

Aspergillaceae

Penicillium citrinum

China

Aspergillaceae

Penicillium terrigenum

China

Rhizopodaceae

Rhizopus oryzae

China

Trichocomaceae

Talaromyces amestolkiae

China

Trichocomaceae

Talaromyces pinophilus

China

Trichocomaceae

Talaromyces purpureogenus

China

Xylariaceae

Neoanthostomella viticola

Italy

Table 2

Taxa identified from the two grape cultivars and their life modes using the traditional approach

Species

Family

Life Mode

References

Actinomucor elegans var. meitauzae

Mucoraceae

Saprotroph

Zheng and Liu (2005)

Albifimbria viridis

Stachybotryaceae

Saprotroph

Lombard et al. (2016)

Albifimbria verrucaria

Stachybotryaceae

Saprotroph

Lombard et al. (2016)

Alternaria alternata

Pleosporaceae

Pathogen, endophyte, saprotroph

French (1989), Mulenko et al. (2008), Kakalikova et al. (2009), Gonzalez and Tello (2011)

Alternaria vitis

Pleosporaceae

Pathogen, endophyte, saprotroph

Zhang (2003), Zhuang (2005)

Aspergillus aculeatus

Aspergillaceae

Secondary pathogen, saprotroph

Jarvis and Traquair (1984)

Aspergillus niger

Aspergillaceae

Secondary pathogen, endophyte, saprotroph

Bobev (2009), Casieri et al. (2009), Gonzalez and Tello (2011)

Bipolaris maydis

Pleosporaceae

Saprotroph

Manamgoda et al. (2014)

Botryosphaeria dothidea

Botryosphaeriaceae

Pathogen, endophyte, saprotroph

Úrbez-Torres et al. 2012, 2013a, b

Botrytis cinerea

Sclerotiniaceae

Pathogen

Piqueras et al. (2014), Saito et al. (2016)

Cladosporium cladosporioides

Cladosporiaceae

Pathogen, endophyte, saprotroph

Swett et al. (2016)

Cladosporium sp.

Cladosporiaceae

Pathogen, endophyte, saprotroph

Swett et al. (2016)

Clonostachys rosea

Bionectriaceae

Pathogen, endophyte, saprotroph

Casieri et al. (2009)

Colletotrichum hebeiense

Glomerellaceae

Pathogen

Yan et al. (2015)

Colletotrichum truncatum

Glomerellaceae

Pathogen

Pan et al. (2016)

Colletotrichum viniferum

Glomerellaceae

Pathogen

Peng et al. (2013)

Coniella vitis

Schizoparmaceae

Pathogen

Chethana et al. (2017)

Diaporthe eres

Diaporthaceae

Pathogen

Bastide et al. (2017)

Didymella pomorum

Didymellaceae

Saprotroph

Cook and Dubé (1989)

Dothiorella sarmentorum

Botryosphaeriaceae

Pathogen

Carlucci et al. (2015)

Epiccocum nigrum

Didymellaceae

Saprotroph

Casieri et al. (2009)

Exserohilum rostratum

Pleosporaceae

Saprotroph

Ariyawansa et al. (2015)

Fusarium oxysporum

Nectriaceae

Pathogen

Gonzalez and Tello (2011)

Fusarium sp.

Nectriaceae

Pathogen

Gonzalez and Tello (2011)

Minimedusa sp.

Cantharellales incertae sedis

Saprotroph

Beale and Pitt (1990)

Mucor racemosus

Mucoraceae

Secondary pathogen

Gonzalez and Tello (2011)

Mucor circinelloides

Mucoraceae

Secondary pathogen

Gonzalez and Tello (2011)

Neopestalotiopsis clavispora

Sporocadaceae

Saprotroph

Maharachchikumbura et al. (2015)

Neopestalotiopsis vitis

Sporocadaceae

Pathogen

Jayawardena et al. (2015, 2016a, b)

Paraphoma chrysanthemicola

Pleosporales incertae sedis

Saprotroph

Hofstetter et al. (2012)

Penicillium brevicompactum

Aspergillaceae

Secondary pathogen

Kim et al. (2007)

Penicillium citrinum

Aspergillaceae

Secondary pathogen

Kim et al. (2007)

Penicillium terrigenum

Aspergillaceae

Secondary pathogen

Kim et al. (2007)

Peniophora sp.

Peniophoraceae

Saprotroph

Torrejón (2013)

Phoma medicaginis

Didymellaceae

Saprotroph

Weber et al. (2004)

Pythium amasculinum

Pythiaceae

Pathogen

Uzuhashi et al. (2010)

Rhizopus oryzae

Rhizopodaceae

Secondary pathogen

Gonzalez and Tello (2011)

Septoriella allojunci

Dothideomycetes incetae sedis

Saprotroph

Li et al. (2015)

Stagonosporopsis sp. 1

Didymellaceae

Saprotroph

Hofstetter et al. (2012)

Stagonosporopsis sp.2

Didymellaceae

Saprotroph

Hofstetter et al. (2012)

Talaromyces pinophilus

Trichocomaceae

Saprotroph

Yilmaz et al. (2014)

Talaromyces purpurogenus

Trichocomaceae

Saprotroph

Yilmaz et al. (2014)

Talaromyces amestolkiae

Trichocomaceae

Saprotroph

Yilmaz et al. (2014)

Trichoderma atroviride

Hypocreaceae

Saprotroph

Gonzalez and Tello (2011)

Trichoderma harzianum

Hypocreaceae

Saprotroph

Gonzalez and Tello (2011)

Trichoderma lixii

Hypocreaceae

Saprotroph

Gonzalez and Tello (2011)

Fig. 1

Dead V. vinifera samples at collection sites

DNA extraction, PCR amplification, sequencing and phylogenetic analysis

The methods used are presented in detail in Jayawardena et al. (2018).

Culture-independent approach: mycobiome analysis

Two cultivars were selected for this analysis; Red Globe being the table grape cultivar and Carbanate Gernischet being the Wine grape cultivar. Samples of Red Globe (RG) were collected from Yanqin District of Beijing while samples of Carbanate Gernischet (CG) were collected from Yunnan Province were used for this analysis. For each cultivar, three representative grapevine plants were sampled. The root, bark, shoot, inflorescence and leaves were homogenized and sub-sampled. For culture-independent technique of fungal communities, total DNA extraction was performed using 1 g of ground specimens using 2× CTAB method. All the DNA samples were quantitated and quality checked with the NanoDrop ND-2000C spectrophotometer (ThermoFisher Scientific, Dreieich, Germany). DNA extracts were then stored at − 20 °C for further analysis. For fungal Illumina sequencing, we targeted the Internal Transcribed Spacer 1 (ITS1) region of ribosomal RNA gene cluster. ITS1 was amplified with the forward primer ITS5-1737 (GGAAGTAAAAGTCGTAACAAGG) and reverse primer ITS2-2043R (GCTCGCTTCTTCATCGATGC) (White et al. 1990). The PCR reaction was performed in a 50 ml volume that contained approximately 10 ng of DNA, ExTaq buffer, 0.2 mM of dNTPs, 0.2 mM of each primer, and 2 units of ExTaq DNA polymerase. The cycling consisted of an initial denaturing at 94 °C for 30 s, followed by 25 cycles of denaturing at 94 °C for 30 s, annealing at 54 °C for 1 min and extension at 72 °C for 2 min, and a final extension at 72 °C for 8 min. All PCR reactions were carried out with Phusion® High-Fidelity PCR Master Mix (New England Biolabs Inc. Ipswich, MA, USA). The PCR products were mixed with same volume of 1× loading buffer (contained SYB green) and then operated electrophoresis on 2% agarose gel for quality detection. Only samples with bright main strip between 400–450 bp were chosen for further experiments. The qualified PCR products were mixed in equidensity ratios. Then, mixture PCR products were purified with Qiagen Gel Extraction Kit (Qiagen, Germany) following the manufacture’s protocol.

Sequencing libraries were generated using TruSeq® DNA PCR-Free Sample Preparation Kit (Illumina, San Diego, CA, USA) following manufacturer’s recommendations and index codes were added. The library quality was assessed on the Qubit® 2.0 Fluorometer (Thermo Scientific) and Agilent Bioanalyzer 2100 system. At last, the library was sequenced on an IlluminaHiSeq2500 platform and 250 bp paired-end reads were generated.

Paired-end reads were assigned to samples based on their unique barcode and truncated by cutting off the barcode and primer sequence. Paired-end reads were merged using FLASH (V1.2.7, http://ccb.jhu.edu/software/FLASH/) (Magoč and Salzberg 2011). Quality filtering on the raw tags was performed under specific filtering conditions to obtain the high-quality clean tags (Bokulich et al. 2013) according to the QIIME (V1.7.0, http://qiime.org/index.html) quality controlled process (Caporaso et al. 2010). The tags were compared with the reference database (Unite Database, https://unite.ut.ee/) using UCHIME algorithm (UCHIME Algorithm, http://www.drive5.com/usearch/manual/uchime_algo.html) to detect chimera sequences (Edgar et al. 2011), and then the chimera sequences were removed (Haas et al. 2011). Then the Effective Tags were finally obtained. Sequences analysis was performed by Uparse software (Uparse v7.0.1001, http://drive5.com/uparse/) (Edgar 2013). Sequences with ≥ 97% similarity were assigned to the same OTUs. Representative sequence for each OTU was screened for further annotation. For each representative sequence, the Unite Database (https://unite.ut.ee/) (Kõljalg et al. 2013) was used to annotate taxonomic information based on Blast algorithm, which was calculated by QIIME software (Version 1.7.0) (http://qiime.org/scripts/assign_taxonomy.html). In order to study phylogenetic relationship of different OTUs, and the difference of the dominant species in different samples (groups), multiple sequence alignment were conducted using the MUSCLE software (Version 3.8.31, http://www.drive5.com/muscle/) (Edgar 2004).

All OTU abundance information was normalized using a standard of sequence number corresponding to the sample with the least sequences (45, 246 sequences). From the data set, rare OTUs (singletons), which could have potentially originated from sequencing errors (Kunin et al. 2010), were removed. We used a Mantel test based on Bray–Curtis distance measure with 999 permutations to assess the correlation between the whole matrix and a matrix excluding the rare OTUs (Hammer et al. 2001; Hoppe et al. 2016). The results indicated that the removal of rare OTUs from the fungal communities had no effect (RMantel = 1.000, P = 0.002). Subsequent analysis of alpha diversity and community composition were all performed basing on these normalized rare OTUs removal data. The fungal ITS rDNA genes Illumina sequencing data are deposited in the NCBI under the BioProject No PRJNA437133.

Statistical analysis

Mycobiome analysis

All datasets related to fungal OTU richness were tested for normality and equality of variances using the Jarque–Bera test. To assess the coverage of the sequencing depth, individual rarefaction analysis was performed for each sample using the “diversity” function in PAST (Hammer et al. 2001). In this work we used observed fungal OTU richness and Shannon diversity index as the measures for fungal diversity. The difference in fungal OTU richness between the two deadwood species was compared using a two-sample t test in PAST. To visualize the fungal community compositions, we used non-metric multidimensional scaling (NMDS) analysis based on the Bray–Curtis dissimilarity index calculated PAST. Similarity Percentages (SIMPER) analysis using PAST was used to obtain the identity and relative abundances of the fungal taxa that contributed to 92.92% of the observed pair-wise variation in the fungal community composition due to different V. vinifera cultivars. To accounting for the effect of locations when compared the fungal community compositions of the two grape cultivars which were collected from different locations, we eliminated all location specific fungal OTUs (87 OTUs). We finally retained 139 OTUs for the community composition analysis using NMDS based on the Bray–Curtis dissimilarity. The results from these reduced datasets were highly consistent compared with the total datasets (Supplementary Fig. S3a, b). Potential fungal functional groups were identified using the online Guilds application tool: FUNGuildb (Nguyen et al. 2015). The ITS1 fragments were extracted from both the Sanger sequencing (traditional) and Illumina sequencing datasets using ITS1. The output showed that both datasets have the ITS1 region except culture sequences of the genus Neopestalotiopsis (9 sequences). The sequence similarity based comparison was performed using the cd-hit-est-2d algorithm at 90% similarity level for a genus level comparison.

Diversity analysis

Taxa were recorded as either present or absent from each sample. Occurrence of a fungus was designated based on the presence of a particular fungus on the host samples. Percentage occurrence of a taxon on one sample was calculated using the following formula (Tsui et al. 2001; Yanna and Hyde 2002; Wang et al. 2008):
$$ \begin{aligned} & {\text{Percent occurrence of a taxon A (\%)}} = \frac{\text{Occurrence of taxon A}}{\text{Occurrence of all taxa in one sample}} \times 100 \\ & {\text{Species richness}} = {\text{the number of different species represented in an ecological community}} \\ \end{aligned} $$
Following diversity indices were calculated using the R software for the two cultivars and the habits.
  1. (i)
    $$ {\text{Shannon}}{-}{\text{Wiener's Index (H)}} = \sum p_{i} \ln p_{i},$$
    where p i is the frequency of fungal species I occurring on a specific sample (Begon et al. 1993; Wong and Hyde 2001; Wang et al. 2008).
    1. (ii)
      $$ {\text{S}}{\o}{\text{rensen's index of similarity (S)}} = 2c/(a + b), $$
      where a is the total number of species on host A, b is the total number of species on host B and c is the number of species on both host. Similarity is expressed with values between 0 (no similarity) and 1 (absolute similarity) (Wang et al. 2008).
       
     

Compiling the checklist

The checklist is based on, articles in referred journals, Index to Saccardo’s Sylloge fungorum, Petrak’s Lists, Index of Fungi, graduate student theses, books, and web-based resources such as annual reports on this host and the SMML database (https://nt.ars-grin.gov/fungaldatabases/) (latest accessed 14-9-2017). The mode of life, such as pathogen, endophyte or saprotroph is listed. The checklist includes species names, family, life modes, disease name if any and locality. The current name is used according to Index Fungorum (2018) and Wijayawardene et al. (2017) and the classification follows Wijayawardene et al. (2018). Genera and species are listed in alphabetical order. Identification confirmed by molecular data is marked with an asterisk (*). In some cases, the host name given in the original citation was changed to be consistent with current taxonomy. In a few cases, neither the species cited nor a proper synonym was identified and the species name was used as originally cited.

Results

Species identified from fresh collections based on morphology and phylogeny (traditional method)

Fungal saprophytic diversity and community composition of the two grape cultivars: traditional method

Examination of decaying leaves, shoots, inflorescence, berries, root and bark of two cultivars of V. vinifera from China yielded 461 collections for the Red Globe variety and 180 collections for Carbanate Gernischet. The Red Globe variety had higher species richness (41) than the Carbanate Gernischet variety (23), however the Shannon diversity was not significantly different (Table 3). The majority of the culturable saprotrophic fungi were ascomycetes. However, there were two species belonging to Agaricomycetes and one species belonging to Oomycota incertae sedis. Thirty genera and 45 taxa were identified based on morphology and phylogenetic sequence data. From the identified isolates, 32.6% were Sordariomycetes, 26.1% Dothideomycetes 19.7% Eurotiomycetes, 6.5% Mucoromycetes, 4.4% Agaricomycetes, 2.2% Leotiomycetes and 2.2% of Oomycota incertae sedis. There were four taxa belonging to Zygomycota incertae sedis, which we were unable to identify. The identified Sordariomycetes belonged to Bionectriaceae (6.7%), Diaporthaceae (6.7%), Glomerellaceae (20%), Hypocreaceae (20%), Nectriaceae (13.3%), Schizoparmaceae (6.7%), Stachybotryaceae (13.3%) and Sporocadaceae (13.3%). Dothideomycete isolates belonged to Botryosphaeriaceae (16.7%), Cladosporiaceae (16.7%), Didymellaceae (33.3%) and Pleosporaceae (33.3%). The rest of the isolates belong to Mucoraceae (6.5%), Peniophoraceae (2.2%), Pythiaceae (2.2%), Rhizopodaceae (2.2%), Sclerotiniaceae (2.2%) and Trichocomaceae (17.4%). Among those 45 taxa, we found 19 species that were common on both cultivars: Actinomucor elegans, Alternaria alternata, Aspergillus niger, A. aculeatus, Cladosporium cladosporioides, Cladosporium sp., Clonostachys rosea, Coniella vitis, Diaporthe eres, Fusarium oxysporum, Mucor racemosus, Penicillium terrigenum, Phoma medicaginis, Rhizopus oryzae, Talaromyces amestolkiae, T. pinophilus, T. purpurogenus and T. harzianum. The Sørensen’s index of similarity of the two grape cultivars was 0.58. We have identified 45 taxa to species level, although in six cases the identification is only to genus level due to lack of enough molecular data. Taxa were identified using both morphology and molecular techniques. Identified species are listed in Tables 1 and 2 (Supplementary Figs. S1a–d, S2).
Table 3

Richness and diversity (mean ± SD, n = 3) of fungi detected in the two Vitis vinifera cultivars

 

RG

CG

Species richness

41

23

Shannon

2.5433 ± 0.251

2.4743 ± 0.187

Fungal saprophytic diversity and community composition of the two grape cultivars: culture-independent technique

Bioinformatics processing of the sequence data sets

A total of 638,146 quality-filtered fungal ITS reads were obtained after removal of chimeric and the unique tag (3703 sequences) sequences. After normalizing all data sets to a smallest sequence read (45, 246 sequences) and removing all rare taxa, the final analyse data sets contained 226 fungal OTUs. Phylogenetic trees for the top 20 species in different samples of the two cultivars Carbanate Gernischet and Red Globe of Vitis vinifera are given in Fig. 2. With the high number of sequence reads per sample obtained in this study, the sample-based rarefaction curves almost reached saturation for all samples (Fig. 3a). We used the observed OTU richness and Shannon diversity directly for further analyses.
Fig. 2

Phylogenetic tree of top 20 species in different samples of the two cultivars Carbanate Gernischet and Red Globe of Vitis vinifera

Fig. 3

Rarefaction curves (a), and Venn diagrams show distribution of OTUs across different samples (1–3): (b) in both Carbanate Gernischet (CG) and Red Globe (RG) cultivars, (c) only Carbanate Gernischet and (d) only Red Globe

Fungal saprotrophic OTU diversity and distribution in the two cultivars of Vitis vinifera

Diverse fungi colonized the debris samples derived from Carbanate Gernischet and Red Globe cultivars. Fungal OTU richness was not significantly different between the two V. vinifera cultivars tested in this study, ranging from 122–137 (127.33 ± 4.84 (mean ± SD); Carbanate Gernischet) and 116–141 (126.33 ± 7.54 (mean ± SD); Red Globe) (t = 0.11, P = 0.916). Shannon diversity also showed a similar trend ranging from 1.98–2.35 (2.16 ± 0.11 (mean ± SD); Carbanate Gernischet) and 1.78–1.98 (1.86 ± 0.06 (mean ± SD); Red Globe) (t = 2.41, P = 0.07). In total we detected 226 fungal OTUs with 176 and 189 belonging to the cultivars Carbanate Gernischet and Red Globe, respectively. There were 139 Fungal OTUs shared between the two V. vinifera cultivars and 37 and 50 OTUs were specific to Carbanate Gernischet and Red Globe cultivars. When we took each replicate into account, we detected only moderate proportion of fungal OTUs shared across different replicates (31–44%, 51 OTUs, Fig. 3b). Distributions of fungal OTUs across replicates for the two cultivars and for each specific cultivar are shown in Fig. 3b–d.

Fungal saprophytic community composition: culture-independent technique

The NMDS ordination plot and SIMPER analysis revealed distinct fungal communities in the two cultivars of V. vinifera samples (Table 4 and Supplementary Fig. S3a, b). Overall, fungal community composition of the two cultivars had the overall average dissimilarity of 94.29% (based on Bray–Curtis distance measure) and 30 fungal OTUs mostly responsible for differences in fungal community composition were all together accounting for 94.41% of the overall average dissimilarity (Table 4). The difference in fungal community composition between the two cultivars of V. vinifera was detected across different taxonomic levels (Supplementary Figs. S4, S5).
Table 4

Similarity percentages (SIMPER) analysis showing the top 30 fungal OTUs mostly responsible for differences in fungal community composition between Carbanate Gernischet(CG) and Red Globe (RG) cultivars; OA Dissimilarity = overall average dissimilarity

In Carbanate Gernischet, members of Ascomycota were commonly detected accounting for 77% (46% Sordariomycetes, 19% Eurotiomycetes and 7% Dothideomycetes) of total sequences in this cultivar followed by unidentified phylum (23%; Fungal OTU-7) and Basidiomycota and Zygomycota (less than 0.1%). In Red Globe, almost all sequences were assigned to Ascomycota (97%; 51% Eurotiomycetes, 42% Sordariomycetes, and 3% Dothideomycetes) followed by Basidiomycota (3%; 1% Agaricomycetes and 1% Tremellomycetes) and unidentified phylum (Fungal OTU-7) and Zygomycota were negligible (altogether less than 0.5%). Phylogenetic tree for the abundance at genus level using the top 35 genera detected in the two cultivars are shown in Fig. 4. The difference between the fungal community composition of the two cultivars of V. vinifera were clearly demonstrated at OTU level: Trichothecium roseum OTU-1, Fungal-OTU-7, Aspergillus piperis OTU-5 and Nectriaceae OTU-3 were commonly detected (10–20%) in Carbanate Gernischet, but almost absent in Red Globe (represented by Aspergillus OTU-11, Ilyonectria macrodidyma OTU-4, Aspergillus cibarius OTU-2 and Diaporthaceae OTU-10; 11–19%; Table 4).
Fig. 4

Abundance phylogenetic tree at genus level (top 35 genera) in two cultivars [Carbanate Gernischet (CG1-3) and Red Globe (RG1-3)] of Vitis vinifera

Using presence/absence data, we found that for both Vitis vinifera cultivars Ascomycota (Carbanate Gernischet = 151 OTUs and Red Globe = 162 OTUs) was the richest OTU phylum followed by unidentified phylum, Basidiomycota (11–14 OTUs) and Zygomycota (2 OTUs). Patterns of the richest OTU classes and orders were similar for both cultivars: Sordariomycetes (Hypocreales (Carbanate Gernischet = 32 OTUs and Red Globe = 39 OTUs), Sordariales (Carbanate Gernischet = 13 OTUs and Red Globe = 13 OTUs), Microascales (Carbanate Gernischet = 10 OTUs and Red Globe = 11 OTUs)], Eurotiomycetes (Eurotiales, Carbanate Gernischet = 41 OTUs and Red Globe = 38 OTUs) and Dothideomycetes (Pleosporales, Carbanate Gernischet = 7 OTUs and Red Globe = 7 OTUs).

Comparing and matching of traditional and culture-independent approaches

Several commonly detected fungal genera (Aspergillus, Clonostachys and Fusarium) were detected in both approaches. However, there are many highly or frequently detected genera in the mycobiome that were not detected in the traditional method. These include Acrostalagmus, Aureobasidium, Ceratobasidium, Chrysosporium, Ilyonectria, Lasiodiplodia, Microascus, and Trichothecium (Supplementary Table S1). Some frequently isolated fungi, especially the fast growing ones (Rhizopus and Mucor) were not detected in mycobiome analysis.

ITS sequences obtained from both traditional and culture-independent methods were compared using the query and cluster cover. This showed that the saprotrophs detected from the two approaches are consistent in most cases. However, in few cases we found inconsistent identifications which have arisen from the lower level of taxonomic assignment in the culture-independent (amplicon sequencing) as compared with traditional approaches. For example, Diaporthe eres and Alternaria identified via the traditional approach were identified as Diaporthaceae and Pleosporaceae in the culture-independent analyses. A mismatch was also found between Albifimbria viridis and Myrothecium sp., which are classified in the same order (Hypocreales). The sexual morph genus Talaromyces was matched with its potential asexual morph (Penicillium). We found that twelve taxa detected from traditional method form a cluster (91–100% similarity) with 25 fungal OTUs from the culture-independent methods (Table 5). We were able to assign 25 OTUs from NGS: 20 OTUs to genus and 5 OTUs (similarity 99–100%) to species level respectively (Table 5). We removed two OTUs as singletons (Botryosphaeria OTU-178 and Ascomycota OTU-213) as they were detected only once. However, in the direct matching of ITS sequences, these fungal OTUs showed 97 and 100% similarity to Botryospaeria dothidea and Coniella vitis, respectively. The other fungi that we were able to identify to the species level are Aspergillus niger, Clonostachys rosea, Botrytis cinerea, and Albifimbria viridis. Most of the frequently detected genera in the traditional approach (i.e. with relative abundance higher than 5%; Alternaria, Clonostachys, Fusarium) were also detected in culture-independent approach. Rhizopus sp. and Talaromyces sp. were frequently detected in the traditional approach, but exhibited low relative abundances or disappeared in the culture-independent approach.
Table 5

Matching of fungal isolates to the saprotrophic mycobiome of Vitis vinifera

Fungal taxon (culture)

Relative abundance in culture (%)

Fungal taxa (mycobiome)

Relative abundance in mycobiome (%)

Cluster identification (coverage)  %

Number of OTUs in cluster

Albifimbria viridis

0.55

Myrothecium

0.010

99 (100)

1

Alternaria spp.

28.14

Ampelomyces, Phoma, Pleosporaceae OTU, Fungal OTU

0.636

92–100 (95–100)

4

Aspergillus niger

6.01

Aspergillus

3.683

99 (100)

1

Botryospaeria dothidea

0.27

Botryospaeria

Remove as singleton

97 (100)

1

Botrytis cinerea

2.73

Botrytis

0.002

100 (100)

1

Clonostachys rosea

2.19

Clonostachys

5.244

99 (100)

1

Coniella vitis

1.09

Ascomycota OTU

Remove as singleton

100 (100)

1

Diaporthe eres

1.37

Diaporthaceae OTUs

0.070

92–97 (98–100)

2

Fusarium sp.

25.41

Fusarium, Nectriaceae OTUs

5.368

93–100 (83–87)

8

Penicillum sp.

0.54

Penicillium

0.203

91–100 (81–100)

3

Talaromyces amestolkiae

5.46

Penicillium

0.001

96 (100)

1

Tricoderma atroviride

4.09

Tricoderma

0.008

97 (99)

1

Fungal functional groups identified using traditional and culture-independent approaches

Among the 45 identified taxa based on traditional method, 17 are well known pathogens on V. vinifera causing severe yield as well as economic loss to viticulture around the world (Table 2). Six species of secondary pathogens of V. vinifera were also identified in this study. Most of the pathogens tend to survive or overwinter on dead plant material as saprotrophs and act as the primary inoculums once the conditions are favourable (Armijo et al. 2016).

In total, 143 fungal OTUs (63% of total fungal OTUs) were successfully assigned for their functions (Supplementary Table S1). We identified six functional groups of fungi associated with dead materials of V. vinifera: saprotrophs, plant pathogens, endophytes, fungal parasites–saprotrophs (mycoparasites–saprotrophs), ectomycorrhizae and animal pathogens. The fungal community was dominated by saprotrophs (102 OTUs) and plant pathogens (22 OTUs), which accounted for 71% and 15% of the function assigned to fungal OTUs in this study. Clonostachys, Lasiodiplodia and Trichothecium, were the most commonly detected plant pathogen genera with relative abundances 1–10%. Botrytis sp., an important fungal pathogen in grape, was also detected with low relative abundance. Endophytes together with endophyte–saprotrophs and endophyte–plant pathogens (9 OTUs) contributed little and most OTUs were detected with low relative abundance, except, Acrostalagmus luteoalbus. All fungal OTUs with their potential functions are listed in Supplementary Table S1.

Checklist of fungi on Vitis

Nine-hundred and six fungal taxa have been reported on Vitis species and are listed in Table 6, although the actual number of fungal taxa associated with this host is likely much higher. It is not possible to reconfirm all previous reports by re-examining collections to confirm their identities. In many cases no fungarium material is linked to the reports, while examining nearly 900 specimens would be an almost impossible task. Even if it was were possible, it would most likely be futile, since molecular data would be needed to establish correct names. This is extremely difficult based on the presently available techniques and not permitted by many fungaria. Most of the 905 taxa reported from Vitis species do not have sequence data. Therefore, recollecting and sequencing these taxa are essential to establish and accurate species list associated with Vitis species.
Table 6

Check list of fungi on Vitis sp. (classification follows Wijayawardene et al. 2017, 2018)

Species

Family

Life mode

Disease caused

Locality

References

Acremonium acutatum W. Gams*

Bionectriaceae

P

Unknown

Korea

Oh et al. (2014)

A. alternatum Link*

Bionectriaceae

E

 

China, Greece, Spain

Pantidou (1973), Benavides et al. (2013), Dissanayake et al. (2018)

Acremonium sp.*

Bionectriaceae

P, E

‘Hoja de malvon’

Argentina, China, Iran, Italy, South Africa, Korea, Spain

Gatica et al. (2001), Halleen et al. (2003), Luque et al. (2009), Gonzalez and Tello (2011), Mohammadi and Banihashemi (2012), Mondello et al. (2013), Oh et al. (2014), This study

Acrocalymma vagum (D.F. Farr) P.W. Crous & T. Trakunyingcharoen*

Acrocalymmaceae

U

 

Spain

Trakunyingcharoen et al. (2014)

Acrospermum viticola Ikata & Hitomi

Acrospermaceae

U

 

China, Japan, Korea

Tai (1979), Cho and Shin (2004), Kobayashi (2007)

Acrostalagmus luteoalbus (Link) Zare, W. Gams & Schroers*

Plectosphaerellaceae

S

 

China

This study

Actinomucor elegans (Eidam) C.R. Benj. & Hesselt*

Mucoraceae

S

 

China

This study, Jayawardena et al. (2018)

Agaricus viticola Schulzer

Agaricaceae

S

 

Slavonia

Saccardo (1878)

Albifimbria verrucaria (Alb. & Schwein.) L. Lombard & Crous*

Stachybotryaceae

S

 

China

This study, Jayawardena et al. (2018)

A. viridis L. Lombard & Crous*

Stachybotryaceae

S

 

China

This study, Jayawardena et al. (2018)

Alfaria cyperi-esculenti Crous, Montaño-Mata & García-Jim*

Hypocreales genera incertae sedis

S

 

Italy

This study, Jayawardena et al. (2018)

Alfaria vitis Manawasinghe, Camporesi & K.D. Hyde*

Hypocreales genera incertae sedis

S

 

Italy

This study, Jayawardena et al. (2018)

Alternaria lternate (Fr.) Keissl.*

Pleosporaceae

P, E, S

Fruit rot

Brunei, China, Italy, Poland, Slovakia, Spain, USA

Peregrine and Ahmad (1982), French (1987, 1989), Mulenko et al. (2008), Kakalikova et al. (2009), Gonzalez and Tello (2011), Dissanayake et al. (2018), This study, Jayawardena et al. (2018)

A. arborescens E.G. Simmons*

Pleosporaceae

E

 

Spain, Switzerland

Casieri et al. (2009), Gonzalez and Tello (2011)

A. italica J.F. Li,Camporesi & K.D. Hyde*

Pleosporaceae

S

 

Italy

This study, Jayawardena et al. (2018)

A. tenuissima (Kunze) Wiltshire

Pleosporaceae

E

 

Malawi, Spain

Wiehe (1948), Peregrine and Siddiqi (1972), Gonzalez and Tello (2011)

A. viticola Brunaud

Pleosporaceae

P

Fruit rot

China

Tai (1979)

A. vitis Cavara*

Pleosporaceae

P, S

Leaf blight, Fruit rot

Chile, China, El Salvador, Greece, India, Italy, Romania, Russia, Thailand, Turkmenistan

Cavara (1888), Makovetz (1933), Stevenson and Wellman (1944), Mujica and Vergara (1945), Nasyrov (1964), Sarbhoy et al. (1971), Pantidou (1973), Giatgong (1980), Bechet and Sapta-Forda (1981), Zhang (2003), Zhuang (2005), This study, Jayawardena et al. (2018)

A. viniferae Yong Wang bis, Y.Y. Than, K.D. Hyde & Xing H. Li*

Pleosporaceae

P

On pedicels and rachis

China

Tao et al. (2014)

Alternaria sp.*

Pleosporaceae

P, E

On pedicels and rachis

Cuba, France, Italy, Poland, South Africa, Spain, Switzerland, USA

Preston (1945), Harvey (1955), Arnold (1986), Cook and Dubé (1989), Larignon and Dubos (1997), Halleen et al. (2003), Mulenko et al. (2008), Casieri et al. (2009), Gonzalez and Tello (2011), Mondello et al. (2013)

Amerosporium concinnum Petr.

Ascomycota genera incertae sedis

P

Excoriose and die back

Portugal

Phillips (2000)

Ampelomyces quisqualis Ces.

Phaeosphaeriaceae

M

 

South Africa

Doidge (1950)

Ampelomyces sp.*

Phaeosphaeriaceae

S

 

China

This study

Amphisphaeria sylvan Sacc. & Speg

Amphisphaeriaceae

S

 

Italy

Farr (1973)

A. humuli (Fautrey) Rudakov

Amphisphaeriaceae

M

 

Ukraine

Dudka et al. (2004)

Angustimassarina populi Thambug. & K.D. Hyde*

Amorosiaceae

S

 

Italy

This study, Jayawardena et al. (2018)

Aplosporella beaumontiana S. Ahmad

Aplosporellaceae

S

 

India

Rajak and Pandey (1985)

A. fabiformis (Pass. & Thüm.) Petr. & Syd.

Aplosporellaceae

P

On stem

Italy, Pakistan, USA

Petrak and Sydow (1927), Anonymous (1960), Ahmad (1969)

A. japonicas Ellis & Everh.

Aplosporellaceae

P

On stem

China

Tai (1979)

A. viticola Cooke & Massee

Aplosporellaceae

P

On stem

UK

Saccardo (1878)

Aplosporella sp.*

Aplosporellaceae

S

 

China

This study

Apodus sp.*

Lasiosphaeriaceae

S

 

China

This study

Arachnomyces sp.*

Arachnomycetaceae

S

 

China

This study

Armillaria limonea (G. Stev.) Boesew

Physalacriaceae

P

Root rot

New Zealand

Gadgil (2005)

A. luteobubalina Watling & Kile

Physalacriaceae

P

Root rot

Australia

Cook and Dubé (1989)

A. mellea (Vahl) P. Kumm.

Physalacriaceae

P

Root rot

Australia, Greece, Italy, Japan, Scotland, USA

Anonymous (1960), Foister (1961), Simmonds (1966), French (1989), Zervakis et al. (1998), Holevas et al. (2000), Kobayashi (2007), Bobev (2009), Prodorutti et al. (2009)

A. novae-zelandiae (G. Stev.) Boesew

Physalacriaceae

P

Root rot

New Zealand

Gadgil (2005)

Armillaria sp.

Physalacriaceae

P

Root rot

Australia, New Zealand

Pennycook (1989), Shivas (1989)

Arthrobotrys sp.*

Orbiliaceae

S

 

Switzerland

Casieri et al. (2009)

Arthrographis sp.*

Eremomycetaceae

S

 

China

This study

Arthrinium arundinis* (Corda) Dyko & B. Sutton

Apiosporaceae

E

 

Switzerland

Casieri et al. (2009)

A. phaeospermum (Corda) M.B. Ellis

Apiosporaceae

E

 

Spain

Gonzalez and Tello (2011)

A. rasikravindrae Shiv M. Singh, L.S. Yadav, P.N. Singh, Rah. Sharma & S.K. Singh*

Apiosporaceae

E

 

China

Dissanayake et al. (2018)

Arthrinium sp.

Apiosporaceae

U

 

Russia

Melnik and Popushoi (1992)

Arxiomyces vitis (Fuckel) P.F. Cannon & D. Hawksw.

Ceratostomataceae

U

 

Europe, Poland

von Arx and Mueller (1954), Mulenko et al. (2008)

Ascochyta ampelina Sacc.

Didymellaceae

P

On leaves

Greece, Pakistan, Romania, UK, USA

Saccardo (1878), Anonymous (1960), Pantidou (1973), Ahmad et al. (1997), Jones and Baker (2007)

Ascorhizoctonia sp.*

Pyronemataceae

E

 

China

Dissanayake et al. (2018)

Aspergillus aculeatus Iizuka*

Aspergillaceae

P, S

Bunch rot

Canada, China

Jarvis and Traquair (1984), This study, Jayawardena et al. (2018)

A. carbonarius (Bainier) Thom*

Aspergillaceae

P

Bunch rot

South Africa, USA

Setati et al. (2015), Rooney-Latham et al. (2008)

A. cibarius S.B. Hong & Samson*

Aspergillaceae

S

 

China

This study

A. flavus Link

Aspergillaceae

P

Bunch rot

Italy

Greuter et al. (1991)

A. glaucus (L.) Link

Aspergillaceae

U

 

Dominican Republic

Ciferri (1929, 1961)

A. aponicas Saito*

Aspergillaceae

E

 

China

Dissanayake et al. (2018)

A. niger Tiegh.*

Aspergillaceae

P, E, S

Bunch rot, Canker

Australia, Bulgaria, China, Cyprus, Italy, Japan, Spain, South Africa, Switzerland, USA, Zimbabwe

Georghiou and Papadopoulos (1957), Whiteside (1966), Cook and Dubé (1989), Setati et al. (2015), Michailides et al. (2002), Kobayashi (2007), Vitale et al. (2008), Bobev (2009), Casieri et al. (2009), Gonzalez and Tello (2011), Dissanayake et al. (2018), This study, Jayawardena et al. (2018)

A. terreus Thom*

Aspergillaceae

E, S

 

Spain, China

Gonzalez and Tello (2011), This study

A. tubingensis Mosseray*

Aspergillaceae

P

Canker

Spain

Garcia-Benavides et al. (2013)

A. piperis Samson & Frisvad*

Aspergillaceae

S

 

China

This study

A. pseudodeflectus Samson & Mouch.*

Aspergillaceae

E, S

 

China

Dissanayake et al. (2018), This study

A. pseudoglaucus Blochwitz*

Aspergillaceae

E

 

China

Dissanayake et al. (2018)

A. ustus (Bainier) Thom & Church

Aspergillaceae

U

 

Italy

Greuter et al. (1991)

Aspergillus sp.*

Aspergillaceae

P, E, S

Bunch rot, canker, sour rot

China, France, Italy, Korea,South Africa, Spain, Switzerland

Larignon and Dubos (2001), Halleen et al. (2003), Casieri et al. (2009), Gonzalez and Tello (2011), Mondello et al. (2013), Oh et al. (2014), Dissanayake et al. (2018), This study

Asperisporium minutulum (Sacc.) Deighton

Mycosphaerellaceae

E

 

USA

Schubert and Braun (2005)

A. vitiphyllum (Speschnew) Deighton

Mycosphaerellaceae

E

 

China, Europe, Russia, Uzbekistan

Elenkin (1909), Gaponenko (1965), Sutton (1975), Zhuang (2005)

Athelia rolfsii (Curzi) C.C. Tu & Kimbr.

Atheliaceae

P, S

Sour rot

Mauritius, New Zealand, Taiwan

Orieux and Felix (1968), Anonymous (1979), Pennycook (1989)

Aureobasidium pullulans (de Bary) G. Arnaud.*

Saccotheciaceae

E, S

 

Australia, China, France, Germany, Greece, Italy, South Africa, Spain, Poland, USA

Setati et al. (2015), Morgan and Michailides (2004), Mulenko et al. (2008), Gonzalez and Tello (2011), Sanoamuang et al. (2013), Fischer et al. (2016), Dissanayake et al. (2018), This study, Jayawardena et al. (2018)

Aureobasidium sp.*

Saccotheciaceae

S

 

China

This study

Bactrodesmium pallidum M.B. Ellis

Dothideomycetes genera incertae sedis

S

 

Russia

Melnik and Popushoi (1992)

Bartalinia robillardoides Tassi

Sporocadaceae

S

 

India

Mathur (1979)

Beauveria bassiana (Bals.-Criv.) Vuill*

Cordycipitaceae

P, E

U

Spain

Gonzalez and Tello (2011), Garcia-Benavides et al. (2013)

Bertia vitis Schulzer

Bertiaceae

S

 

Croatia, Portugal

Schulzer (1870), Unamuno (1941)

Bionectria ochroleuca (Schwein.) Schroers & Samuels*

Bionectriaceae

S

 

Switzerland

Casieri et al. (2009)

Bipolaris maydis (Y. Nisik. & C. Miyake) Shoemaker*

Pleosporaceae

S

 

China

This study, Jayawardena et al. (2018)

B. sorokiniana (Sacc.) Shoemaker*

Pleosporaceae

E

 

China

Dissanayake et al. (2018)

Biscogniauxia capnodes (Berk.) Y.M. Ju & J.D. Rogers

Boliniaceae

S

 

Taiwan

Ju and Rogers (1999)

B. mediterranea (De Not.) Kuntze

Boliniaceae

S

 

USA

Anonymous (1960)

Boeremia exigua var. exigua (Desm.) Aveskamp*

Didymellaceae

P

Black spot

Italy

Balmas et al. (2005)

Botryodiplodia palmarum (Cooke) Petr. & Syd.

Botryosphaeriaceae

P

Canker

India

Mathur (1979)

B. vitis Sousa da Câmara

Botryosphaeriaceae

P

Canker

Pakistan, Portugal

Sousa da Câmara (1950), Ahmad et al. (1997)

Botryodiplodia sp.

Botryosphaeriaceae

P

Canker

Argentina, Brazil

Mendes et al. (1998), Gatica et al. (2001)

Botryosphaeria bondarzewii L. A. Kantsch.

Botryosphaeriaceae

S

 

Russia, USA

Kantschaveli (1928), Nagorny (1930)

B. dothidea (Moug. ex Fr.) Ces. & De Not.*

Botryosphaeriaceae

P, E, S

Botryosphaeria die back, Macrophoma rot

Argentina, Australia, Brazil, Canda, Chile, China, France, Germany, Iran, Italy, Japan, South Africa, Portugal, Spain, USA, New Zealand, Tunisia, Turkey, Uruguay

Milholland (1994), Phillips (1998, 2000), Slippers et al. (2007a, b), Larignon and Dubos (2001), Halleen et al. (2003), van Niekerk et al. (2006), Kobayashi (2007), Luque et al. (2009), Pitt et al. (2010), Qiu et al. (2011), Úrbez-Torres (2011), Úrbez-Torres et al. (2012, 2013a, b), Abreo et al. (2012), Arzanlou et al. (2012), Baskarathevan et al. (2012), Yan et al. (2012), Akgul et al. (2014a), Chebil et al. (2014), Carlucci et al. (2015), Fischer et al. (2016), Dissanayake et al. (2018), This study, Jayawardena et al. (2018)

B. vitis Niessl

Botryosphaeriaceae

P

Die back

Czech Republic

Niessl (1871)

Botryosphaeria sp.*

Botryosphaeriaceae

P, E

Botryosphaeria die back, Macrophoma rot

Australia, China, Japan, South Africa, Spain

Fourie and Halleen (2002), Halleen et al. (2003), Gimenez-Jaime et al. (2006), Kobayashi (2007), Martin and Cobos (2007), Sosnowski et al. (2007), Dissanayake et al. (2018)

Botrytis ampelophila Speg.

Sclerotiniaceae

S

 

Argentina

Farr (1973)

B. californica S. Saito & C.L. Xiao*

Sclerotiniaceae

P

Botrytis bunch rot, Leaf blight

California, USA

Saito et al. (2016)

B. cinerea Pers.*

Sclerotiniaceae

P, E, S

Botrytis bunch rot, Leaf blight

Australia, Brazil, Bulgaria, Chile, China, France, Greece, Germany, Hawai, Italy, Korea, Libya, New Zealand, Pakistan, Poland, Portugal, Scotland, Spain, Switzerland, USA, Zimbabwe

Foister (1961), Whiteside (1966), El-Buni and Rattan (1981), Raabe et al. (1981), Lee et al. (1991), Mendes et al. (1998), Holevas et al. (2000), Phillips (2000), Gadgil (2005), Mulenko et al. (2008), Bobev (2009), Casieri et al. (2009), Gao et al. (2009), Gonzalez and Tello (2011), Walker et al. (2011), Fournier et al. (2013), Piqueras et al. (2014), Saito et al. (2016), Dissanayake et al. (2018), Javed et al. (2017), This study, Jayawardena et al. (2018)

B. pseudocinerea A.S. Walker, A. Gautier*

Sclerotiniaceae

P

Botrytis bunch rot, Leaf blight

France, Germany, New Zealand, USA

Walker et al. (2011), Saito et al. (2016)

B. sinoviticola J. Zhang, Y. J. Zhou & G. Q. Li*

Sclerotiniaceae

P

Botrytis bunch rot, Leaf blight

China

Zhou et al. (2014)

Botrytis sp.*

Sclerotiniaceae

P, E, S

 

Chile, China, Italy, Japan, Mexico, USA

Mujica and Vergara (1945), Anonymous (1960), Alvarez (1976), Kobayashi (2007), Liu et al. (2016a), Dissanayake et al. (2018), Jayawardena et al. (2018)

Briosia ampelophaga Cavara

Ascomycota genera incertae sedis

P

Brown Zonate Spot of Grape/Leaf blotch

Japan, Russia, USA

Greene (1955), Anonymous (1960), Melnik and Popushoi (1992), Nakagiri et al. (1994), Kobayashi (2007)

Cadophora fastigiata Lagerb. & Melin*

Ploettnerulaceae

P, S

Wood pathogen

Germany, Switzerland,

Casieri et al. (2009), Fischer et al. (2016)

C. luteo-olivacea (J.F.H. Beyma) T.C. Harr. & McNew*

Ploettnerulaceae

P

Wood pathogen

Germany, Japan, Switzerland, Uruguay

Casieri et al. (2009), Abreo et al. (2012), Fischer et al. (2016), Nakaune et al. (2016)

C. novi-eboraci R Travadon, DP Lawrence, S Rooney-Latham, WD Gubler, PE Rolshausen & K Baumgartner*

Ploettnerulaceae

P

Wood pathogen

North America

Travadon et al. (2015)

C. orientoamericana R Travadon, DP Lawrence, S Rooney-Latham, WD Gubler, PE Rolshausen & K Baumgartner*

Ploettnerulaceae

P

Wood pathogen

North America

Travadon et al. (2015)

C. spadicis R Travadon, DP Lawrence, S Rooney-Latham, WD Gubler, PE Rolshausen & K Baumgartner*

Ploettnerulaceae

P

Wood pathogen

North America

Travadon et al. (2015)

C. viticola D. Gramaje, L. Mostert & Armengol*

Ploettnerulaceae

P, S

Wood pathogen

Spain

Crous et al. (2015)

Cadophora sp.*

Ploettnerulaceae

E, S

 

China

Dissanayake et al. (2018), This study

Calonectria kyotensis Terash.

Nectriaceae

P

Black foot disease

New Zealand

Pennycook (1989)

C. macrospora Sacc. & Speg.

Nectriaceae

P

Black foot disease

Italy

Saccardo (1878), Farr (1973)

Calycella sarmentorum (De Not.) Boud.

Helotiaceae

S

 

Italy, Portugal

Kuntze (1898), Unamuno (1941)

Camarosporium viniferum S. Ahmad

Camarosporiaceae

E

 

Central Asia, Pakistan

Ahmad (1969), Koshkelova and Frolov (1973), Ahmad et al. (1997)

C. viticola (Cooke & Harkn.) Sacc.

Camarosporiaceae

E

 

USA

Saccardo (1878)

Camillea tinctor (Berk.) Læssøe, J.D. Rogers & Whalley

Graphostromataceae

S

 

USA

Hanlin (1963)

Campylocarpon fasciculare Schroers, Halleen & Crous*

Nectriaceae

P

Wood canker, Black foot disease

Brazil, Italy, South Africa, Turkey

Halleen et al. (2003), Abreo et al. (2010), Petit et al. (2011), Correia et al. (2013), Akgul et al. (2014b), Úrbez-Torres et al. (2014), Carlucci et al. (2017), Gonzalez and Chaverri (2017)

C. pseudofasciculare Halleen, Schroers & Crous*

Nectriaceae

P

Black foot

Brazil, South Africa, Uruguay

Abreo et al. (2010, 2012), Petit et al. (2011), Correia et al. (2013), Úrbez-Torres et al. (2014), Gonzalez and Chaverri (2017)

Capnodium citri Berk. & Desm.

Capnodiaceae

P

Bunch rot

Italy, Greece, Portugal, Spain

Pantidou (1973), Greuter et al. (1991), Checa (2004)

Capnodium sp.

Capnodiaceae

P

Bunch rot

Brazil, Venezuela

Urtiaga (1986), Mendes et al. (1998)

Cephalosporium sp.

Hypocreales incertae sedis

P

Black measles

Greece, Mexico, Greece, USA

Chiarappa (1959), Pantidou (1973), Alvarez (1976), Holevas et al. (2000)

Ceratobasidium cornigerum (Bourdot) D.P. Rogers

Ceratobasidiaceae

E

 

Spain

Gonzalez and Tello (2011)

Ceratobasidium sp.*

Ceratobasidiaceae

E, S

 

China, Switzerland

Casieri et al. (2009), This study

Cercospora coryneoides Savul. & Rayss

Mycosphaerellaceae

P

Leaf spot

Palestine

Savulescu and Rayss (1935)

C. fuckelii (Thüm.) Jacz.

Mycosphaerellaceae

P

Leaf spot

Asia

Chupp (1953)

C. judaica Rayss

Mycosphaerellaceae

P

Leaf spot

Palestine

Chupp (1953)

C. roesleri (Catt.) Sacc.*

Mycosphaerellaceae

P

Leaf spot

China, Cyprus, Egypt, France, Scotland

Chupp (1953), Georghiou and Papadopoulos (1957), Foister (1961), Tai (1979), Soliman et al. (2016)

C. sessilis Sorokin

Mycosphaerellaceae

P

Leaf spot

Russia

Pollack (1987)

C. vitiphylla (Speschnew) Barbarin

Mycosphaerellaceae

P

Leaf spot

Palestine

Savulescu and Rayss (1935)

C. zebrina Pass.*

Mycosphaerellaceae

P

Leaf spot

Iran

Bakhshi et al. (2012)

Cercospora sp.

Mycosphaerellaceae

P

Leaf spot

Cuba, Hawaii, Mexico, USA

Denaree and Runner (1942), Greene (1956), Raabe (1966), Alvarez (1976), Grand (1985), Urtiaga (1986)

Chaetomium globosum Kunze ex Fr.*

Chaetomiaceae

E, S

 

China, Italy, Spain, Switzerland,

Casieri et al. (2009), Gonzalez and Tello (2011), Dissanayake et al. (2018), This study, Jayawardena et al. (2018)

C. nigricolor L.M. Ames*

Chaetomiaceae

E

 

India, Switzerland

Pande (2008), Casieri et al. (2009)

Chaetomium sp.*

Chaetomiaceae

E, S

 

Spain, Switzerland, China

Casieri et al. (2009), Gonzalez and Tello (2011), This study

Chaetothyrium javanicum (Zimm.) Boedijn

Chaetothyriaceae

P

Sooty mold

China, Taiwan

Tai (1979)

Chalastospora gossypii (Jacz.) U. Braun & Crous*

Pleosporaceae

E

 

USA

Crous et al. (2009)

Cheilymenia theleboloides (Alb. & Schwein.) Boud.

Pyronemataceae

S

 

Chile

Mujica and Vergara (1945)

Chrysosporium pilosum Gené, Guarro & Ulfig*

Onygenaceae

S

 

China

This study

Chrysosporium sp.*

Onygenaceae

S

 

China

This study

Cladochytrium viticola Prunet

Cladochytriaceae

P

Wood

Algeria, Gaul, Tunisia, USA

Saccardo (1878)

Cladosporium aggregatocicatricatum Bensch, Crous & U. Braun*

Cladosporiaceae

P

Fruit rot

USA

Bensch et al. (2015)

C. ampelinum Pass.

Cladosporiaceae

P

Leaf spot

Austria, Germany, France, Italy, Portugal

Passerini (1872)

C. asperulatum Bensch, Crous & U. Braun

Cladosporiaceae

P

Fruit rot

USA

Bensch et al. (2015)

C. autumnale Kübler

Cladosporiaceae

E

 

Switzerland

Dugan et al. (2004)

C. baccae Verwoerd & Dippen.

Cladosporiaceae

P

Fruit rot

South Africa

Braun et al. (2003), Dugan et al. (2004)

C. cladosporioides (Fresen.) G.A. de Vries*

Cladosporiaceae

P, E, S

Fruit rot

Chile, China, Italy, Japan, Switzerland, USA

Briceno and Latorre (2007), Kobayashi (2007), Casieri et al. (2009), Bensch et al. (2015), Swett et al. (2016), Dissanayake et al. (2018), This study, Jayawardena et al.(2018)

C. cucumerinum Ellis & Arthur*

Cladosporiaceae

S

 

Italy

This study, Jayawardena et al.(2018)

C. fasciculatum Corda

Cladosporiaceae

  

Russia, Spain, Uzbekistan

Gonzalez Fragoso (1921), Nagorny (1930)

C. herbarum (Pers.) Link

Cladosporiaceae

P, E

Fruit rot

Australia,Chile, Spain

Cook and Dubé (1989), Briceno and Latorre (2007), Gonzalez and Tello (2011)

C. limoniforme Bensch, Crous & U. Braun*

Cladosporiaceae

P

Fruit rot

USA

Bensch et al. (2015), Swett et al. (2016)

C. longipes Sorokin

Cladosporiaceae

E

 

Caucasus

Dugan et al. (2004)

C. macrocarpum Preuss

Cladosporiaceae

P

Fruit rot

China

Zhang (2003)

C. oxysporum Berk. & M.A. Curtis

Cladosporiaceae

P

Fruit rot

India

Sarbhoy et al. (1971)

C. pestis Thüm

Cladosporiaceae

E

 

Austria

Dugan et al. (2004)

C. ramotenellum K. Schub., Zalar, Crous & U. Braun*

Cladosporiaceae

P

Fruit rot

China, USA

Swett et al. (2016), Dissanayake et al. (2018)

C. rectoides Bensch, H.D. Shin, Crous & U. Braun*

Cladosporiaceae

E

 

Korea

Bensch et al. (2015)

C. roesleri Catt.

Cladosporiaceae

E

 

Austria, France, Cyprus, Pakistan

Georghiou and Papadopoulos (1957), Ahmad (1969), Ahmad et al. (1997)

C. silences Crous*

Cladosporiaceae

P

Fruit rot

China

Dissanayake et al. (2018)

C. sphaerospermum Penz.*

Cladosporiaceae

P, S

Fruit rot

Switzerland

Casieri et al. (2009)

C. tenellum K. Schub., Zalar, Crous & U. Braun*

Cladosporiaceae

P

Fruit rot

USA

Swett et al. (2016), Dissanayake et al. (2018)

C. tenuissimum Cooke*

Cladosporiaceae

P, E

Fruit rot

China

Zhang (2003), Dissanayake et al. (2018)

C. uvarum McAlpine

Cladosporiaceae

S

 

Australia, China

Zhang (2003), Dugan et al. (2004)

C. viride (Fresen.) Z.Y. Zhang & T. Zhang

Cladosporiaceae

P

Fruit rot

China

Dugan et al. (2004)

C. vitis-frutigeni Herb.

Cladosporiaceae

E

 

USA

Dugan et al. (2004)

Cladosporium sp.*

Cladosporiaceae

P, E, S

Fruit rot

Chile, China, Italy, Korea, USA, Venezuela

Mujica and Vergara (1945), Anonymous (1960), Briceno and Latorre (2008), Mondello et al. (2013), Oh et al. (2014), Dissanayake et al. (2018), This study

Clathrospora turkestanica Domashova

Pleosporaceae

E

 

Central Asia

Koshkelova and Frolov (1973)

Claviceps sp.*

Clavicipitaceae

S

 

China

This study

Clonostachys rosea (Link) Schroers, Samuels, Seifert & W. Gams*

Bionectriaceae

P, E, S

Wood decay, Root rot

China, Switzerland

Casieri et al. (2009), This study, Jayawardena et al. (2018)

Clonostachys sp.*

Bionectriaceae

P, E, S

Wood decay, Root rot

China, South Africa

Halleen et al. (2003), This study

Cochliobolus geniculatus R.R. Nelson

Pleosporaceae

P

Leaf spot

Brunei

Peregrine and Ahmad (1982)

Colletotrichum acutatum J.H. Simmonds*

Glomerellaceae

P

Ripe rot

Australia, Japan, New Zealand, USA

Miller (1991), Kummuang et al. (1996), Guerber et al. (2003), Kobayashi (2007), Shivas et al. (2016)

C. aenigma B.S. Weir & P.R. Johnston*

Glomerellaceae

P

Ripe rot

China

Yan et al. (2015)

C. ampelinum Cavara

Glomerellaceae

E

 

China, Italy

Cavara (1889), Tai (1979)

C. clidemia B.S. Weir & P.R. Johnston*

Glomerellaceae

P

Ripe rot

USA

Weir et al. (2012)

C. dematium (Pers.) Grove*

Glomerellaceae

E, S

 

Russia, South Africa

Damm et al. (2009), This study, Jayawardena et al. (2018)

C. fioriniae Marcelino & Gouli ex R.G. Shivas & Y.P. Tan*

Glomerellaceae

P

Ripe rot

Italy, Portugal

Faedda et al. (2011), Damm et al. (2012)

C. fructicola Prihastuti, L. Cai & K.D. Hyde*

Glomerellaceae

P

Ripe rot, Leaf spot, Sunken shoot and stem canker

China

Peng et al. (2013)

C. gloeosporioides (Penz.) Penz. & Sacc.*

Glomerellaceae

P

Ripe rot

Australia, Barbodos, Brazil, Brunei, China, Cuba, India, Japan, Korea, Mynmar, New Zealnd, South Africa, Taiwan, USA

Chandra (1974), Norse (1974), Anonymous (1979), Tai (1979), Peregrine and Ahmad (1982), Urtiaga (1986), Pennycook (1989), Mendes et al. (1998), Cho and Shin (2004), Lubbe et al. (2004), Gadgil (2005), Kobayashi (2007), Thaung (2008c), Weir et al. (2012)

C. godetiae Neerg.*

Glomerellaceae

P, S

Ripe rot

Italy, UK

Baroncelli et al. (2014), Zapparata et al. (2017), This study, Jayawardena et al. (2018)

C. hebeiense XH Li, Y Wang, KD Hyde. MMRS* Jayawardena, JY Yan

Glomerellaceae

P

Twig anthracnose, Ripe rot

China

Yan et al. (2015), This study, Jayawardena et al. (2018)

C. nymphaeae (Pass.) Aa*

Glomerellaceae

P

Ripe rot

China

Liu et al. (2016b)

C. siamense Prihastuti, L. Cai & K.D. Hyde*

Glomerellaceae

P, S

Ripe rot

Italy, USA

Weir et al. (2012), This study, Jayawardena et al. (2018)

C. truncatum (Schwein.) Andrus & W.D. Moore*

Glomerellaceae

P

Ripe rot

China, India, Italy, Switzerland

Farr (1973), Casieri et al. (2009), Sawant et al. (2012), Pan et al. (2016), This study, Jayawardena et al. (2018)

C. viniferum L.J. Peng, L. Cai, K.D. Hyde & Zi Y. Ying*

Glomerellaceae

P, S

Ripe rot

China

Peng et al. (2013), Yan et al. (2015), This study, Jayawardena et al. (2018)

Colletotrichum sp.

Glomerellaceae

P

Ripe rot, Wood necrosis

Cuba, Mexico, Spain

Alvarez (1976), Arnold (1986), Gonzalez and Tello (2011)

Collophorina paarla (Damm & Crous) Damm & Crous*

Leotiomycetes genera incertae sedis

P

Wood necrosis

Germany

Fischer et al. (2016)

C. rubra (Damm & Crous) Damm & Crous*

Leotiomycetes genera incertae sedis

P

Wood necrosis

Spain

Garcia-Benavides et al. (2013)

Coniella castaneicola (Ellis & Everh.) B. Sutton

Schizoparmaceae

P

White rot

Japan, USA

Nag Raj (1993), Kobayashi (2007)

C. diplodiella (Speg.) Petr. & Syd.*

Schizoparmaceae

P

White rot

Africa, Australia, Bulgaria, China, France, Germany, Greece, India, Italy, South Africa

Sutton (1969), Pantidou (1973), Mathur (1979), Zhuang (2001), van Niekerk et al. (2004b), Bobev (2009), Chethana et al. (2017)

C. diplodiopsis (Crous & Van Niekerk) L.V. Alvarez & Crous*

Schizoparmaceae

P

White rot

France, Germany, Italy, South Africa, Switzerland

van Niekerk et al. (2004b), Chethana et al. (2017)

C. fragariae (Oudem.) B. Sutton

Schizoparmaceae

P

White rot

Germany, Japan

van Niekerk et al. (2004b), Kobayashi (2007)

C. granati (Sacc.) Petr. & Syd.*

Schizoparmaceae

P

White rot

Italy

van Niekerk et al. (2004b), Chethana et al. (2017)

C. petrakii B. Sutton*

Schizoparmaceae

P, S

White rot

France, India

Nag Raj (1993), Chethana et al. (2017)

C. vitis Chethana, Yan, Li & K. D. Hyde*

Schizoparmaceae

P

White rot

China

Chethana et al. (2017), This study, Jayawardena et al. (2018)

Coniella sp.*

Schizoparmaceae

P

Wood necrosis

India

Chethana et al. (2017)

Coniocessia sp.*

Coniocessiaceae

S

 

China

This study

Coniochaeta hoffmannii (J.F.H. Beyma) Z.U. Khan, Gené & Guarro*

Coniochaetaceae

P

Bunch rot

Germany, Switzerland

Casieri et al. (2009), Fischer et al. (2016)

Coniolariella sp.*

Xylariaceae

S

 

China

This study

Coniothecium viticola Cooke & Massee

Helotiales incertae sedis

S

 

UK

Saccardo (1878)

Coniothyrium ampelinum Cooke

Coniothyriaceae

E

 

USA

Cooke (1878)

C. berlandieri Viala & Sauv.

Coniothyriaceae

P

Leaf spot

Cambodia, USA

Anonymous (1960), Litzenberger et al. (1962)

C. iranicum Esfand.

Coniothyriaceae

E

 

Central Asia

Koshkelova and Frolov (1973)

C. vitivorum Miura

Coniothyriaceae

E

 

China

Tai (1979)

Cophinforma mamane (D.E. Gardner) A.J.L. Phillips & A. Alves*

Botryosphaeriaceae

P

Canker, Die back

Brazil

Correia et al. (2013)

Coprinellus radians (Desm.) Vilgalys, Hopple & Jacq. Johnson*

Psathyrellaceae

S

 

Switzerland

Casieri et al. (2009)

Corticium appalachiense (Burds. & M.J. Larsen) M.J. Larsen

Corticiaceae

P, S

Wood decay

USA

Burdsall (1976)

C. centrifugum (Weinm.) Fr.

Corticiaceae

P, S

Wood decay

China

Tai (1979)

Corticium sp.

Corticiaceae

S

 

USA

Anonymous (1960)

Coryneopsis microsticta (Berk. & Broome) Grove

Discosiaceae

P

Stem lesions

Poland, Portugal

de Sousa Dias and Lucas (1972), Mulenko et al. (2008)

Corynespora cassiicola (Berk. & M.A. Curtis) C.T. Wei

Corynesporascaceae

P

Leaf spot

USA

Alfieri Jr. et al. (1984, 1994)

Coryneum viticola Ellis & Everh.

Pseudovalsaceae

S

 

USA

Anonymous (1960)

Crepidotus viticola S. Imai

Inocybaceae

S

 

Japan

Petrak (1953)

Cryptocline cinerascens (Bubák) Arx

Ascomycota genera incertae sedis

E

 

Japan

Kobayashi (2007)

Cryptococcus sp.*

Tremellaceae

E, S

 

China

Dissanayake et al. (2018), This study

Cryptophaeella trematosphaeriicola Frolov

Montagnulaceae

E

 

Central Asia

Koshkelova and Frolov (1973)

Cryptosphaeria pullmanensis Glawe*

Diatrypaceae

P

Canker

USA

Trouillas and Gubler (2010), Trouillas et al. (2010), Úrbez-Torres et al. (2012)

Cryptosporella viticola Shear

Valsaceae

P

Fruit rot, Dead arm

China, Greece, Korea, USA

Hewitt (1951), Tai (1979), Holevas et al. (2000), Cho and Shin (2004)

Cryptovalsa ampelina Abbado*

Diatrypaceae

P

Eutypa dieback

Australia, Austria, Chile, France, Hungary, Italy, Portugal, South Africa, Spain, USA

Unamuno (1941), Petrak (1953), Mostert et al. (2004), Lardner et al. (2005), Sosnowski et al. (2007), Luque et al. (2009), Martin et al. (2009), Trouillas and Gubler (2010), Trouillas et al. (2010, 2011), Diaz et al. (2011), White et al. (2011), Úrbez-Torres et al. (2012), Pitt et al. (2013), Li et al. (2016-designated reference specimen), This study, Jayawardena et al. (2018)

C. protracta (Pers.) De Not.

Diatrypaceae

P

Eutypa dieback

Greece

Pantidou (1973)

C. rabenhorstii (Nitschke) Sacc.*

Diatrypaceae

P

Eutypa dieback

Australia

Trouillas et al. (2011), Pitt et al. (2013)

Cryptovalsa sp.*

Diatrypaceae

P

Eutypa dieback

New Zealand

Lardner et al. (2005)

Curvularia americana Da Cunha, Madrid, Gené & Cano*

Pleosporaceae

E

 

China

Dissanayake et al. (2018)

Curvularia sp.*

Pleosporaceae

E

 

China

Dissanayake et al. (2018)

Cylindrocarpon destructans (Zinssm.) Scholten*

Diatrypaceae

P, E

Black foot

Argentina, Canada, France, Iran, Italy, Portugal, Spain, Tasmania, Uruguay

Gerlach and Ershad (1970), Grasso (1984), Maluta and Larignon (1991), Rego et al. (2000), Gatica et al. (2001), Seifert et al. (2003), Casieri et al. (2009), Abreo et al. (2010), Gonzalez and Tello (2011)

C. lichenicola (C. Massal.) D. Hawksw.

Diatrypaceae

P

Black foot

India

Booth (1966)

C. ntricatea J.D. MacDon. & E.E. Butler*

Diatrypaceae

P

Black foot

Australia, Canada, France, Iran, Portugal, Spain, Switzerland, Uruguay, USA

Alaniz et al. (2007, 2009), Petit and Gubler (2007), Whitelaw-Weckert et al. (2007), Casieri et al. (2009), Luque et al. (2009), Abreo et al. (2010, 2012), Petit et al. (2011), Mohammadi et al. (2013a)

Cylindrocarpon sp.*

Diatrypaceae

P, S

Black foot

Canda, China, Lebanon, Portugal, South Africa, Spain, Switzerland, Tasmania, USA

Halleen et al. (2003), Gimenez-Jaime et al. (2006), Martin and Cobos (2007), Whitelaw-Weckert et al. (2007), Casieri et al. (2009), Choueiri et al. (2009), This study

Cylindrocladiella lageniformis Crous, M.J. Wingf. & Alfenas*

Nectriaceae

P

Black foot

South Africa, USA

Victor et al. (1998), Boesewinkel (1982), Koike et al. (2016)

C. parva (P.J. Anderson) Boesew.*

Nectriaceae

P

Black foot

New Zealand, South Africa, Spain

Van Coller et al. (2005), Gadgil (2005), Agusti-Brisach et al. (2012)

C. peruviana (Bat., J.L. Bezerra & M.P. Herrera) Boesew.*

Nectriaceae

P

Black foot

South Africa, USA

Boesewinkel (1982), Koike et al. (2016)

C. pseudoparva L. Lombard & Crous*

Nectriaceae

S

 

New Zealand

Boesewinkel (1982)

C. viticola Crous & Van Coller*

Nectriaceae

P

Cutting rot of grapevines, Black foot

South Africa, USA

Hirooka et al. (2013)

C. vitis Crous & Thangavel*

Nectriaceae

P

Black foot

New Zealand

Crous et al. (2017)

Cylindrocladiella sp.*

Nectriaceae

S

 

New Zealand

Boesewinkel (1982)

Cytospora ampelina Sacc.

Valsaceae

P

Canker

Pol2and

Mulenko et al. (2008)

C. chrysosperma (Pers.) Fr.*

Valsaceae

E

 

Spain

Gonzalez and Tello (2011), Garcia-Benavides et al. (2013)

C. cincta Sacc.*

Valsaceae

P

Canker

Iran

Fotouhifar et al. (2010)

C. leucostoma (Pers.) Sacc.*

Valsaceae

P

Canker

Iran

Fotouhifar et al. (2010)

C. vinacea D.P. Lawr., Travadon & Pouzoulet*

Valsaceae

P

Canker

USA

Lawrence et al. (2017a)

C. viticola D.P. Lawr., Travadon & Pouzoulet*

Valsaceae

P

Canker

Canada, USA

Lawrence et al. (2017a)

C. vitis Mont.

Valsaceae

P

Canker

Central Asia, Greece, Portugal, USA

Montagne (1856), Koshkelova and Frolov (1973), Pantidou (1973), Anonymous (1960), Phillips (2000)

Dacrymyces viticola

Dacrymycetaceae

S

 

USA

Saccardo (1878)

Dactylellina sp.*

Orbiliaceae

S

 

China

This study

Dactylonectria alcacerensis (A. Cabral, Oliveira & Crous)*

Nectriaceae

P

Black foot

Portugal, Spain

Agusti-Brisach et al. (2016), Carlucci et al. (2017)

D. estremocensis (A. Cabral, Nascimento & Crous) L. Lombard & Crous*

Nectriaceae

P

Black foot

Portugal

Agusti-Brisach et al. (2016), Carlucci et al. (2017)

D. macrodidyma (Halleen, Schroers & Crous)*

Nectriaceae

P, S

Black foot

Australia, Brazil, Canada, New Zealand, Portugal, Slovenia, South Africa, Switzerland, USA

Casieri et al. (2009), Abreo et al. (2010), Santos et al. (2014), Úrbez-Torres et al. (2014), Agusti-Brisach et al. (2016), Carlucci et al. (2017), This study

D. novozelandica (A. Cabral & Crous) L. Lombard & Crous*

Nectriaceae

P

Black foot

New Zealand, South Africa, USA

Úrbez-Torres et al. (2014), Carlucci et al. (2017)

D. pauciseptata (Schroers & Crous) L. Lombard & Crous*

Nectriaceae

P, S

Root rot, Black foot

Brazil, Canada, New Zealand, Portugal, Slovenia, Spain, Uruguay

Abreo et al. (2010), Agusti-Brisach et al. (2011), Martin et al. (2011a), Petit et al. (2011), Úrbez-Torres et al. (2014), Santos et al. (2014)

D. pinicola L. Lombard & Crous*

Nectriaceae

P

Black foot

Portugal

Carlucci et al. (2017),

D. torresensis (A. Cabral, Rego & Crous) L. Lombard & Crous*

Nectriaceae

P

Black foot

Australia, Canada, Italy, New Zealand, Portugal, South Africa, Spain, USA

Úrbez-Torres et al. (2014), Agusti-Brisach et al. (2016), Carlucci et al. (2017), Gonzalez and Chaverri (2017)

D. vitis (A. Cabral, Rego & Crous) L. Lombard & Crous*

Nectriaceae

P

Black foot

Portugal

Úrbez-Torres et al. (2014), Carlucci et al. (2017)

Deconica horizontalis (Bull.) Noordel.

Hymenogastraceae

S

 

South Africa

Doidge (1950)

Dendrophoma sp.

Chaetosphaeriaceae

S

 

Japan

Kobayashi (2007)

Desarmillaria tabescens (Scop.) R. A. Koch & Aime

Physalacriaceae

P

Root rot

Japan

Kobayashi (2007)

Devriesia sp.*

Teratosphaeriaceae

S

 

China

This study

Desmazierella sp.

Chorioactidaceae

S

 

Pakistan

Ahmad et al. (1997)

Diaporthe ambigua Nitschke*

Diaporthaceae

P

Canker

USA, South Africa

van Niekerk et al. (2005), White et al. (2011), Úrbez-Torres et al. (2013a, b), Lawrence et al. (2015)

D. ampelina (Berkeley & M.A. Curtis) R.R. Gomes, C. Glienke & Crous*

Diaporthaceae

P, E, S

Excoriose, Dead arm, Canker

Australia, Bulgaria, China, France, India, Italy, Japan, New Zealand, Poland, South Africa, Spain, Switzerland, Turkey, USA

Phillips (2000), Zhuang (2005), Kobayashi (2007), Casieri et al. (2009), Gonzalez and Tello (2011), Garcia-Benavides et al. (2013), Gomes et al. (2013), Kepley et al. (2015), Lawrence et al. (2015), Du et al. (2016), This study, Jayawardena et al. (2018)

D. mnivore (Delacr.) Udayanga, P.W.Crous & K.D.Hyde*

Diaporthaceae

P

Canker

South Africa

van Niekerk et al. (2005), Udayanga et al. (2011), Gomes et al. (2013)

D. australafricana Crous & Van Niekerk*

Diaporthaceae

P

Canker

Australia, South Africa, USA

van Niekerk et al. (2005), Mostert et al. (2001), Udayanga et al. (2012, 2014), Gomes et al. (2013), Lawrence et al. (2015), Du et al. (2016)

D. chamaeropis (Cooke) R.R. Gomes, C. Glienke & Crous

Diaporthaceae

P

Canker

USA

Lawrence et al. (2015)

D. eres Nitschke*

Diaporthaceae

P, S

Canker

Bulgaria, China, France, Germany, Italy, Japan, Switzerland, USA

Kobayashi (2007), Casieri et al. (2009), Stoykov (2012), Baumgartner et al. (2013), Úrbez-Torres et al. (2013a, b), Lawrence et al. (2015), Cinelli et al. (2016), Fischer et al. (2016), Bastide et al. (2017), This study, Jayawardena et al. (2018)

D. foenicula Niessl*

Diaporthaceae

P

Canker

South Africa, Portugal, USA

Luongo et al. (2011), Úrbez-Torres et al. (2013a, b), Udayanga et al. (2014a, b), Lawrence et al. (2015)

D. helianthi Munt.-Cvetk., Mihaljc. & M. Petrov*

Diaporthaceae

P

Canker

South Africa

van Niekerk et al. (2005), Udayanga et al. (2011)

D. hongkongensis R.R. Gomes, C. Glienke & Crous*

Diaporthaceae

P

Canker

China

Dissanayake et al. (2015)

D. kyushuensis Kajitani & Kanem.

Diaporthaceae

P

Canker

Japan

Kanematsu et al. (2000), Kobayashi (2007)

D. longiparaphysata (Uecker & K.C. Kuo) Udayanga & Castl.*

Diaporthaceae

P

Canker

Taiwan

Uecker and Kuo (1992), Udayanga et al. (2011)

D. nobilis Sacc. & Speg.*

Diaporthaceae

P

Canker

California

Lawrence et al. (2015)

D. novem M. Santos, Vrandecic & A.J.L. Phillips*

Diaporthaceae

P

Canker

California

Lawrence et al. (2015)

D. perjuncta Niessl

Diaporthaceae

P

Canker

Australia, Portugal, South Africa

Phillips (1999), Mostert et al. (2001)

D. perniciosa Marchal & É.J. Marchal

Diaporthaceae

P

Canker

Bulgaria

Stoykow and Denchev (2006)

D. phaseolorum (Cooke & Ellis) Sacc.*

Diaporthaceae

P

Canker

China, Switzerland

Casieri et al. (2009), Dissanayake et al. (2015)

D. rudis (Fr.) Nitschke*

Diaporthaceae

P, S

Canker

Australia, Germany, Italy, Portugal

Scheper et al. (2000), Úrbez-Torres et al. (2012), Gomes et al. (2013), Udayanga et al. (2014a, b), Huang et al. (2015), This study, Jayawardena et al. (2018)

D. sojae Lehman*

Diaporthaceae

P

Canker

China

Dissanayake et al. (2015)

D. vitimegaspora (K.C. Kuo & L.S. Leu) Rossman & Udayanga*

Diaporthaceae

P

Canker

Japan, Thailand, Thaiwan

Kuo and Leu (1998), van Niekerk et al. (2005), Udayanga et al. (2011)

Diaporthe sp.*

Diaporthaceae

P

Canker

Bulgaria, France, Italy, Japan, Portugal, South Africa, Spain Switzerland, USA

Kanematsu et al. (2000), Mostert et al. (2001), van Niekerk et al. (2005), Bobev (2009), Casieri et al. (2009), Santos et al. (2010), Luongo et al. (2011), Úrbez-Torres et al. (2013a, b)

Diatrype nigerrima Ellis & Everh.

Diatrypaceae

P

Eutypa dieback

USA

Ellis and Everhart (1904), Cash (1952)

D. oregonensis Wehm.) Rappaz*

Diatrypaceae

P

Eutypa dieback

USA

Trouillas and Gubler (2010), Trouillas et al. (2010), Úrbez-Torres et al. (2013a, b)

D. stigma (Hoffm.) Fr.*

Diatrypaceae

P

Eutypa dieback

Spain, USA

Unamuno (1941), Trouillas et al. (2010), Úrbez-Torres et al. (2013a, b)

D. utahensis Rehm

Diatrypaceae

P

Eutypa dieback

India

Pande (2008)

D. whitmanensis J.D. Rogers & Glawe*

Diatrypaceae

P

Eutypa dieback

USA

Trouillas and Gubler (2010), Trouillas et al. (2010), Úrbez-Torres et al. (2013a, b)

Diatrype sp.*

Diatrypaceae

P

Eutypa dieback

Australia, USA

Trouillas et al. (2010, 2011), Pitt et al. (2013), Úrbez-Torres et al. (2012, 2013a, b)

Diatrypella verrucaeformis (Ehrh.) Nitschke*

Diatrypaceae

P

Eutypa dieback

USA

Trouillas and Gubler (2010), Trouillas et al. (2010)

D. vitis Ellis & Everh.

Diatrypaceae

P

Eutypa dieback

China, USA

Cash (1952), Teng (1996)

D. vulgaris Trouillas, W.M. Pitt & Gubler*

Diatrypaceae

P

Eutypa dieback

Australia

Trouillas et al. (2011), Pitt et al. (2013)

Diatrypella sp.*

Diatrypaceae

P

Eutypa dieback

USA

Trouillas and Gubler (2010), Trouillas et al. (2010), Úrbez-Torres et al. (2012)

Dictyosporium elegans Corda

Dictyosporiaceae

P

Canker

Portugal

de Sousa Dias et al. (1987)

D. toruloides (Corda) Guég.

Dictyosporiaceae

P

Canker

Russia

Melnik and Popushoi (1992)

Didymella glomerata (Corda) Q. Chen & L. Cai*

Didymellaceae

E

 

Spain, Switzerland

Casieri et al. (2009), Gonzalez and Tello (2011)

D. negriana (Thümen) Q. Chen & L. Cai*

Didymellaceae

P, S

Black rot, Canker

Germany, Italy

Chen et al. (2015), This study, Jayawardena et al. (2018)

D. pomorum (Thümen) Q. Chen & L. Cai*

Didymellaceae

S

 

Australia,China

Cook and Dubé (1989), This study, Jayawardena et al. (2018)

Didymosphaeria bacchans Pass.

Didymosphaeriaceae

S

 

Italy

Greuter et al. (1991)

D. sarmenti (Cooke & Harkn.) Berl. & Voglino

Didymosphaeriaceae

P

Shoot lesions

Japan, Portugal, USA

Unamuno (1941), French (1989), Kobayashi (2007)

Dinemasporium pleurospora (Sacc.) Shkarupa

Chaetosphaeriaceae

S

 

Pakistan, Poland

Ahmad (1969), Ahmad et al. (1997), Mulenko et al. (2008)

Diplodia ampelina Cooke

Botryosphaeriaceae

P

Canker

Portugal, USA

Cooke (1878), Saccardo and Traverso (1903)

D. bacchii Pass. & Thüm

Botryosphaeriaceae

P, S

Canker

Belgium, Italy, Portugal

Cooke (1878)

D. corticola A.J.L. Phillips, A. Alves & J. Luque*

Botryosphaeriaceae

P

Canker

Italy, Mexico, Spain, USA

Carlucci and Frisullo (2009), Úrbez-Torres et al. (2010a, b, c), Pintos et al. (2011), Úrbez-Torres (2011), Carlucci et al. (2015)

D. intermedia A.J.L. Phillips, J. Lopes & A. Alves*

Botryosphaeriaceae

P

Canker

France

Comont et al. (2016)

D. mutila (Fr.) Mont.*

Botryosphaeriaceae

P, E

Canker

Australia, Canada, France, Hungary, Italy, New Zealand, Portugal, Spain, USA

Phillips (1998, 2000), Taylor et al. (2005), Úrbez-Torres et al. (2006), van Niekerk et al. (2006), Martin and Cobos (2007), Baskarathevan et al. (2008, 2012), Pitt et al. (2010), Gonzalez and Tello (2011), Qiu et al. (2011), Úrbez-Torres (2011), Whitelaw-Weckert et al. (2013), Alves et al. (2014), Carlucci et al. (2015)

D. nematospora Sacc.

Botryosphaeriaceae

S

 

Eritrea

Castellani and Ciferri (1937)

D. seriata (Fr.) Mont.*

Botryosphaeriaceae

P, E, S

Canker

Australia, Bulgaria, Canada, Chile, China, France, Germany, Greece, Iran, Italy, Lebanon, New Zealand, Portugal, South Africa, Spain, Switzerland, Tunisia Uruguay, USA

Pantidou (1973), Castillo-Pando et al. (2001), Larignon and Dubos (2001), Halleen et al. (2003), Auger et al. (2004a), Choueiri et al. (2006), van Niekerk et al. (2006), Slippers et al. (2007a, b), Baskarathevan et al. (2008), Epstein (2008), Casieri et al. (2009), Luque et al. (2009), Úrbez-Torres (2011), Yan et al. (2011a, b), Abreo et al. (2012), Garcia-Benavides et al. (2013), Mohammadi et al. (2013b), Mondello et al. (2013), Chebil et al. (2014), Fischer et al. (2016), This study, Jayawardena et al. (2018)

Diplodia sp.*

Botryosphaeriaceae

P

Canker

Belgium, Bulgaria, Cuba, Mexico, South Africa

Greuter et al. (1991), van Niekerk et al. (2004a), Bobev (2009), Casieri et al. (2009)

Diplodina vitis Brunaud

Gnomoniaceae

P

Root stock disease

Central Asia

Koshkelova and Frolov (1973)

Discohainesia oenotherae (Cooke & Ellis) Nannf.

Dermateaceae

P

Leaf spot

USA

Anonymous (1960)

Discosia artocreas (Todd) Fr.

Sporocadaceae

P

Leaf spot

USA

Gilman (1932), Maneval (1937), Cooke (1983)

D. vitis Schulzer

Sporocadaceae

P

Leaf spot

Hungary

Nag Raj (1993)

Discostroma corticola (Fuckel) Brockmann

Sporocadaceae

P

Cane blight

New Zealand

Pennycook (1989)

Doratomyces stemonitis (Pers.) F.J. Morton & G. Sm.

Microascaceae

S

 

Argentina, Russia

Melnik and Popushoi (1992), Carmaran and Novas (2003)

Dothiorella americana Úrbez-Torres, Peduto & Gubler*

Botryosphaeriaceae

P

Die back, Canker

USA

Úrbez-Torres (2011), Úrbez-Torres et al. (2012)

D. iberica A.J.L. Phillips, J. Luque & A. Alves*

Botryosphaeriaceae

P, S

Die back, Canker

Australia, Italy, New Zealand, Spain, USA

Úrbez-Torres et al. (2007), Baskarathevan et al. (2008, 2012), Úrbez-Torres and Gubler (2009), Qiu et al. (2011), Úrbez-Torres (2011), Pitt et al. (2010), McDonald and Eskalen (2011), Carlucci et al. (2015), Martin and Cobos (2007), This study, Jayawardena et al. (2018)

D. neclivora W.M. Pitt & J.R. Úrbez-Torres*

Botryosphaeriaceae

P

Die back, Canker

Australia

Pitt et al. (2015)

D. mnivore B. T. Linaldeddu, A. Deidda & B. Scanu*

Botryosphaeriaceae

P

Die back, Canker

Australia

Linaldeddu et al. (2016)

D. reinformis (Viala & Ravaz) Petr. & Syd

Botryosphaeriaceae

P, S

Die back, Canker

Italy, Portugal, South Africa

Petrak and Sydow (1927), Doidge (1950), Costa and Camara (1952)

D. sarmentorum (Fr.) A.J.L. Phillips, Alves & Luque*

Botryosphaeriaceae

P, S

Die back, Canker

China, Italy, New Zealand, Spain

Martin and Cobos (2007), Baskarathevan et al. (2012), Carlucci et al. (2015), This study, Jayawardena et al. (2018)

D. vidmadera W.M. Pitt, J.R. Úrbez-Torres, Trouillas*

Botryosphaeriaceae

P

Die back, Canker

Australia

Pitt et al. (2013), Linaldeddu et al. (2016), Lawrence et al. (2017b)

D. vinea-gemmae W.M. Pitt & J.R. Úrbez-Torres*

Botryosphaeriaceae

P

Die back, Canker

Australia

Pitt et al. (2015)

D. viticola A.J.L. Phillips & J. Luque

Botryosphaeriaceae

P, S

Die back, Canker

Spain

Luque et al. (2005)

Dothiorella sp.*

Botryosphaeriaceae

P

Die back, Canker

Australia, Mexico, USA

Úrbez-Torres et al. (2010a, b, c), Pitt et al. (2015), Lawrence et al. (2017b)

Elsinoe ampelina Shear

Elsinoaeceae

P

Grape antracnose

Barbados, Brazil, Bulgaria, Cambodia,Chile,China,Cuba, Haiti, Hong Kong, India, Italy, Jamaica, Kenya, Mauritius, Mexico, Myanmar, New Zealand, Poland, South Africa, Spain, Tanzania, Trinidad and Tobago, Thailand, USA, Venezuela, Zimbabwe

Gilman and Archer (1929), Jenkins and Bitancourt (Jenkins and Bitancourt 1940–1963), Mujica and Vergara (1945), Baker and Dale (1951), Riley (1960), Nattrass (1961), Litzenberger et al. (1962), Whiteside (1966), Orieux and Felix (1968), Benjamin and Slot (1969), Dennis (1970), Norse (1974), Alvarez (1976), Tai (1979), Alfieri Jr. et al. (1984), Grand (1985), Arnold (1986), Pennycook (1989), Greuter et al. (1991), Mendes et al. (1998), Lu et al. (2000), Zhuang (2001), Mulenko et al. (2008), Thaung (2008a, b, c), Bobev (2009)

Emericella sp.*

Aspergillaceae

S

 

China

This study

Endobasidium clandestinum Speschnew

Exobasidiaceae

P

Root rot

Uzbekistan

Gaponenko (1965)

Endoconidioma populi Tsuneda, Hambl. & Currah*

Dothideaceae

P

Necrotic twigs

Iran

Mirzaei et al. (2015)

Epicoccum granulatum Penz.

Didymellaceae

S

 

USA

Shaw (1973)

E. nigrum Link*

Didymellaceae

E, S

 

China, Italy, Spain, Switzerland

Phillips (2000), Casieri et al. (2009), Gonzalez and Tello (2011), This study, Jayawardena et al. (2018)

E. plurivorum (P.R. Johnston) Q. Chen & L. Cai

Didymellaceae

S

 

New Zealand

Gadgil (2005)

Epicoccum sp.

Didymellaceae

S

 

France

Larignon and Dubos (1997), Halleen et al. (2003)

Eriocercosporella vitis-heterophyllae (Henn.) U. Braun

Ascomycota genera incertae sedis

P

Leaf spot

Japan

Chupp (1953), Watson (1971)

Eriosphaeria oenotria Sacc. & Speg.

Trichosphaeriaceae

S

 

Italy

Farr (1973)

Erysiphe necator Schwein.

Erysiphaceae

P

Powdery mildew

Australia, Belgium, Bulgaria, Czechoslovakia, Denmark, Finland, France, Germany, Greece, Hungary, India, Ishrael, Italy, Japan, Korea, Netherlands, Peru, Poland, Romania, Russia, Spain, Sweden, Switzerland, Turkey, UK, Yugoslavia

Greuter et al. (1991), Nomura et al. (2003), Bolay (2005), Ruszkiewicz-Michalska and Michalski (2005), Amrani and Corio-Costet (2006), Paul and Thakur (2006), Rusanov and Bulgakov (2008), Voytyuk et al. (2009), Park et al. (2010), Bendezu-Euribe and Alvarez (2012)

E. tuckeri Berk.

Erysiphaceae

P

Powdery mildew

Spain

Unamuno (1941)

Erythricium salmonicolor (Berk. & Broome) Burds.

Corticiaceae

P

Sour rot

Thailand

Giatgong (1980)

Eucasphaeria capensis Crous*

Niessliaceae

P

Eutypa dieback

Germany

Fischer et al. (2016)

Eutypa lata (Pers.) Tul. & C. Tul.*

Diatrypaceae

P

Eutypa dieback

Australia, Brazil, Bulgaria, Europe, France, Germany, Greece, Italy, New Zealand, Serbia, South Africa, Spain, Switzerland, USA

Moller et al. (1974), Pennycook (1989), Shivas (1989), Carter (1991), Larignon and Dubos (1997), Mendes et al. (1998), Péros et al. (1999), Holevas et al. (2000), Rolshausen et al. (2004, 2014), Lardner et al. (2005), Sosnowski et al. (2007), Bobev (2009), Luque et al. (2009), Trouillas et al. (2010, 2011), White et al. (2011), Úrbez-Torres et al. (2012), Živkovic et al. (2012), Garcia-Benavides et al. (2013), Travadon and Baumgartner (2015), Mayorquin et al. (2016)

E. laevata (Nitschke) Sacc.*

Diatrypaceae

P

Eutypa dieback

Canada, USA

Rappaz (1987), Rolshausen et al. (2004, 2014)

E. ludibunda Sacc.

Diatrypaceae

P

Eutypa dieback

USA

Tiffany and Gilman (1965)

E. leptoplaca (Durieu & Mont.) Rappaz*

Diatrypaceae

P

Eutypa dieback

Spain, South Africa, USA

Luque et al. (2009), Trouillas and Gubler (2004, 2010), Úrbez-Torres et al. (2012)

Eutypa sp.*

Diatrypaceae

P

Eutypa dieback

Bulgaria, USA

Bobev (2009), Rolshausen et al. (2014)

Eutypella aequilinearis (Schwein.) Starbäck

Diatrypaceae

P

Eutypa dieback

Japan, USA

Rappaz (1987), Kobayashi (2007)

E. aulacostroma (Kunze) Berl.

Diatrypaceae

P

Eutypa dieback

Taiwan

Rappaz (1987)

E. citricola Speg.*

Diatrypaceae

P

Eutypa dieback

Australia, USA

Trouillas et al. (2011), Pitt et al. (2013), Mayorquin et al. (2016)

E. fraxinicola (Cooke & Peck) Sacc.

Diatrypaceae

P

Eutypa dieback

USA

Hanlin (1963)

E. leprosa (Pers.) Berl.

Diatrypaceae

P

Eutypa dieback

Chile, Spain, Switzerland, USA

Rappaz (1987), Diaz et al. (2011)

E. microtheca Trouillas, W.M. Pitt & Gubler*

Diatrypaceae

P

Eutypa dieback

Australia, Mexico, USA

Trouillas et al. (2011), Pitt et al. (2013), Paolinelli-Alfonso et al. (2016), Mayorquin et al. (2016)

E. vitis (Schwein.) Ellis & Everh.*

Diatrypaceae

P

Eutypa dieback

Italy, Pakistan, South Africa, Spain, Uruguay, USA

Greuter et al. (1991), Ahmad et al. (1997), Luque et al. (2009), White et al. (2011), Úrbez-Torres et al. (2012), Abreo et al. (2012), Mayorquin et al. (2016)

Eutypella sp.*

Diatrypaceae

P

Eutypa dieback

USA

Trouillas et al. (2010), Úrbez-Torres et al. (2012), Mayorquin et al. (2016)

Excipula viticola Schwein

Dermateaceae

P

On leaves

USA

Saccardo (1878)

Exosporium sultanae du Plessis

Ascomycota genera incertae sedis

S

 

South Africa

Gorter (1977)

Exophiala sp.*

Herpotrichiellaceae

E

 

China

Dissanayake et al. (2018)

Exserohilum rostratum (Drechsler) K.J. Leonard & Suggs*

Pleosporaceae

S

 

China

This study, Jayawardena et al. (2018)

Floricola viticola (Phukhamsakda, Camporesi & K.D. Hyde) Jaklitsch & Voglmayr*

Teichosporaceae

S

 

Italy

Ariyawansa et al. (2015), This study, Jayawardena et al. (2018)

Fomes fomentarius (L.) Fr.

Polyporaceae

P

Esca

China

Tai (1979)

F. igniarius (L.) Fr.*

Polyporaceae

P

Esca

France, USA

Chiarappa (1959), Cloete et al. (2015)

Fomitiporia australiensis M. Fisch., J. Edwards, Cunningt. & Pascoe*

Hymenochaetaceae

P

Esca

Australia

Fischer et al. (2005), Cloete et al. (2015)

F. capensis M. Fisch., M. Cloete, L. Mostert, F. Halleen*

Hymenochaetaceae

P

Esca

South Africa

Cloete et al. (2014)

F. mediterranea M. Fisch.*

Hymenochaetaceae

P

Esca

Europe, Germany, Iran, Italy, Spain, Turkey

Fischer et al. (2005), Martin and Cobos (2007), Luque et al. (2009), Mohammadi and Banihashemi (2012), Garcia-Benavides et al. (2013), Mondello et al. (2013), Akgul et al. (2015), Cloete et al. (2015)

F. polymorpha M. Fisch.*

Hymenochaetaceae

P

Esca

USA

Cloete et al. (2015)

F. punctata (P. Karst.) Murrill*

Hymenochaetaceae

P

Esca

Australia, France, Iran, Italy

Larignon and Dubos (1997), Pascoe and Cottral (2000), Karimi et al. (2001), Cloete et al. (2015)

Fomitiporia sp.*

Hymenochaetaceae

P

Esca

Italy, South Africa

White et al. (2011), Mondello et al. (2013)

Fusarium acuminatum Ellis & Everh.*

Nectriaceae

P

Wilt

Spain

Garcia-Benavides et al. (2013)

F. anthophilum (A. Braun) Wollenw.

Nectriaceae

P

Wilt

Brazil

Mendes et al. (1998)

F. avenaceum (Fr.) Sacc.

Nectriaceae

P

Wilt

China, Italy

Tai (1979), Greuter et al. (1991)

F. equiseti (Corda) Sacc.

Nectriaceae

P

Wilt

Brazil

Mendes et al. (1998)

F. fujikuroi Nirenberg

Nectriaceae

P

Wilt

Brazil

Mendes et al. (1998)

F. oxysporum Schltdl.*

Nectriaceae

P, E, S

Wilt

Australia, Brazil, China, South Africa, Spain

Gorter (1977), Mendes et al. (1998), Castillo-Pando et al. (2001), Gonzalez and Tello (2011), This study, Jayawardena et al. (2018)

F. poae (Peck) Wollenw.

Nectriaceae

P

Wilt

USA

Shaw (1973)

F. proliferatum (Matsush.) Nirenberg*

Nectriaceae

P, E

Wilt

China, Spain

Gonzalez and Tello (2011), Wang et al. (2015)

F. schweinitzii Ellis & Harkn.

Nectriaceae

P, E

Wilt

USA

Sumstine (1949), Cash (1952)

F. solani (Mart.) Sacc.*

Nectriaceae

P

Wilt

Brazil, India, Switzerland

Sarbhoy and Agarwal (1990), Mendes et al. (1998), Casieri et al. (2009)

F. viticola Thüm.

Nectriaceae

S

 

USA

Saccardo (1878)

F. volutella Ellis & Everh.

Nectriaceae

P

Wilt

USA

Cash (1952)

Fusarium sp.*

Nectriaceae

P, S

Wilt

Australia, China, Germany, Italy, South Africa, Switzerland, Spain, Uruguay

Cook and Dubé (1989), O’Donnell et al. (1998), Halleen et al. (2003), Casieri et al. (2009), Luque et al. (2009), Abreo et al. (2010), Mondello et al. (2013), This study, Jayawardena et al. (2018)

Fusicladium viticis M.B. Ellis

Sympoventuriaceae

P

Leaf spot

China

Zhang (2003)

Geomyces pannorum (Link) Sigler & J.W. Carmich.*

Myxotrichaceae

E

 

Switzerland

Casieri et al. (2009)

Geomyces sp.

Myxotrichaceae

S

 

China

This study

Geotrichum candidum Link

Dipodascaceae

E

 

Japan

Kobayashi (2007)

Geotrichum sp.

Dipodascaceae

E

 

Spain

Gonzalez and Tello (2011)

Gloniopsis praelonga (Schwein.) Underw. & Earle

Hysteriaceae

S

 

Germany

Lotz-Winter et al. (2011)

Glonium lineare (Fr.) De Not.

Gloniaceae

S

 

Rhode Island

Goos (2010)

G. macrosporium Tracy & Earle

Gloniaceae

S

 

USA

Parris (1959)

Glonium sp.

Gloniaceae

S

 

USA

Hanlin (1963)

Golovinomyces biocellatus (Ehrenb.) V.P. Heluta

Erysiphaceae

P

Powdery mildew

India

Paul and Thakur (2006)

Gonatobotrys flava Bonord.

Ceratostomataceae

E

 

Poland

Mulenko et al. (2008)

Gonatobotryum sp.

Ascomycota genera incertae sedis

E

 

Spain

Gonzalez and Tello (2011)

Graphium cinerellum Speg.

Graphiaceae

P

Leaf spot

Italy

Farr (1973)

Greeneria uvicola (Berk. & M.A. Curtis) Punith.*

Diaporthales genera incertae sedis

P

Bitter rot

Australia, Bulgaria, Brazil, Cuba, India, Poland, South Africa, Taiwan, Thailand, Ukraine, Uruguay, USA

Cooke (1878), Simmonds (1966), Gorter (1977), Mathur (1979), Giatgong (1980), Reddy and Reddy (1983), Arnold (1986), Kummuang et al. (1996), Mendes et al. (1998), Castillo-Pando et al. (2001), Farr et al. (2001), Dudka et al. (2004), Longland and Sutton (2008), Mulenko et al. (2008), Bobev (2009), Navarrete et al. (2009), Abreo et al. (2012)

Grovesinia moricola (I. Hino) Redhead

Sclerotiniaceae

P

Bunch rot

USA

Grand (1985)

G. pyramidalis M.N. Cline, J.L. Crane & S.D. Cline

Sclerotiniaceae

P

Bunch rot

Japan

Kobayashi (2007)

Gymnascella sp.*

Gymnoascaceae

S

 

China

This study

Gyrothrix podosperma (Corda) Rabenh.

Ascomycota genera incertae sedis

S

 

Pakistan

Ahmad et al. (1997)

Hansfordia pulvinata (Berk. & M.A. Curtis) S. Hughes

Ascomycota genera incertae sedis

S

 

Pakistan

Ahmad et al. (1997)

H. tonduzii (Speg.) Bat. & A.F. Vital

Ascomycota genera incertae sedis

S

 

Costa Rica

Batista and Ciferri (1962)

Hansfordia sp.*

Ascomycota genera incertae sedis

S

 

China

This study

Hapalopilus rutilans (Pers.) Murrill

Polyporaceae

S

 

USA

Gilbertson et al. (1974)

Helicobasidium mompa Nobuj. Tanaka

Helicobasidiaceae

P

Root rot

Japan

Kobayashi (2007)

Helminthosporium decacuminatum Thüm. & Pass.

Dothideomycetes genera incertae sedis

P

Leaf spot

Greece, Macedonia

Konstantinia-Sulidu (1939), Pantidou (1973)

H. siliquosum Berk. & M.A. Curtis

Dothideomycetes genera incertae sedis

P

Twigs and leaf spot

USA

Anonymous (1960)

H. velutinum (Link) Link

Dothideomycetes genera incertae sedis

S

 

Japan

Shirouzu and Harada (2004)

Helminthosporium sp.

Dothideomycetes genera incertae sedis

P

Leaf spot

USA

Anonymous (1960), Alfieri Jr. et al. (1984)

Hendersonia cookeana Speg.

Ascomycota genera incertae sedis

S

 

Italy

Spegazzini (1878), Farr (1973)

H. corticalis Ellis & Everh.

Ascomycota genera incertae sedis

S

 

USA

Cash (1953)

H. sarmentorum Westend.

Ascomycota genera incertae sedis

P

Twig lesions

Central Asia, Greece, Italy, Pakistan, Spain, USA

Gonzalez Fragoso (1916), Anonymous (1960), Ahmad (1969), Koshkelova and Frolov (1973), Pantidou (1973), Greuter et al. (1991), Ahmad et al. (1997)

H. tenuipes McAlpine

Ascomycota genera incertae sedis

S

 

Greece

Pantidou (1973)

H. viticola S. Ahmad

Ascomycota genera incertae sedis

S

 

Greece, Pakistan

Ahmad (1969), Pantidou (1973), Ahmad et al. (1997)

Herpotrichia sp.

Melanommataceae

E

 

USA

Hanlin (1963)

Hormonema viticola F. Laich & Stchigel*

Dothioraceae

E

 

Malaysia, Spain

Crous et al. (2015)

Humicola sp*.

Chaetomiaceae

E, S

 

China, Spain

Gonzalez and Tello (2011), This study

Hydnum viticola

Hydnaceae

S

 

USA

Saccardo (1878)

Hydnum sp.*

Hydnaceae

S

 

China

This study

Hyaloceras viticola (Cavara) Died.

Sporocadaceae

P

Fruits

Italy

Saccardo (1878)

Hymenochaetopsis intricata (Lloyd) S.H. He & Jiao Yang

Hymenochaetaceae

S

 

Japan

Kobayashi (2007)

Hypocrella reineckeana Henn.

Clavicipitaceae

P

Leaf spot

Niue

Dingley et al. (1981)

Hypoderma commune (Fr.) Duby

Rhytismataceae

S

 

Portugal

Unamuno (1941)

H. rubi (Pers.) DC.

Rhytismataceae

S

 

China

Ying-Ren (2012)

Hypoxylon hypophlaeum (Berk. & Ravenel) J.H. Mill.

Hypoxylaceae

S

 

USA

Hanlin (1963)

H. lateripigmentum J. Fourn., Kuhnert & M. Stadler*

Hypoxylaceae

E

 

China

Dissanayake et al. (2018)

H. rubiginosum (Pers.) Fr.

Hypoxylaceae

S

 

USA

Hanlin (1963)

Hypoxylon sp.*

Hypoxylaceae

E

 

China

Dissanayake et al. (2018)

Hysterium pulicare (Lightf.) Pers.

Hysteriaceae

S

 

Italy

Greuter et al. (1991)

H. viticola Cooke & Peck

Hysteriaceae

S

 

USA

Saccardo (1878)

Hysterobrevium mori (Schwein.) E. Boehm & C.L. Schoch

Hysteriaceae

S

 

USA

Anonymous (1960), Barr (1990), Tibpromma et al. (2017)

Hysterographium flexuosum Maire

Pleosporomycetidae genera incertae sedis

P, S

Stem lesions

USA

Hanlin (1963)

H. viticola (Cooke & Peck) Rehm

Pleosporomycetidae genera incertae sedis

P, S

Stem lesions

USA

Wolf et al. (1938), Anonymous (1960)

H. vulvatum (Schwein.) Rehm

Pleosporomycetidae genera incertae sedis

P, S

Stem lesions

USA

Parris (1959), Anonymous (1960)

Ilyonectria crassa (Wollenw.) A. Cabral & Crous*

Nectriaceae

P

Black foot

Uruguay

Abreo et al. (2010)

I. destructans (Zinssmeister) Rossman, L. Lombard & Crous

Nectriaceae

P

Black foot

Argentina, Canada, France, Iran, South Africa, Spain, USA

Gerlach and Ershad (1970), Seifert and Axelrood (1998), Gatica et al. (2001), Petit and Gubler (2005), Gonzalez and Tello (2011), Petit et al. (2011)

I. europaea A. Cabral, Rego & Crous*

Nectriaceae

P

Black foot

Portugal

Úrbez-Torres et al. (2014), Agusti-Brisach et al. (2016), Carlucci et al. (2017)

I. liriodendri (Halleen, Rego & Crous) Chaverri & C. Salgado*

Nectriaceae

P

Black foot

Australia, Canada, France, Portugal, South Africa, Turkey, USA

Halleen et al. (2003), Petit et al. (2011), Whitelaw-Weckert et al. (2013), Úrbez-Torres et al. (2014), Savas et al. (2015), Agusti-Brisach et al. (2016)

I. lusitanica A. Cabral, Rego & Crous*

Nectriaceae

P

Black foot

Portugal

Úrbez-Torres et al. (2014), Agusti-Brisach et al. (2016), Carlucci et al. (2017)

I. pseudodestructans A. Cabral, Rego & Crous*

Nectriaceae

P

Black foot

Portugal

Úrbez-Torres et al. (2014), Agusti-Brisach et al. (2016), Carlucci et al. (2017)

I. robusta (A.A. Hildebr.) A. Cabral & Crous*

Nectriaceae

P

Black foot

Brazil, Canada, Portugal

Santos et al. (2014), Úrbez-Torres et al. (2014)

Ilyonectria sp.*

Nectriaceae

P, S

Black foot

Australia, China, Portugal

Úrbez-Torres et al. (2014), Parkinson et al. (2017), This study

Inocutis jamaicensis (Murrill) A.M. Gottlieb, J.E. Wright & Moncalvo*

Hymenochaetaceae

P

Hoja de malvón and chlorotic leaf roll

Argentina, Uruguay

Abreo et al. (2012), Rajchenberg and Robledo (2013), Cloete et al. (2015)

Irpex lacteus (Fr.) Fr.

Phanerochaetaceae

E

 

USA

Brenckle (1918)

I. viticola

Phanerochaetaceae

S

 

USA

Saccardo (1878)

Kalmusia variispora (Verkley, Göker & Stielow) Ariyawansa & K.D. Hyde

Didymosphaeriaceae

P

Trunk disease

Syria

Verkley et al. (2014)

Karstenula yaline (Ellis & Everh.) M.E. Barr

Didymosphaeriaceae

S

 

USA

Cash (1954)

Kazachstania viticola Zubcova

Saccharomycetaceae

 

Fermented juice

Kazakhstan

Zubkova (1971)

Kernia sp.*

Microascaceae

E, S

 

China

Dissanayake et al. (2018), This study

Kluyveromyces marxianus (E.C. Hansen) Van der Walt

Saccharomycetaceae

P

Sour rot

Poland

Mulenko et al. (2008)

Kuehneola vitis (E.J. Butler) Syd. & P. Syd.

Phragmidiaceae

P

Rust

India

Watson (1971), Ragunathan and Ramakrishnan (1973)

Lachnella macrochaeta Speg.

Niaceae

S

 

Italy

Farr (1973)

L. myceliosa W.B. Cooke

Niaceae

S

 

France, Germany

Batista and Ciferri (1962)

L. uvicola (Speg.) W.B. Cooke

Niaceae

S

 

Argentina

Batista and Ciferri (1962)

L.viticola Gonz. Frag.

Niaceae

S

 

Portugal

Unamuno (1941)

Lachnum virgineum (Batsch) P. Karst.

Lachnaceae

S

 

Japan

Kobayashi (2007)

Lasiodiplodia brasiliense M.S.B. Netto, M.W. Marques & A.J.L. Phillips*

Botryosphaeriaceae

P

Canker and die back

Brazil

Correia et al. (2016b)

L. citricola Abdollahzadeh, Javadi & A.J.L. Phillips*

Botryosphaeriaceae

P

Canker and die back

Italy

Carlucci et al. (2015)

L. crassispora T. Burgess & Barber*

Botryosphaeriaceae

P

Canker and die back

Brazil, South Africa, USA

Úrbez-Torres et al. (2010b), van Niekerk et al. (2010), Correia et al. (2013, 2016b)

L. egyptiaca A.M. Ismail, L. Lombard & Crous*

Botryosphaeriaceae

P

Canker and die back

Brazil

Correia et al. (2016b)

L. euphorbicola A.R. Machado & O.L. Pereira*

Botryosphaeriaceae

P

Canker and die back

Brazil

Correia et al. (2016b)

L. hormozganensis Abdollahzadeh, Zare & A.J.L. Phillips*

Botryosphaeriaceae

P

Canker and die back

Brazil

Correia et al. (2016b)

L. jatrophicola A.R. Machado & O.L. Pereira*

Botryosphaeriaceae

P

Canker and die back

Brazil

Correia et al. (2016b)

L. iraniensis Abdollahzadeh, Zare & A.J.L. Phillips*

Botryosphaeriaceae

P

Canker and die back

Italy

Correia et al. (2016b), Netto et al. (2017)

L. laeliocattleyae (Sibilia) A. Alves*

Botryosphaeriaceae

P

Canker and die back

Brazil

Correia et al. (2016b)

L. margaritacea Pavlic, T.I. Burgess & M.J. Wingf.*

Botryosphaeriaceae

S

 

China

This study

L. mediterranea Linaldeddu, Deidda & Berraf-Tebbal*

Botryosphaeriaceae

P

Canker and die back

USA

Linaldeddu et al. (2015), Cruywagen et al.(2017), Netto et al. (2017)

L. missouriana Úrbez-Torres, Peduto & Gubler*

Botryosphaeriaceae

P

Canker and die back

Brazil, USA

Úrbez-Torres et al. (2012), Netto et al. (2014, 2017), Linaldeddu et al. (2015), Trakunyingcharoen et al. (2015), Correia et al. (2016b), Cruywagen et al. (2017), Coutinho et al. (2017)

L. parva A.J.L. Phillips, A. Alves & Crous*

Botryosphaeriaceae

P

Canker and die back

Brazil

Correia et al. (2013)

L. plurivora Damm & Crous*

Botryosphaeriaceae

P

Canker and die back

Africa, South Africa

Damm et al. (2007), Begoude et al. (2010), Doilom et al. (2015), Coutinho et al. (2017)

L. pseudotheobromae A.J.L. Phillips, A. Alves & Crous*

Botryosphaeriaceae

P

Canker and die back

Brazil, China

Correia et al. (2013, 2016b), Dissanayake et al. (2015)

L. theobromae (Pat.) Griffon & Maubl.*

Botryosphaeriaceae

P, E

Canker and die back

Argentina, Australia, Bolivia, Brazil, China, Egypt, Florida, Iran, Italy, Iraq, Portugal, South Africa, Spain, Turkey, Uganda, USA

Alfieri Jr. et al. (1984), Úrbez-Torres et al. (2006), van Niekerk et al. (2006), Pitt et al. (2010), Qiu et al. (2011), Yan et al. (2011b), Mondello et al. (2013), Dissanayake et al. (2018)

L. viticola Úrbez-Torres, Peduto & Gubler*

Botryosphaeriaceae

P

Canker and die back

USA

Úrbez-Torres et al. (2012), Linaldeddu et al. (2015), Comont et al. (2016), Coutinho et al. (2017), Netto et al. (2017)

L. vitis Tao Yang & Crous*

Botryosphaeriaceae

P

Canker and die back

Italy

Yang et al. (2017)

Lasiodiplodia sp.*

Botryosphaeriaceae

P, S, E

Canker and die back

China, Italy

Mondello et al. (2013), Dissanayake et al. (2018), This study

Lecanicillium lecanii (Zimm.) Zare & W. Gams

Cordycipitaceae

E

 

Spain

Gonzalez and Tello (2011)

Lecanicillium sp.*

Cordycipitaceae

S

 

China

This study

Lecanidion atratum (Hedw.) Endl.

Patellariaceae

S

 

Italy

Greuter et al. (1991)

Lecythophora hoffmannii (J.F.H. Beyma) W. Gams & McGinnis*

Coniochaetaceae

E

 

Switzerland

Casieri et al. (2009)

Lentinus sp.*

Polyporaceae

S

 

China

This study

Lenzites betulina (L.) Fr.

Polyporaceae

S

 

Pakistan

Ahmad et al. (1997)

Leptodothiorella sp.

Botryosphaeriaceae

P

Black rot

Russia

Melnik and Popushoi (1992)

Leptosphaeria ampelina Curzi & Barbaini

Leptosphaeriaceae

E

 

Italy

Crane and Shearer (1991)

L. cerlettii Speg.

Leptosphaeriaceae

S

 

Italy

Farr (1973), Crane and Shearer (1991)

L. chaetostoma Sacc.

Leptosphaeriaceae

S

 

Italy

Crane and Shearer (1991)

L. cirricola Pass.

Leptosphaeriaceae

S

 

Italy

Crane and Shearer (1991)

L. gibelliana Pirotta

Leptosphaeriaceae

S

 

Italy

Crane and Shearer (1991)

L. ogilviensis (Berk. & Broome) Ces. & De Not.

Leptosphaeriaceae

S

 

Pakistan

Ahmad (1978)

L. pampini (Thüm.) Sacc.

Leptosphaeriaceae

S

 

France, Italy, Portugal

Unamuno (1941), Crane and Shearer (1991)

L. yalin Sacc.

Leptosphaeriaceae

S

 

Italy, UK

Cannon et al. (1985), Crane and Shearer (1991)

L. vagabunda Sacc.

Leptosphaeriaceae

S

 

USA

Hanlin (1963)

L. vinealis Pass.

Leptosphaeriaceae

S

 

Italy

Crane and Shearer (1991)

L. viticola Fautrey & Roum.

Leptosphaeriaceae

S

 

France

Crane and Shearer (1991)

L. vitigena Sacc.

Leptosphaeriaceae

S

 

Austria

Crane and Shearer (1991)

L. vitis (Castagne) Pirotta

Leptosphaeriaceae

S

 

Austria, France

Crane and Shearer (1991)

Leptosphaeria sp.*

Leptosphaeriaceae

E, S

 

China, Spain, Switzerland, Venezuela

Urtiaga (1986), Casieri et al. (2009), Gonzalez and Tello (2011), This study

Leptothyrium passerinii Thüm.

Ascomycota genera incertae sedis

E

 

China

Tai (1979)

Leucostoma persoonii (Nitschke) Höhn.*

Valsaceae

P

Canker

Germany, Italy, Spain

Greuter et al. (1991), Fischer et al. (2016)

Libertella blepharis A.L. Sm.

Diatrypaceae

P, E

Trunk disease

Bulgaria

Bobev (2009)

L. viticola Fautrey

Diatrypaceae

E

 

France

Fautrey and Lambotte (1896)

Libertella sp.

Diatrypaceae

P, E

Trunk disease

Australia, Spain

Sosnowski et al. (2007), Gonzalez and Tello (2011)

Lophidium nitidum Ellis & Everh.

Lophiostomataceae

S

 

USA

Cash (1953)

Lophiostoma caulium (Fr.) Ces. & De Not.

Lophiostomataceae

E

 

Poland

Mulenko et al. (2008)

L. elegans (Fabre) Sacc.

Lophiostomataceae

E

 

Pakistan

Ahmad (1969)

L. macrostomum (Tode) Ces. & De Not.*

Lophiostomataceae

E, S

 

Pakistan, Italy

Ahmad (1978), Ahmad et al. (1997), This study, Jayawardena et al. (2018)

L. pustulatum Ellis & Everh.

Lophiostomataceae

E

 

USA

Cash (1953)

L. rhopalosporum Ellis & Everh.

Lophiostomataceae

E

 

USA

Cash (1953)

L. scrophulariae Peck

Lophiostomataceae

E

 

Canada, USA

Barr (1992)

L. stenostomum Ellis & Everh.

Lophiostomataceae

E

 

USA

Cash (1953)

L. subcorticale Fuckel

Lophiostomataceae

E

 

Italy

Saccardo (1878)

L. thuemenianum Speg.

Lophiostomataceae

E

 

Italy

Farr (1973)

L. vitigenum (Kaz. Tanaka & Y. Harada) K. Hirayama & Kaz. Tanaka

Lophiostomataceae

E

 

Japan

Hirayama and Tanaka (2011)

Lophiostoma sp.*

Lophiostomataceae

E, S

 

China

Dissanayake et al. (2018), This study

Lophiotrema eburnoides Kaz. Tanaka, A. Hashim. & K. Hiray.*

Lophiotremataceae

S

 

Japan

Liu et al. (2015)

L. vitigenum Kaz. Tanaka & Y. Harada

Lophiotremataceae

S

 

Japan

Tanaka and Harada (2003), Kobayashi (2007)

Loranitschkia viticola Lar.N. Vassiljeva

Nitschkiaceae

S

 

China, Kunashir Island, Russia

Vasilyeva (1990), Vasilyeva et al. (2009, 2010)

Macrophoma farlowiana (Viala & Sauv.) Tassi

Botryosphaeriaceae

P

Macrophoma rot

USA

Anonymous (1960), Greene (1966)

M. flaccida (Viala & Ravaz) Cavara

Botryosphaeriaceae

P

Macrophoma rot

Bulgaria, France, Greece, India, Italy, Portugal

Mathur (1979), Phillips and Lucas (1997), Phillips (2000), Bobev (2009)

M. longispora (I. Miyake) Hara

Botryosphaeriaceae

P

Macrophoma rot

USA

Anonymous (1960)

M. peckiana Dearn. & House

Botryosphaeriaceae

P

Macrophoma rot

USA

Anonymous (1960)

M. reniformis (Viala & Ravaz) Cavara

Botryosphaeriaceae

P

Macrophoma rot

Italy, USA

Anonymous (1960), Phillips and Lucas (1997)

M. rimiseda (Sacc.) Berl. & Voglino

Botryosphaeriaceae

P

Macrophoma rot

Greece, Morocco, Turkey

Watson (1971), Pantidou (1973)

M. sicula Scalia

Botryosphaeriaceae

P

Macrophoma rot

Central Asia, Italy

Koshkelova and Frolov (1973), Greuter et al. (1991)

Macrophoma sp.

Botryosphaeriaceae

P

Macrophoma rot

India, USA

Mathur (1979), Alfieri Jr. et al. (1984)

Macrophomina phaseolina (Tassi) Goid.

Botryosphaeriaceae

P, E

Charcoal rot

Australia, Hawaii, India, Malawi, South Africa, Spain,

Peregrine and Siddiqi (1972), Marais (1979), Raabe et al. (1981), Gonzalez and Tello (2011)

Macrosporium vitis (Cavara) Cavara

Pleosporaceae

E

 

Chile

Mujica and Vergara (1945)

Macrosporium sp.

Pleosporaceae

E

 

Bulgaria, Greece, South Africa

Alexopoulos (1940), Doidge (1950), Bobev (2009)

Marssonina viticola (I. Miyake) F.L. Tai

Drepanopezizaceae

E

 

China, Japan, Taiwan

Sawada (1959), Watson (1971), Tai (1979), Kobayashi (2007)

Marasmius sp.*

Marasmiaceae

S

 

China

This study

Massariella viticola Frolov

Amphisphaeriaceae

S

 

Central Asia

Koshkelova and Frolov (1973)

Massarina corticola (Fuckel) L. Holm*

Massarinaceae

S

 

Switzerland

Casieri et al. (2009)

Merismodes bresadolae (Grélet) Singer

Niaceae

E

 

Italy

Farr (1973)

Meliola vitis Hansf.

Meliolaceae

E

 

India, Uganda

Hansford (1947), Patil and Mahamulkar (1999)

Metarhizium sp.*

Clavicipitaceae

S

 

China

This study

Metasphaeria social (Sacc.) Sacc.

Dothioraceae

S

 

Italy

Greuter et al. (1991)

Metschnikowia pulcherrima Pitt & M.W. Mill.

Metschnikowiaceae

E

 

USA

Batra (1973)

M. viticola G. Péter, Tornai-Leh., M. Suzuki & Dlauch*

Metschnikowiaceae

E

 

Hungary

Peter et al. (2005)

Microascus brevicaulis S.P. Abbott*

Helotiales genera incertae sedis

E

 

China

Dissanayake et al. (2018)

Microascus sp.

Helotiales genera incertae sedis

S

 

China

This study

Microdochium bolleyi (R. Sprague) de Hoog & Herm. Nijh.*

Microdochiaceae

E

 

Switzerland

Casieri et al. (2009)

Microdochium sp.*

Microdochiaceae

S

 

China

This study

Microdiplodia microsporella (Sacc.) Allesch.

Ascomycota genera incertae sedis

P

Trunk disease

Poland

Mulenko et al. (2008)

M. vineae (Pass. & Beltrani) Tassi

Ascomycota genera incertae sedis

S

 

Italy

Tassi (1902), Greuter et al. (1991)

Micropera ampelina Sacc. & Fairm.

Ascomycota genera incertae sedis

S

 

USA

Anonymous (1960)

Microthyrium microscopicum Desm.

Microthyriaceae

S

 

Portugal

Unamuno (1941)

Minimedusa sp.*

Cantharellales incertae sedis

S

 

China

This study, Jayawardena et al. (2018)

Moeszia cylindroides Bubák

Nectriaceae

S

 

Japan

Tubaki (1958)

Mollisia cinerea (Batsch) P. Karst.

Mollisiaceae

S

 

USA

Hanlin (1963)

M. melaleuca (Fr.) Sacc.

Mollisiaceae

S

 

USA

Hanlin (1963)

M. pullata (W.R. Gerard) Dennis

Mollisiaceae

S

 

USA

Dennis (1964)

Monilinia fructicola (G. Winter) Honey*

Sclerotiniaceae

P

Brown rot

Canada, Japan, New Zealand, USA

Preston (1945), Pennycook (1989), Kobayashi (2007), Hrustic et al. (2015)

M. fructigena (Pers.) Pers.

Sclerotiniaceae

S

 

China

Tai (1979)

M. laxa (Aderh. & Ruhland) Honey

Sclerotiniaceae

S

 

New Zealand

Pennycook (1989)

Monochaetia ampelophila Speg.

Xylariomycitidae genera insertae sedis

E

 

Argentina

Guba (1961), Nag Raj (1993)

M. uniseta (Tracy & Earle) Sacc. & D. Sacc.

Xylariomycitidae genera insertae sedis

E

 

USA

Nag Raj (1993)

Monochaetinula ampelophila (Speg.) Nag Raj

Ascomycota genera incertae sedis

E

 

Argentina

Nag Raj (1993)

M. terminaliae (Bat. & J.L. Bezerra) Muthumary, Abbas & B. Sutton

Ascomycota genera incertae sedis

E

 

India

Muthumary et al. (1986)

Monodictys antiqua (Corda) S. Hughes

Dothideomycetes genera incertae sedis

S

 

Portugal

de Sousa Dias and Lucas (1972)

Mortierella hyalina (Harz) W. Gams*

Mortierellaceae

S

 

Switzerland

Casieri et al. (2009)

Mortierella sp.*

Mortierellaceae

E, S

 

China

Dissanayake et al. (2018), This study

Mucor circinelloides Tiegh.*

Mucoraceae

S

 

China, Switzerland

Casieri et al. (2009), This study, Jayawardena et al. (2018)

M. hiemalis Wehmer*

Mucoraceae

E, S

 

Spain, Switzerland

Casieri et al. (2009), Gonzalez and Tello (2011)

M. moelleri (Vuill.) Lendn.*

Mucoraceae

S

 

Switzerland

Casieri et al. (2009)

M. plumbeus Bonord.*

Mucoraceae

S

 

Switzerland

Casieri et al. (2009)

M. racemosus Fresen.*

Mucoraceae

E, S

 

China, Spain, Switzerland

Casieri et al. (2009), Gonzalez and Tello (2011), This study, Jayawardena et al. (2018)

Mucor sp.

Mucoraceae

E

 

Greece, Spain, USA

Pantidou (1973), Shaw (1973), Gonzalez and Tello (2011)

Mycosphaerella cuboniana (D. Sacc.) Tomilin

Mycosphaerellaceae

P

Leaf spot

Greece

Pantidou (1973)

M. graminicola (Fuckel) J. Schröt*

Mycosphaerellaceae

E

 

China

Dissanayake et al. (2018)

M. manganottiana (C. Massal.) Tomilin

Mycosphaerellaceae

P

Leaf spot

Greece

Pantidou (1973)

M. vitis (Fuckel) J. Schröt.

Mycosphaerellaceae

P

Leaf spot

Japan, Poland, Russia

Watson (1971), Kobayashi (2007), Mulenko et al. (2008)

Mycosphaerella sp.*

Mycosphaerellaceae

E

 

China, USA, Venezuela

Stevenson and Wellman (1944), Dissanayake et al. (2018)

Myrothecium sp.*

Stachybotryaceae

P, S

Leaf spot

China, USA

Alfieri Jr. et al. (1984), This study

Myxosporium viticola Dearn. & House

Ascomycota genera incertae sedis

S

 

USA

Anonymous (1960)

Nectria cinnabarina (Tode) Fr.

Nectriaceae

S

 

USA

Seifert (1985), Anonymous (1960), Shaw (1973)

N. ramulariae (Wollenw.) E. Müll.*

Nectriaceae

P, E

 

Spain, Switzerland

Casieri et al. (2009), Gonzalez and Tello (2011)

Nectria sp.

Nectriaceae

S

 

Korea, Mexico

Alvarez (1976), Cho and Shin (2004)

Nemania serpens (Pers.) Gray

Xylariaceae

E

 

Spain

Gonzalez and Tello (2011)

Neoanthostomella viticola Daranagama, Camporesi & K. D. Hyde*

Xylariaceae

S

 

Italy

Daranagama et al. (2016), This study, Jayawardena et al. (2018)

Neofusicoccum algeriense Berraf-Tebbal & A.J.L. Phillips*

Botryosphaeriaceae

P

Canker, die back

Algeria

Berraf-Tebbal et al. (2014), Nogueira et al. (2016)

N. australe (Slippers, Crous & M.J. Wingf.) Crous, Slippers & A.J.L. Phillips*

Botryosphaeriaceae

P

Canker, die back

Algeria, Australia, Chile, Italy, Mexico, New Zealand, South Africa, Spain, Uruguay, USA

van Niekerk et al. (2004a, b, 2006), Luque et al. (2005), Phillips et al. (2005), Taylor et al. (2005), Úrbez-Torres et al. (2006), Cunnington et al. (2007), Baskarathevan et al. (2008), Úrbez-Torres (2011), Martin et al. (2011b), Sessa et al. (2016)

N. cordaticola Pavlic, Slippers & M.J. Wingf.*

Botryosphaeriaceae

P

Canker, die back

Italy

Sakalidis et al. (2013)

N.italicum Dissan. & K.D. Hyde*

Botryosphaeriaceae

S

 

Italy

Marin-Felix et al. (2017)

N. kwambonambiense Pavlic, Slippers & M.J. Wingf.*

Botryosphaeriaceae

P

Canker, die back

Uruguay

Sessa et al. (2016)

N. luteum (Pennycook & Samuels) Crous, Slippers & A.J.L. Phillips*

Botryosphaeriaceae

P

Botryosphaeria die back

Australia, Germany, Italy, New Zealand, Portugal, South Africa, Spain, Tunisia, Uruguay, USA

Pennycook (1989), van Niekerk et al. (2004a, b), Luque et al. (2005, 2009), Úrbez-Torres et al. (2007), Baskarathevan et al. (2008), Abreo et al. (2012), Fischer et al. (2016)

N. macroclavatum (T.I. Burgess, Barber & G.E. Hardy) T.I. Burgess, Barber & G.E. Hardy

Botryosphaeriaceae

P

Canker, die back

New Zealand

Billones et al. (2010), Úrbez-Torres (2011)

N. mangiferae (Syd. & P. Syd.) Crous, Slippers & A.J.L. Phillips*

Botryosphaeriaceae

P

Canker, die back

China

Dissanayake et al. (2015)

N. mediterraneum Crous, M.J. Wingf. & A.J.L. Phillips*

Botryosphaeriaceae

P

Canker, die back

Algeria, Spain, USA

Úrbez-Torres et al. (2010a, b, c), Berraf-Tebbal et al. (2014)

N. occulatum Sakalidis & T.I. Burgess*

Botryosphaeriaceae

P

Canker, die back

Australia

Sakalidis et al. (2013)

N. parvum (Pennycook & Samuels) Crous, Slippers & A.J.L. Phillips*

Botryosphaeriaceae

P, E, S

Botryosphaeria die back

Australia, Italy, Brazil, Canada, Chile, China, France, New Zealand, Portugal, South Africa, Spain, Switzerland, Uruguay, USA

Phillips et al. (2002, 2005), van Niekerk et al. (2004a, b, 2006), Luque et al. (2005, 2009), Úrbez-Torres et al. (2006), Cunnington et al. (2007), Baskarathevan et al. (2008), Casieri et al. (2009), Gonzalez and Tello (2011), Abreo et al. (2012), Correia et al. (2013), Mondello et al. (2013), Sakalidis et al. (2013), Wu et al. (2015), This study, Jayawardena et al. (2018)

N. ribis (Slippers, Crous & M.J. Wingf.) Crous, Slippers & A.J.L. Phillips

Botryosphaeriaceae

P

Botryosphaeria die back, Macrophoma rot

Australia, Italy, South Africa, Tanzania, Pakistan, Portugal, USA

Anonymous (1960), Ebbels and Allen (1979), Milholland (1994), Ahmad et al. (1997), Phillips (2000), Halleen et al. (2003), van Niekerk et al. (2006)

N. stellenboschiana Tao Yang & Crous*

Botryosphaeriaceae

P

Canker, die back

South Africa

Yang et al. (2017)

N. viticlavatum (Van Niekerk & Crous) Crous, Slippers & A.J.L. Phillips

Botryosphaeriaceae

P

Canker, die back

South Africa

Burgess et al. (2005), Farr et al. (2005), Luque et al. (2005), Phillips et al. (2005), van Niekerk et al. (2006)

N. vitifusiforme (Van Niekerk & Crous) Crous, Slippers & A.J.L. Phillips

Botryosphaeriaceae

P

Botryosphaeria die back

Italy, Mexico, South Africa, Spain, USA

van Niekerk et al. (2004a, b), Burgess et al. (2005), Luque et al. (2009), Candolfi-Arballo et al. (2010), Úrbez-Torres (2011), Mondello et al. (2013)

Neomassaria fabacearum Mapook, Camporesi & K.D. Hyde*

Massariaceae

S

 

Italy

This study, Jayawardena et al. (2018)

Neonectria candida (Ehrenb.) Rossman, L. Lombard & Crous*

Nectriaceae

S

 

Spain, Switzerland

Casieri et al. (2009), Gonzalez and Tello (2011)

N. coccinea (Pers.) Rossman & Samuels

Nectriaceae

S

 

USA

Anonymous (1960)

N. fuckeliana (C. Booth) Castl. & Rossman*

Nectriaceae

P, E

 

Canada, Spain, Switzerland

Casieri et al. (2009), Gonzalez and Tello (2011), Petit et al. (2011)

N. macrodidyma Halleen, Schroers & Crous*

Nectriaceae

S

 

Switzerland

Casieri et al. (2009)

N. microconidia J. Luo, P. Zhao & W.Y. Zhuang*

Nectriaceae

S

 

Japan

Hirooka et al. (2013)

N. obtusispora (Cooke & Harkn.) Rossman, L. Lombard & Crous

Nectriaceae

P

Black-foot disease

Italy, USA

Scheck et al. (1998a, b), Greuter et al. (1991)

Neopestalotiopsis asiatica (Maharachch. & K.D. Hyde) Maharachch., K.D. Hyde & Crous*

Sporocadaceae

P

Leaf stripe

France

Maharachchikumbura et al. (2016)

N. clavispora (G.F. Atk.) Maharachch., K.D. Hyde & Crous*

Sporocadaceae

S

 

China

This study, Jayawardena et al. (2018)

N. javaensis Maharachch., K.D. Hyde & Crous*

Sporocadaceae

E

 

France

Maharachchikumbura et al. (2016)

N. vitis Jayawardena, Maharachch., Yan, Li & Hyde*

Sporocadaceae

P, S

Fruit rot, trunck disease, leaf spot

China

Jayawardena et al. (2016a, b)

Neopestalotiopsis sp.*

Sporocadaceae

P

Leaf spot

China, France, India

Jayawardena et al. (2015), Maharachchikumbura et al. (2014, 2016)

Neoplaconema sp.*

Ascomycota genera incertae sedis

P

 

Switzerland

Casieri et al. (2009)

Neoscytalidium dimidiatum (Penz.) Crous & Slippers*

Botryosphaeriaceae

P

Wood canker, die back

Brazil, India, Iraq, USA,

Wangikar et al. (1969), Sarbhoy et al. (1971), Mathur (1979), Al-Saadoon et al. (2012), Rolshausen et al. (2013), Correia et al. (2016a)

Neurospora sp.*

Sordariaceae

S

 

China

This study

Nigrospora oryzae (Berk. & Broome) Petch*

Sordariomycetes genera incertae sedis

E

 

China, Spain

Gonzalez and Tello (2011), Dissanayake et al. (2018)

N. sphaerica (Sacc.) E.W. Mason*

Sordariomycetes genera incertae sedis

E

 

China

Dissanayake et al. (2018)

Nodulisporium sp.

Xylariaceae

E

 

Spain

Gonzalez and Tello (2011)

Oidiodendron sp.*

Myxotrichaceae

E

 

China

Dissanayake et al. (2018)

Ophiocordyceps sp.*

Ophiocordycipitaceae

S

 

China

This study

Ophiostoma piceae (Münch) Syd. & P. Syd.*

Ophiostomataceae

E

 

Spain, Switzerland

Casieri et al. (2009), Gonzalez and Tello (2011)

O. quercus (Georgev.) Nannf.*

Ophiostomataceae

E

 

Switzerland

Casieri et al. (2009)

O. subalpinum Ohtaka & Masuya*

Ophiostomataceae

E

 

Switzerland

Casieri et al. (2009)

Ophiostoma sp.*

Ophiostomataceae

E

 

Switzerland

Casieri et al. (2009)

Ostreichnion curtisii (Duby) M.L. Lohman

Hysteriaceae

S

 

USA

Hanlin (1963)

Ostreola viticola R. Rao & Modak

Mytilinidiaceae

S

 

India

Pande (2008)

Paecilomyces sp.

Thermoascaceae

P

Root stock

South Africa

Halleen et al. (2003)

Papiliotrema laurentii (Kuff.) X.Z. Liu, F.Y. Bai, M. Groenew. & Boekhout

Tremellaceae

P

Melting decay

USA

Morgan and Michailides (2004)

Papulospora sp.*

Sordariomycetes genera incertae sedis

S

 

China

This study

Pareutypella sulcata Y.M. Ju & J.D. Rogers

Sordariomycetes genera incertae sedis

S

 

Taiwan

Ju and Rogers (1995)

Passalora dissiliens (Duby) U. Braun & Crous

Mycosphaerellaceae

P

Leaf spot

Australia, Bulgaria, China, Egypt, France, Iran, India. Israel, Japan, South Africa, Pakistan, Palestine, Poland, Portugal, Yemen

Crous and Braun (2003), Guo and Liu (2003), Zhuang (2005), Kobayashi (2007), Bobev (2009), Mouchacca (2009)

P. fulva (Cooke) U. Braun & Crous*

Mycosphaerellaceae

P

Leaf spot

Switzerland

Casieri et al. (2009)

P. heterosporella U. Braun & Crous

Mycosphaerellaceae

P

Leaf spot

Israel, USA

Crous and Braun (2003)

P. vitis (M.S. Patil & Sawant) Poonam Srivast.

Mycosphaerellaceae

P

Leaf spot

India

Crous and Braun (2003), Kamal (2010)

P. vitis-piadezkii U. Braun & Crous

Mycosphaerellaceae

P

Leaf spot

China

Crous and Braun (2003), Guo and Liu (2003)

P. vitis-ripariae (U. Braun) U. Braun & Crous

Mycosphaerellaceae

P

Leaf spot

USA

Crous and Braun (2003)

Patellaria atrata (Hedw.) Fr.

Patellariaceae

S

 

Central Asia

Koshkelova and Frolov (1973)

P. lantanae R. Rao

Patellariaceae

S

 

India

Pande (2008)

P. viticola Pers.

Patellariaceae

S

 

Spain

Unamuno (1941)

Paraphoma chrysanthemicola (Hollós) Gruyter, Aveskamp & Verkley*

Phaeosphaeriaceae

S

 

China

This study, Jayawardena et al. (2018)

Penicillium adametzioides S. Abe

Aspergillaceae

E, S

 

Japan

Kobayashi (2007)

P. astrolabium R. Serra & S.W. Peterson*

Aspergillaceae

S

 

Portugal

Serra and Peterson (2007)

P. aurantiogriseum Dierckx

Aspergillaceae

P

Fruit rot

South Africa

Gorter (1977)

P. brevicompactum Dierckx*

Aspergillaceae

S

 

China

This study, Jayawardena et al. (2018)

P. chrysogenum Thom*

Aspergillaceae

S

 

China

This study

P. citrinum Thom*

Aspergillaceae

S

 

China

This study, Jayawardena et al. (2018)

P. digitatum (Pers.) Sacc.*

Aspergillaceae

E

 

China

Dissanayake et al. (2018)

P. elongatum Dierckx

Aspergillaceae

P

Fruit rot

South Africa

Gorter (1977)

P. expansum Link

Aspergillaceae

P

Fruit rot

Bulgaria, South Africa, USA

Gorter (1977), Bobev (2009)

P. funiculosum Thom

Aspergillaceae

S

 

Cyprus

Georghiou and Papadopoulos (1957)

P. italicum Wehmer

Aspergillaceae

P

Fruit rot

Greece

Pantidou (1973)

P. neocrassum R. Serra & S.W. Peterson*

Aspergillaceae

S

 

Portugal

Serra and Peterson (2007)

P. olsonii Bainier & Sartory*

Aspergillaceae

E

 

Portugal

Serra and Peterson (2007)

P. rolfsii Thom

Aspergillaceae

E

 

USA

Shaw (1973)

P. sclerotigenum W. Yamam.

Aspergillaceae

S

 

Japan

Kobayashi (2007)

P. sumatraense Svilv.*

Aspergillaceae

P

 

Iran

Mahdian and Zafari (2017)

P. terrigenum Houbraken, Frisvad & Samson*

Aspergillaceae

S

 

China

This study, Jayawardena et al. (2018)

P. toxicarium I. Miyake*

Aspergillaceae

P, E

Fruit rot

Spain

Garcia-Benavides et al. (2013)

P. variabile Sopp

Aspergillaceae

S

 

USA

Shaw (1973)

Penicillium sp.*

Aspergillaceae

P, E, S

Fruit rot

Australia, Chile, China, Cuba, France, Italy, Japan, Korea, South Africa, Spain, Switzerland, USA

French (1989), Castillo-Pando et al. (2001), Fourie and Halleen (2002), Casieri et al. (2009), Gonzalez and Tello (2011), Mondello et al. (2013), Oh et al. (2014), Dissanayake et al. (2018), This study

Peniophora albomarginata (Schwein.) Massee

Peniophoraceae

S

 

USA

Hanlin (1966)

P. viticola (Schwein.) Höhn. & Litsch.

Peniophoraceae

S

 

USA

Hanlin (1966)

Peniophora sp.*

Peniophoraceae

S

 

China

This study, Jayawardena et al. (2018)

Penzigomyces dissolvens (Hol.-Jech., Mercado & J. Mena) J. Mena*

Ascomycota genera incertae sedis

S

 

Cuba

Mena-Portales et al. (2000)

Perenniporia tenuis (Schwein.) Ryvarden

Polyporaceae

S

 

Greece

Kotlaba (1997), Zervakis et al. (1998)

P. unita (Pers.) Murrill

Polyporaceae

S

 

USA

Hanlin (1966)

Periconia byssoides Pers.

Periconiaceae

E

 

Argentina, USA

Grand (1985), Carmaran and Novas (2003)

P. igniaria E.W. Mason & M.B. Ellis

Periconiaceae

E

 

Spain

Gonzalez and Tello (2011)

Pestalotiopsis biciliata Maharachch., K.D. Hyde & Crous*

Sporocadaceae

P

Leaf stripe, defoliated shoots

France

Maharachchikumbura et al. (2016)

P. chamaeropis Maharachch., K.D. Hyde & Crous*

Sporocadaceae

S

 

Italy

This study, Jayawardena et al. (2018)

P. funerea (Desm.) Steyaert

Sporocadaceae

P

Leaf spot

Japan

Kobayashi (2007)

P. mangiferae (Henn.) Steyaert

Sporocadaceae

P

Leaf spot

Myanmar

Thaung (2008c)

P. menezesiana (Bres. & Torrend) Bissett*

Sporocadaceae

P

Fruit rot

Australia, China, Greece, India, Japan, Madeira Islands, USA

Mundkur and Thirumalachar (1946), Alfieri Jr. et al. (1984, Nag Raj (1993), Sergeeva et al. (2005)

P. quadriciliata (Bubák & Dearn.) Bissett

Sporocadaceae

P

Leaf spot

Canada

Nag Raj (1993)

P. trachicarpicola Y.M. Zhang & K.D. Hyde*

Sporocadaceae

P

Fruit rot, trunck disease

China

Jayawardena et al. (2015)

P. uvicola (Speg.) Bissett*

Sporocadaceae

P

Fruit rot

Australia, China, India, Italy, Japan, Korea, USA

Simmonds (1966), Tai (1979), Nag Raj (1988, 1993), Cho and Shin (2004), Sergeeva et al. (2005), Kobayashi (2007), Ge et al. (2009), Maharachchikumbura et al. (2011), Úrbez-Torres et al. (2012)

Pestalotiopsis sp.*

Sporocadaceae

P, E, S

Fruit rot

Australia, Cuba, Italy, Japan, Korea, South Africa, USA

Urtiaga (1986), Halleen et al. (2003), Castillo-Pando et al. (2001), Úrbez-Torres et al. (2012), This study

Phaeoacremonium aleophilum W. Gams, Crous, M.J. Wingf. & Mugnai*

Togniniaceae

P, E

Esca

Algeria, Argentina, Austria, Australia, France, Italy, Iran, Serbia, South Africa, Spain, Turkey, Uruguay, USA, Yugoslavia

Larignon and Dubos (1997), Pascoe and Cottral (2000), Gatica et al. (2001), Lardner et al. (2005), Whiting et al. (2005), Mostert et al. (2006), Sosnowski et al. (2007), Luque et al. (2009), Berraf-Tebbal et al. (2011), Gonzalez and Tello (2011), Abreo et al. (2012), Mohammadi and Banihashemi (2012), Garcia-Benavides et al. (2013), Mohammadi et al. (2013a), Úrbez-Torres et al. (2013a, b)

P. alvesii L. Mostert, Summerb. & Crous*

Togniniaceae

P

Esca

South Africa, Turkey

Essakhi et al. (2008), White et al. (2011)

P. amstelodamense L. Mostert, Summerb. & Crous

Togniniaceae

P

Esca

Netherland

Arzanlou et al. (2014)

P. angustius W. Gams, Crous & M.J. Wingf.

Togniniaceae

P

Esca

France, Portugal, USA

Chicau et al. (2000), Whiting et al. (2005)

P. argentinense L. Mostert, W. Gams & Crous*

Togniniaceae

P

Esca

Argentina

Arzanlou et al. (2014)

P. armeniacum A.B. Graham, P.R. Johnst. & B. Weir*

Togniniaceae

P

Esca

New Zealand

Graham et al. (2009), Arzanlou et al. (2014), Úrbez-Torres et al. (2014)

P. australiense L. Mostert, Summerb. & Crous*

Togniniaceae

P

Esca

Australia, Uruguay

Mostert et al. (2006), Graham et al. (2009), Abreo et al. (2012), Arzanlou et al. (2014), Úrbez-Torres et al. (2014)

P. austroafricanum L. Mostert, W. Gams & Crous*

Togniniaceae

P

Esca

South Africa

Berraf-Tebbal et al. (2011), Úrbez-Torres et al. (2014)

P. canadense J.R. Úrbez-Torres, P. Haag & D.T. O’Gorman*

Togniniaceae

P

Esca

Canada

Úrbez-Torres et al. (2014)

P. chlamydospora (W. Gams, Crous, M.J. Wingf. & Mugnai) Crous & W. Gams*

Togniniaceae

P

Esca

Australia, Chile, France, Italy, Portugal, South Africa, USA

Larignon and Dubos (1997), Dupont et al. (1998), Scheck et al. (1998b), Chicau et al. (2000), Pascoe and Cottral (2000), Auger et al. (2004b), Lardner et al. (2005), Santos et al. (2006)

P. cinereum Gramaje, Mohammadi, Banihashemi, Armengol & L. Mostert*

Togniniaceae

P

Esca

Iran

Gramaje et al. (2009), Mohammadi and Banihashemi (2012), Mohammadi et al. (2013a), Úrbez-Torres et al. (2014), Sami et al. (2014)

P. fraxinopennsylvanicum (T.E. Hinds) D. Gramaje, L. Mostert & Crous*

Togniniaceae

P

Esca

Canada, Croatia, Germany, Hungary, Iran, South Africa, Spain, USA

Eskalen et al. (2005), Fischer et al. (2016)

P. globosum A.B. Graham, P.R. Johnst. & B. Weir*

Togniniaceae

P

Esca

New Zealand

Graham et al. (2009), Arzanlou et al. (2014), Úrbez-Torres et al. (2014)

P. griseorubrum L. Mostert, Summerb. & Crous*

Togniniaceae

P

Esca

Italy

Essakhi et al. (2008), Gramaje et al. (2009), Berraf-Tebbal et al. (2011)

P. hispanicum Gramaje, Armengol & L. Mostert*

Togniniaceae

P

Esca

Algeria, Iran, Spain

Martin et al. (2011a), Úrbez-Torres et al. (2014)

P. hungaricum Essakhi, Mugnai, Surico & Crous*

Togniniaceae

P

Esca

Hungary

Essakhi et al. (2008), Berraf-Tebbal et al. (2011), Arzanlou et al. (2014), Úrbez-Torres et al. (2014),

P. inflatipes W. Gams, Crous & M.J. Wingf.*

Togniniaceae

P, E

Esca

Chile, Iran, Italy, Spain, USA,

Scheck et al. (1998a, b), Mugnai et al. (1999), Whiting et al. (2005), Mostert et al. (2006), Gonzalez and Tello (2011), Mohammadi and Banihashemi (2012)

P. iranianum L. Mostert, Gräfenhan, W. Gams & Crous*

Togniniaceae

P

Esca

Canada, Iran, Italy, South Africa, Spain

Mostert et al. (2006), Essakhi et al. (2008), Gramaje et al. (2009), White et al. (2011), Mohammadi et al. (2013a), Sami et al. (2014), Úrbez-Torres et al. (2014)

P. italicum A. Carlucci & M.L. Raimondo*

Togniniaceae

P

Esca

Italy

Raimondo et al. (2014)

P. krajdenii L. Mostert, Summerb. & Crous*

Togniniaceae

P

Esca

Canada, Europe, South Africa, Spain

Mostert et al. (2006), Gramaje et al. (2011), Úrbez-Torres et al. (2014)

P. minimum (Tul. & C. Tul.) D. Gramaje, L. Mostert & Crous*

Togniniaceae

P

Esca

Argentina, Austria, Australia, Brazil, Canada, Chile, France, Germany, Greece, Hungary, Iran, Israel, Italy, Mexico, South Africa, Uruguay, USA, Yugoslavia

Mostert et al. (2006), Úrbez-Torres et al. (2012, 2014), Baloyi et al. (2013), Whitelaw-Weckert et al. (2013)

P. mortoniae Crous & W. Gams*

Togniniaceae

P

Esca

Iran, New Zealand

Whiting et al. (2005), Mohammadi and Banihashemi (2012)

P. occidentale A.B. Graham, P.R. Johnst. & B. Weir*

Togniniaceae

P

Esca

New Zealand

Graham et al. (2009), Arzanlou et al. (2014), Úrbez-Torres et al. (2014)

P. parasiticum (Ajello, Georg & C.J.K. Wang) W. Gams, Crous & M.J. Wingf.*

Togniniaceae

P

Esca

Algeria, Argentina, Australia, Brazil, Chile, Iran, Peru, South Africa

Gatica et al. (2001), Dupont et al. (2002), Berraf-Tebbal et al. (2011)

P. roseum (J.R.) Úrb.-Torr., P. Haag & O’Gorman*

Togniniaceae

P

Esca

Canada

da Silva et al. (2017)

P. rubrigenum W. Gams, Crous & M.J. Wingf.*

Togniniaceae

P

Esca

Argentina, Chile, Croatia, France, Iran, New Zealand, South Africa, USA

Dupont et al. (2000), Kubatova et al. (2004), Essakhi et al. (2008), Sami et al. (2014)

P. scolyti L. Mostert, Summerb. & Crous*

Togniniaceae

P

Esca

France, Italy, South Africa, Spain, Turkey

Essakhi et al. (2008), Gramaje et al. (2008), Ozben et al. (2012), Úrbez-Torres et al. (2014)

P. sicilianum Essakhi, Mugnai, Surico & Crous*

Togniniaceae

P

Esca

Italy, South Africa, Spain

Essakhi et al. (2008), White et al. (2011), Arzanlou et al. (2014), Úrbez-Torres et al. (2014), Gramaje et al. (2009)

P. subulatum L. Mostert, Summerb. & Crous*

Togniniaceae

P

Esca

South Africa

Mostert et al. (2006), Berraf-Tebbal et al. (2011)

P. tuscanicum Essakhi, Mugnai, Surico & Crous*

Togniniaceae

P

Esca

Spain

Garcia-Benavides et al. (2013)

P. venezuelense L. Mostert, Summerb. & Crous*

Togniniaceae

P

Esca

Algeria, South Africa

Mostert et al. (2006), Berraf-Tebbal et al. (2011)

P. viticola J. Dupont*

Togniniaceae

P

Esca

France, Germany, Spain

Luque et al. (2009), Úrbez-Torres et al. (2014), Fischer et al. (2016)

Phaeoacremonium sp.*

Togniniaceae

P, S

Esca

Argentina, China, Iran, South Africa, Spain

Gatica et al. (2001), Fourie and Halleen (2002), Halleen et al. (2003), Gramaje et al. (2009), White et al. (2011), Mohammadi and Banihashemi (2012), This study

Phaeomoniella chlamydospora (W. Gams, Crous, M.J. Wingf. & Mugnai) Crous & W. Gams*

Phaeomoniellaceae

P, E

Esca

Argentina, Australia, Brazil, Bulgaria, Chile, Europe, France, Iran, Italy, New Zealand, Slovakia, South Africa, Spain, Switzerland, Turkey, Uruguay, USA

Larignon and Dubos (1997), Crous and Gams (2000), Karimi et al. (2001), Cunnington (2003), Halleen et al. (2003), Whiting et al. (2005), Kakalikova et al. (2009), Bobev (2009), Casieri et al. (2009), Luque et al. (2009), Smetham et al. (2010), Gonzalez and Tello (2011), Correia et al. (2013), Garcia-Benavides et al. (2013), Mohammadi et al. (2013a), Diaz and Latorre (2014), Akgul et al. (2015)

Phaeotrichoconis crotalariae (M.A. Salam & P.N. Rao) Subram.*

Ascomycota genera incertae sedis

E

 

Brazil

Bezerra and De Lima (2012)

Phakopsora ampelopsidis Dietel & P. Syd.

Phakopsoraceae

P

Rust

Hong Kong, Korea, India, Taiwan, Thailand

Mundkur (1943), Sawada (1943), Lu et al. (2000), Cho and Shin (2004), Lorsuwan et al. (1984)

P. cronartiiformis Dietel

Phakopsoraceae

P

Rust

India

Mundkur (1943), Padwick (1946), Watson (1971), Sarbhoy and Agarwal (1990)

P. euvitis Y. Ono

Phakopsoraceae

P

Rust

Bangladesh, Brazil, China, Indonesia, Jamaica, Japan, Malaysia, North Korea, Philipines, Thailand, Thaiwan, USA

Teodoro (1937), Giatgong (1980), Ono (2000), Chatasiri and Ono (2008)

P. meliosmae-myrianthae (Henn. & Shirai) Y. Ono*

Phakopsoraceae

P

Rust

Japan, Thaiwan

Pota et al. (2015), Ono (2016)

P. montana Y. Ono & Chatasiri*

Phakopsoraceae

P

Rust

Japan

Pota et al. (2015), Ono (2016)

P. uva Buriticá & J.F. Hennen*

Phakopsoraceae

P

Rust

Colombia, Costa rica, Cuba, Guatemala, Mexico, USA, Venezuela

Buritica and Pardo Cardona (1996), Pardo Cardona (1998), Buritica (1999), Salazar-Yepes et al. (2002)

P. vitis P. Syd.

Phakopsoraceae

P

Rust

Colombia, Costa Rica, Dominican Republic, Ecuador, Guatemala, Indonesia, Japan, Russia, Taiwan, Trinidad and Tobago, USA, Venezuela

Arthur (1918), Chardon and toro (1930), Jackson (1931), Kern et al. (1934), Baker and Dale (1951), Berndt (2004)

Phakopsora sp.

Phakopsoraceae

P

Rust

Costa rica

Berndt (2004)

Phanerochaete viticola (Schwein.) Parmasto

Phanerochaetaceae

E

Rust

USA

Burdsall (1985)

Phellinidium noxium (Corner) Bondartseva & S. Herrera

Hymenochaetaceae

P

Esca

Taiwan

Ann et al. (2002)

Phellinus igniarius (L.) Quél.

Hymenochaetaceae

P

Esca

Bulgaria

Bobev (2009)

P. resupinatus M. Fisch., M. Cloete, L. Mostert & F. Halleen*

Hymenochaetaceae

P

Esca

Nambia, South Africa

Cloete et al. (2016)

Phellinus sp.*

Hymenochaetaceae

P

Esca

Argentina, Australia, South Africa, USA

Gatica et al. (2001), Lardner et al. (2005), Sosnowski et al. (2007), White et al. (2011)

Phialophora sp.

Herpotrichiellaceae

E

 

Spain

Gonzalez and Tello (2011)

Phialosimplex sp.*

Trichocomaceae

E, S

 

China

Dissanayake et al. (2018), This study

Phoma confluens Welw. & Curr.

Didymellaceae

OP

Leaves and stem lesions

Central Asia

Koshkelova and Frolov (1973)

P. herbarum Westend.*

Didymellaceae

OP

Leaves and stem lesions

China

Dissanayake et al. (2018)

P. lenticularia Cavara

Didymellaceae

S

 

Italy

Cavara (1888)

P. medicaginis Malbr. & Roum.*

Didymellaceae

S

 

China

This study, Jayawardena et al. (2018)

P. reniformis Viala & Ravaz

Didymellaceae

OP

Leaves and stem lesions

China, Portugal

Phillips and Lucas (1997), Zhuang (2005)

P. vitis Bonord.

Didymellaceae

OP

Leaves and stem lesions

Australia, Greece, India, Italy, USA,

Pantidou (1973), Mathur (1979), French (1989), Shivas (1989), Greuter et al. (1991)

Phoma sp.*

Didymellaceae

P, E, S

Leaves and stem lesions

China, Italy, Spain, Switzerland

Casieri et al. (2009), Gonzalez and Tello (2011), Mondello et al. (2013), Dissanayake et al. (2018), This study

Phyllosticta ampelicida (Engelm.) Aa*

Phyllostictaceae

P, S

Black rot

All over the world

Larter and Martyn (1943), Mujica and Oehrens (1967), Alvarez (1976), Mendes et al. (1998), Dudka et al. (2004), Kobayashi (2007), Slippers et al. (2007a, b), Goos (2010), Wicht et al. (2012)

P. ampelophila Politis

Phyllostictaceae

P

Black rot

Greece

Pantidou (1973)

P. badamii (Cooke)

Phyllostictaceae

P

Black rot

UK, Ukraine

Watson (1971), Dudka et al. (2004)

P. microspila Pass.

Phyllostictaceae

P

Black rot

Italy

Watson (1971)

P. muscadinii (Luttr.) Wulandari

Phyllostictaceae

P

Black rot

USA

Hanlin (1963), Alfieri Jr. et al. (1984, Kummuang et al. (1996)

P. pilispora Speschnew

Phyllostictaceae

P

Black rot

China, Japan, Ukraine, Uzbekistan

Gaponenko (1965), Tai (1979), Kobayashi (2007), Dudka et al. (2004)

P. spermoides Peck

Phyllostictaceae

P

Black rot

China, USA

Anonymous (1960), French (1987, 1989), Bai (2000)

P. turmalis Ellis & Everh.

Phyllostictaceae

P

Black rot

USA

Cash (1953)

P. vitis-rotundifoliae N. Zhou & L. Cai*

Phyllostictaceae

P

Black rot

USA

Zhou et al. (2015)

Phytophthora cactorum (Lebert & Cohn) J. Schröt.

Peronosporaceae

P

Root rot

South Africaa

Oudemans and Coffey (1991), Erwin and Ribeiro (1996)

P. cambivora (Petri) Buisman

Peronosporaceae

P

Root rot

South Africa

Oudemans and Coffey (1991)

P. cinnamomi Rands*

Peronosporaceae

P

Root rot

Australia, New Zealand, South Africa

Gorter (1977), Marais (1980), Pennycook (1989), Shivas (1989), Oudemans and Coffey (1991), Erwin and Ribeiro (1996), Gadgil (2005), Blair et al. (2008), Langrell et al. (2011)

P. citricola Sawada

Peronosporaceae

P

Root rot

New Zealand

Pennycook (1989), Erwin and Ribeiro (1996), Gadgil (2005)

P. cryptogea Pethybr. & Laff.*

Peronosporaceae

P

Root rot

South Africa

Mills et al. (1991), Erwin and Ribeiro (1996), Martin et al. (2014)

P. drechsleri Tucker

Peronosporaceae

P

Root rot

Korea

Cho and Shin (2004)

P. megasperma Drechsler

Peronosporaceae

P

Root rot

Australia, USA

Shivas (1989), Forster and Coffey (1993)

P. nicotianae Breda de Haan

Peronosporaceae

P

Root rot

India, South Africa

Erwin and Ribeiro (1996)

P. niederhauseri Z.G. Abad & J.A. Abad*

Peronosporaceae

P

Root rot

South Africa

Abad et al. (2014)

Phytophthora sp.*

Peronosporaceae

P

Root rot

Australia, Chili, Mexico, USA

Mujica and Oehrens (1967), Alvarez (1976), French (1989), Castillo-Pando et al. (2001), Brasier et al. (2003)

Pilidium concavum (Desm.) Höhn.

Chaetomellaceae

P

Excoriose and cane blight

Portugal

Phillips (2000)

P. lythri (Desm.) Rossman

Chaetomellaceae

P

Excoriose and cane blight

USA

Greene (1963)

Pionnotes biasolettiana (Corda) Sacc.

Nectriaceae

E

 

Japan

Kobayashi (2007)

Plagiostoma devexum (Desm.) Fuckel*

Gnomoniaceae

E

 

Europe, USA

Sogonov et al. (2008)

Plasmopara viticola (Berk. & M.A. Curtis) Berl. & De Toni

Peronosporaceae

P

Downey mildew

All over the world

Doidge (1950), Riley (1960), Whiteside (1966), Dennis (1970), Stevenson (1975), Gorter (1977), Giatgong (1980), Simonyan (1981), Mendes et al. (1998), McKirdy et al. (1999), Dudka et al. (2004), Voglmayr et al. (2004), Gadgil (2005), Garcia-Blazquez et al. (2006), Mulenko et al. (2008), Thaung (2008b), Bobev (2009)

Pleospora herbarum (Pers.) Rabenh.

Pleosporaceae

E

 

Chile, Libya, Pakistan

Mujica and Oehrens (1967), El-Buni and Rattan (1981), Ahmad et al. (1997)

P. penicillus Fuckel

Pleosporaceae

S

 

Portugal, Spain

Checa (2004)

P. phaeocomoides (Sacc.) G. Winter

Pleosporaceae

S

 

USA

Hanlin (1963)

P. vitis Catt.

Pleosporaceae

E

 

Central Asia, Greece, Italy, Spain

Unamuno (1941), Koshkelova and Frolov (1973), Pantidou (1973), Shoemaker (1992)

P. vitis-viniferae Frolov

Pleosporaceae

E

 

Central Asia, Russia

Koshkelova and Frolov (1973), Shoemaker (1992)

P. vulgaris Niessl

Pleosporaceae

E

 

Central Asia

Koshkelova and Frolov (1973)

Pleospora sp.

Pleosporaceae

E

 

Portugal

Phillips (2000)

Pleurophoma sp.

Lentitheciaceae

P

Excoriose and cane blight

Portugal

Phillips (2000)

Pleurostoma richardsiae (Nannfeldt) Réblová & Jaklitsch*

Pleurostomataceae

P

Trunk disease

Italy, South Africa, Spain

White et al. (2011), Carlucci et al. (2015), Pintos Varela et al. (2016)

Pleurotus ostreatus (Jacq.) P. Kumm.

Pleurotaceae

P

Wood rot

USA

Vail et al. (1995)

Preussia africana Arenal, Platas & Peláez*

Sporormiaceae

S

 

Spain

Garcia-Benavides et al. (2013)

P. intermedia (Auersw.) S. Ahmad

Sporormiaceae

E

 

Spain

Gonzalez and Tello (2011)

Pseudallescheria sp.*

Microascaceae

S

 

China

This study

Pseudocamarosporium propinquum (Sacc.) Wijayaw., Camporesi & K.D. Hyde*

Didymospharaceae

S

 

Italy

This study, Jayawardena et al. (2018)

P. brachypus (Ellis & Everh.) X.J. Liu & Y.L. Guo

Mycosphaerellaceae

P

Leaf spot

USA

Alfieri Jr. et al. (1984

P. daspurensis (A.K. Kar & M. Manda)

Mycosphaerellaceae

P

Leaf spot

India

Sarbhoy et al. (1971)

Pseudocercospora riachueli (Speg.) Deighton

Mycosphaerellaceae

P

Leaf spot

India, Thailand

Kamal (2010), Phengsintham et al. (2013)

P. vitis (Lév.) Speg.*

Mycosphaerellaceae

P

Leaf spot

Australia, Barbados, Brazil, Bulgaria, China, France, Hungary, India, Iowa, Iran, Italy, Japan, Korea, Mauritius, Myanmar, Pakistan, Poland, South Africa, South Korea, Taiwan, Tanzania, Thailand, USA, Zimbabwe

Gilman and Archer (1929), Wiehe (1948), Riley (1960), Vasudeva (1963), Whiteside (1966), Norse (1974), Deighton (1976), Gorter (1977), Giatgong (1980), Thaung (1984), Pons and Sutton (1988), Cook and Dubé (1989), Hsieh and Goh (1990), Ahmad et al. (1997), Roux et al. (1997), Kim and Shin (1998), Liu and Guo (1998), Mendes et al. (1998), Zhuang (2001), Dugan et al. (2004), Kobayashi (2007), Mulenko et al. (2008), Bobev (2009), Kamal (2010), Sultan et al. (2011), Pirnia et al. (2012), Liang et al. (2016), This study, Jayawardena et al. (2018)

Pseudogymnoascus pannorum (Link) Minnis & D.L. Lindner*

Myxotrichaceae

S

 

Switzerland

Casieri et al. (2009)

Pseudolachnea hispidula (Schrad.) B. Sutton*

Chaetosphaeriaceae

S

 

Italy

This study, Jayawardena et al. (2018)

Pseudopestalotiopsis camelliae-sinensis F. Liu & L. Cai*

Sporocadaceae

S

 

Italy

This study, Jayawardena et al. (2018)

Pseudopezicula tetraspora Korf, R.C. Pearson & W.Y. Zhuang

Drepanopezizaceae

P

Angular leaf scorch

USA

Pearson et al. (1988)

P. tracheiphila (Müll.-Thurg.) Korf & W.Y. Zhuang)

Drepanopezizaceae

P

Angular leaf scorch

Australia, France, Germany, Hungary, Jordan, Moldova, Romania, Switzerland, Tunisia, Turkey, Ukraine, Yugoslavia

Korf et al. (1986)

Psiloglonium clavisporum (Seaver) E. Boehm, C.L. Schoch & Spatafora

Hysteriaceae

S

 

USA

Hanlin (1963)

Punctulariopsis cremeoalbida (M.J. Larsen & Nakasone) Ghobad-Nejhad

Punctulariaceae

S

 

USA

Larsen and Nakasone (1984)

Pyrenochaeta sp.*

Cucurbitariaceae

E

 

China

Dissanayake et al. (2018)

Pyrenophora phaeocomes (Rebent.) Fr.

Pleosporaceae

E

 

Portugal

Unamuno (1941)

P. phaeocomoides (Berk. & Broome) Sacc.

Pleosporaceae

E

 

France, Portugal

Unamuno (1941), Shoemaker (1992)

Pyrigemmula aurantiaca D. Magyar & R. Shoemaker*

Chaetosphaeriaceae

E, S

 

Hungary

Magyar et al. (2011)

Pythium acanthicum Drechsler*

Pythiaceae

P

Root rot

Australia, South Africa

Shivas (1989), McLeod et al. (2009)

P. amasculinum Y.N. Yu*

Pythiaceae

S

 

China

This study

P. aphanidermatum (Edson) Fitzp.

Pythiaceae

P

Root rot

Australia, South Africa

Cook and Dubé (1989)

P. coloratum Vaartaja*

Pythiaceae

P

Root rot

South Africa

McLeod et al. (2009)

P. cryptoirregulare Garzón, Yánez & G.W. Moorman*

Pythiaceae

P

Root rot

South Africa

McLeod et al. (2009)

P. debaryanum R. Hesse

Pythiaceae

P

Root rot

Chile, India

Mujica and Vergara (1945)

P. echinulatum V.D. Matthews*

Pythiaceae

P

Root rot

South Africa

McLeod et al. (2009)

P. helicoides Drechsler*

Pythiaceae

P

Root rot

South Africa

McLeod et al. (2009)

P. heterothallicum W.A. Campb. & F.F. Hendrix*

Pythiaceae

P

Root rot

South Africa

McLeod et al. (2009)

P. irregulare Buisman*

Pythiaceae

P

Root rot

Asutralia, South Africa

Cook and Dubé (1989), Shivas (1989), McLeod et al. (2009)

P. kunmingense Y.N. Yu*

Pythiaceae

P

Root rot

South Africa

McLeod et al. (2009)

P. mamillatum Meurs*

Pythiaceae

P

Root rot

Australia, South Africa

Shivas (1989), McLeod et al. (2009)

P. parasiticum S. Rajagop. & K. Ramakr.

Pythiaceae

P

Root rot

South Africa

Gorter (1977)

P. paroecandrum Drechsler*

Pythiaceae

P

Root rot

South Africa

McLeod et al. (2009)

P. periilum Drechsler*

Pythiaceae

P

Root rot

South Africa

McLeod et al. (2009)

P. perplexum H. Kouyeas & Theoh*

Pythiaceae

P

Root rot

South Africa

McLeod et al. (2009)

P. pyrilobum Vaartaja*

Pythiaceae

P

Root rot

South Africa

McLeod et al. (2009)

P. recalcitrans Belbahri & E. Moralejo*

Pythiaceae

P

Root rot

South Africa

Moralejo et al. (2008)

P. rostratifingens De Cock & Lévesque*

Pythiaceae

P

Root rot

South Africa

McLeod et al. (2009)

P. rostratum E.J. Butler

Pythiaceae

P

Root rot

Australia

Cook and Dubé (1989)

P. spinosum Sawada*

Pythiaceae

P

Root rot

Australia, South Africa

Shivas (1989), McLeod et al. (2009)

P. splendens Hans Braun

Pythiaceae

P

Root rot

Malaysia

Liu (1977)

P. sylvaticum W.A. Campb. & F.F. Hendrix

Pythiaceae

P

Root rot

South Africa

Gorter (1977)

P. torulosum Coker & P. Patt.*

Pythiaceae

P

Root rot

South Africa

McLeod et al. (2009)

P. ultimum Trow

Pythiaceae

P

Root rot

Australia, New Zealand, South Africa

Cook and Dubé (1989), Shivas (1989), Gadgil (2005)

P. vanterpoolii V. Kouyeas & H. Kouyeas*

Pythiaceae

P

Root rot

South Africa

McLeod et al. (2009)

P. vexans de Bary

Pythiaceae

P

Root rot

Malaysia

Liu (1977)

P. viola Chesters & Hickman*

Pythiaceae

P

Root rot

South Africa

McLeod et al. (2009)

Pythium sp.*

Pythiaceae

P, S

Root rot

Australia, China, USA

Alfieri Jr. et al. (1984, French (1989), Castillo-Pando et al. (2001), This study

Ramularia khandalensis Patw. & A.K. Pande

Mycosphaerellaceae

P, E

Leaf spot

India

Sarbhoy et al. (1971)

R. mali Videira & Crous*

Mycosphaerellaceae

P, E

Leaf spot

Iran

Bakhshii and Arzanlou (2017)

R. vitis (Richon) U. Braun

Mycosphaerellaceae

P, E

Leaf spot

Armenia, Australia, Caucasus, Europe, France

Braun (1998)

Rhabdospora ampelina (Thüm.) Sacc.

Dothideomycetes genera incertae sedis

P

Stem, leaf spot

Japan

Kobayashi (2007)

R. labruscae Gonz. Frag.

Dothideomycetes genera incertae sedis

P

Stem, leaf spot

Spain

Gonzalez Fragoso (1917)

R. mueggenburgii (Pirotta) Sacc.

Dothideomycetes genera incertae sedis

P

Stem, leaf spot

Poland

Mulenko et al. (2008)

R. vitis Koshk. & Frolov

Dothideomycetes genera incertae sedis

P

Stem, leaf spot

Central Asia

Koshkelova and Frolov (1973)

Rhinocladiella atrovirens Nannf.

Herpotrichiellaceae

E

 

Spain

Gonzalez and Tello (2011)

Rhizoctonia solani J.G. Kühn

Ceratobasidiaceae

P, E

Root rot

South Africa, Spain, USA

Marais (1979), Alfieri Jr. et al. (1984, Halleen et al. (2003), Gonzalez and Tello (2011)

Rhizoctonia sp.*

Ceratobasidiaceae

P, E

Root rot

Australia, Chili, Mexico, Switerzland

Mujica and Vergara (1945), Alvarez (1976), Castillo-Pando et al. (2001), Casieri et al. (2009)

Rhizopus arrhizus A. Fisch.

Rhizopodaceae

P, E

Bunch rot

USA

French (1987, 1989)

R. oryzae Went & Prins. Geerl.*

Rhizopodaceae

S

 

China

This study, Jayawardena et al. (2018)

R. stolonifer (Ehrenb.) Vuill.*

Rhizopodaceae

P, E

Bunch rot

Australia, Cuba, Japan, SouthAfrica, Spain, Switzerland

Gorter (1977), Urtiaga (1986), Cook and Dubé (1989), Witbooi et al. (2000), Kobayashi (2007), Casieri et al. (2009), Gonzalez and Tello (2011)

Rhizopus sp.*

Rhizopodaceae

P, E

Bunch rot

France, Italy, Switzerland

Castillo-Pando et al. (2001), Casieri et al. (2009), Mondello et al. (2013)

Rhodosporidium sp.*

Sporidiobolales genera incertae sedis

S

 

China

This study

Rhodotorula sp.*

Sporidiobolales genera incertae sedis

S

 

China

This study

Robillarda vitis Prill. & Delacr.

Sporocadaceae

E

 

France

Nag Raj (1993)

Roesleria pallida (Pers.) Sacc.

Roesleriaceae

P

Root rot

Japan

Kobayashi (2007)

R. subterranea (Weinm.) Redhead*

Roesleriaceae

P

Root rot

Italy, USA

Kepley et al. (2015)

Rosellinia akulovii L.E. Petrini

Xylariaceae

S

 

France

Petrini (2013)

R. amblystoma Berl. & F. Sacc.

Xylariaceae

S

 

Portugal

Unamuno (1941)

R. aquila (Fr.) De Not.

Xylariaceae

S

 

France

Petrini (1992)

R. necatrix Berl. ex Prill.

Xylariaceae

P

White root rot

Bulgaria, France, Greece, Italy, Japan, Mexico, Ukraine

Alvarez (1976), Greuter et al. (1991), Holevas et al. (2000), Dudka et al. (2004), Kobayashi (2007), Bobev (2009), Petrini (2013)

R. rosarum Niessl

Xylariaceae

S

 

Poland

Mulenko et al. (2008)

Sarocladium strictum (W. Gams) Summerb.

Hypocreales genera incertae sedis

E

 

Spain

Gonzalez and Tello (2011)

Schizophyllum commune Fr.

Schizothyriaceae

P

White rot on already dead parts of grapevine trunks

Greece

Zervakis et al. (1998)

Schizothyrium pomi (Mont.) Arx,

Schizothyriaceae

P

White rot on already dead parts of grapevine trunks

Japan, USA

Anonymous (1960), Kobayashi (2007)

Sclerostagonospora sp.

Phaeosphaeriaceae

P

Excoriose and cane blight

Portugal

Phillips (2000)

Sclerotinia sclerotiorum (Lib.) de Bary*

Sclerotiniaceae

P, E

Shoot blight

Australia, Chile, Greece, Japan, Mexico, New Zealand, Spain, Switzerland, USA

French (1989), Shivas (1989), Latorre and Guerrero (2001), Casieri et al. (2009), Gonzalez and Tello (2011), Ferrada et al. (2014)

Sclerotium echinatum Fuckel

Sclerotiniaceae

P

Shoot blight

Poland

Mulenko et al. (2008)

S. rolfsii Sacc.

Sclerotiniaceae

P

Shoot blight

Japan, USA

French (1987, 1989), Kobayashi (2007)

Sclerotium sp.

Sclerotiniaceae

P

Shoot blight

Thailand

Giatgong (1980)

Scolicotrichum vitiphyllum (Speschnew) Karak. & Vassiljevsky

Ascomycota genera incertae sedis

P

Shoot blight

Central Asia

Koshkelova and Frolov (1973)

Scopulariopsis sp.*

Microascaceae

S

 

China

This study

Scytinostroma alutum Lanq.

Lachnocladiaceae

P, S

Root rot

France

Boidin and Lanquetin (1987)

Seimatosporium botan Sat. Hatak. & Y. Harada*

Sporocadaceae

P

Trunk disease

Chile

Diaz et al. (2012)

S. hysterioides (Fuckel) Brockmann*

Sporocadaceae

P

Trunk disease

Australia, England, France, Greece, Germany, Italy

Nag Raj (1993), Sergeeva et al. (2005)

S. lichenicola (Corda) Shoemaker & E. Müll.

Sporocadaceae

P

Trunk disease

Australia

Cook and Dubé (1989), Shivas (1989)

S. lonicerae (Cooke) Shoemaker

Sporocadaceae

P

Trunk disease

Australia

Shivas (1989)

S. parasiticum (Dearn. & House) Shoemaker

Sporocadaceae

P

Trunk disease

Germany, Pakistan

Sutton (1980), Ahmad et al. (1997)

S. vitis P. Xiao, Camporesi & K.D. Hyde*

Sporocadaceae

P, S

Trunk disease

Hungary, Italy

Senanayake et al. (2015), Váczy (2017), This study, Jayawardena et al. (2018)

Seiridium cupressi (Guba) Boesew.

Sporocadaceae

P

Trunk disease

China

Teng (1996)

Selenophoma sp.

Saccotheciaceae

E

 

Spain

Gonzalez and Tello (2011)

Septobasidium tanakae (Miyabe) Boedijn & B.A. Steinm.

Septobasidiaceae

P

 

Japan

Kobayashi (2007)

Septoria ampelina Berk. & M.A. Curtis

Mycosphaerellaceae

P

Leaf spot

Bulgaria, Italy, Mexico, Romania, Ukraine

Radulescu et al. (1973), Alvarez (1976), Greuter et al. (1991), Vanev et al. (1997), Dudka et al. (2004), Bobev (2009)

S. badhamii Berk. & Broome

Mycosphaerellaceae

P

Leaf spot

Japan, Romania, UK

Watson (1971), Radulescu et al. (1973), Kobayashi (2007)

S. melanopsis Pat.

Mycosphaerellaceae

P

Leaf spot

Brazil, Italy, Kenya, Tunisia, UK

Nattrass (1961), Watson (1971)

S. vitis Schulzer

Mycosphaerellaceae

P

Leaf spot

Australia

Priest (2006)

S. vineae Pass.

Mycosphaerellaceae

S

 

Romania

Watson (1971), Radulescu et al. (1973)

Septoriella allojunci W.J. Li, Camporesi, D.J. Bhat & K.D. Hyde*

Phaeosphaeriaceae

S

 

China

This study, Jayawardena et al. (2018)

Simplicillium sp.*

Cordycipitaceae

S

 

China

This study

Sordaria fimicola (Roberge ex Desm.) Ces. & De Not.*

Sordariaceae

S

 

Switzerland

Casieri et al. (2009)

Sordaria sp.

Sordariaceae

E

 

Spain

Gonzalez and Tello (2011)

Spencermartinsia plurivora Abdollahz., Javadi & A.J.L. Phillips*

Botryosphaeriaceae

P

Canker/die back

Australia, Spain

Pitt et al. (2015)

S. viticola (A.J.L. Phillips & J. Luque) A.J.L. Phillips, A. Alves & Crous*

Botryosphaeriaceae

P

Canker/die back

Australia, France, South Africa, Spain, USA

Luque et al. (2005), Úrbez-Torres et al. (2007), de Wet et al. (2009), Qiu et al. (2011), Úrbez-Torres (2011), Diaz et al. (2013), Pitt et al. (2013, 2015), Li et al. (2014), Carlucci et al. (2015), Pavlic-Zupanc et al. (2015), Valencia et al. (2015), Comont et al. (2016), Coutinho et al. (2017), Lawrence et al. (2017b)

S. westrale W.M. Pitt, J.R. Úrbez-Torres & Trouillas*

Botryosphaeriaceae

P

Canker/die back

Australia

Pitt et al. (2015)

Spencermartinsia sp.

Botryosphaeriaceae

P

Canker/die back

Spain

Gonzalez and Tello (2011)

Sphaeropsis ampelos (Schwein.) Cooke

Botryosphaeriaceae

P

Canker/die back

China

Teng (1996)

S. peckiana Thüm.

Botryosphaeriaceae

P

Canker/die back

Italy

Greuter et al. (1991)

S. porosa (Van Niekerk & Crous) A.J.L. Phillips & A. Alves

Botryosphaeriaceae

P

Canker/die back

South Africa

van Niekerk et al. (2004a, b, 2006), Phillips et al. (2005), Luque et al. (2005), de Wet et al. (2009), Úrbez-Torres (2011)

Sphaeropsis sp.

Botryosphaeriaceae

P

Canker/die back

Greece

Holevas et al. (2000)

Spiromastix sp.*

Spiromastigaceae

S

 

China

This study

Spiromyces sp.*

Kickxellaceae

S

 

China

This study

Sporoschisma ampullula Sacc.

Chaetosphaeriaceae

S

 

Yugoslavia

Nag Raj and Kendrick (1975)

Sporocadus rhododendri (Schwein.) M. Morelet*

Amphisphaeriaceae

P

Cane lesions

Australia

Sergeeva et al. (2005)

Stagonospora bulgarica Vanev

Phaeosphaeriaceae

P

Leaf spot

Bulgaria

Vanev et al. (1997)

Stachybotrys sp.*

Stachybotryaceae

S

 

China

This study

Stemphylium viticola Pass.

Pleosporaceae

E

 

Poland

Mulenko et al. (2008)

Stemphylium sp.

Pleosporaceae

E

 

Spain

Gonzalez and Tello (2011)

Stereum hirsutum (Willd.) Pers.*

Stereaceae

P

Esca

Bulgaria, France, Greece, Spain

Larignon and Dubos (1997), Zervakis et al. (1998), Bobev (2009), Luque et al. (2009), Cloete et al. (2015)

Stereum sp.

Stereaceae

P

Esca

USA

French (1989)

Stigmina esfandiarii Petr.

Mycosphaerellaceae

P

Leaf spot

Iran, Pakistan

Esfandiari and Petrak (1950), Khan and Kamal (1974)

Strickeria sylvana (Sacc. & Speg.) Cooke

Sporocadaceae

S

 

Poland

Mulenko et al. (2008)

S. trabicola (Fuckel) G. Winter

Sporocadaceae

S

 

Central Asia

Koshkelova and Frolov (1973)

Stromatoneurospora sp.*

Xylariales genera incertae sedis

S

 

China

This study

Talaromyces amestolkiae N. Yilmaz, Houbraken, Frisvad & Samson*

Trichocomaceae

S

 

China

This study, Jayawardena et al. (2018)

T. pinophilus (Hedgc.) Samson, N. Yilmaz, Frisvad & Seifert*

Trichocomaceae

S

 

China

This study, Jayawardena et al. (2018)

T. purpureogenum Stoll*

Trichocomaceae

S

 

China

This study, Jayawardena et al. (2018)

Talaromyces sp.*

Trichocomaceae

S

 

China

This study, Jayawardena et al. (2018)

Terana coerulea (Lam.) Kuntze

Phanerochaetaceae

P

Wood decay

USA

Campbell et al. (1950), Hanlin (1966)

Tetracoccosporium sp.

Ascomycota genera incertae sedis

P

Root stock disease

South Africa

Halleen et al. (2003)

Thanatephorus cucumeris (A.B. Frank) Donk

Ceratobasidiaceae

S

 

China

Tai (1979)

Thaxteriella pezizula (Berk. & M.A. Curtis) Petr.

Tubeufiaceae

S

 

USA

Hanlin (1963)

Thelonectria olida (Wollenw.) P. Chaverri & Salgado

Nectriaceae

P

Black foot disease

Uruguay

Abreo et al. (2012)

Thielavia sp.

Chaetomiaceae

S

 

China

This study

Tilletiopsis minor Nyland*

Exobasidiomycetidae incertae sedis

S

 

British Colombia, Canada

Urquhart et al. (1997)

T. washingtonensis Nyland

Exobasidiomycetidae incertae sedis

S

 

Japan

Urquhart et al. (1997)

Tomentella atramentaria Rostr.

Thelephoraceae

S

 

Spain

Hernandez (2004)

T. bryophila (Pers.) M.J. Larsen

Thelephoraceae

S

 

Spain

Hernandez (2004)

Tomentella sp.*

Thelephoraceae

E

 

China

Dissanayake et al. (2018)

Torula viticola Allesch.

Torulaceae

E

 

USA

Saccardo (1878)

Torula sp.

Torulaceae

E

 

Spain

Gonzalez and Tello (2011)

Toxicocladosporium sp.*

Cladosporiaceae

E

 

China

Dissanayake et al. (2018)

Trametes zonata (Nees) Pilát

Polyporaceae

S

 

New Zealand

Cunningham (1965)

Trichocladium asperum Harz*

Chaetomiaceae

E, S

 

Russia, Switzerland

Melnik and Popushoi (1992), Casieri et al. (2009)

Trichoderma atroviride P. Karst.*

Hypocreaceae

S

 

China

This study, Jayawardena et al. (2018)

T. aureoviride Rifai

Hypocreaceae

E

 

Spain

Gonzalez and Tello (2011)

T. koningii Oudem.

Hypocreaceae

S

 

Russia

Melnik and Popushoi (1992)

T. harzianum Rifai*

Hypocreaceae

E, S

 

China, Spain

Gonzalez and Tello (2011), This study, Jayawardena et al. (2018)

T. lixii (Pat.) P. Chaverri*

Hypocreaceae

S

 

China

This study, Jayawardena et al. (2018)

T. parapiluliferum (B.S. Lu, Druzhin. & Samuels) Jaklitsch & Voglmayr*

Hypocreaceae

S

 

Switzerland

Casieri et al. (2009)

Trichoderma sp.*

Hypocreaceae

E

 

South Africa, Spain, Switzerland

Fourie and Halleen (2002), Casieri et al. (2009), Gonzalez and Tello (2011)

Trichothecium roseum (Pers.) Link*

Hypocreales genera incertae sedis

P

Berry rot

Australia, China, Greece, India, Japan, Korea

Alexopoulos (1940), Tai (1979), Shivas (1989), Sharma and Agarwal (1997), Kobayashi (2007), Oh et al. (2014), This study

Trullula melanochlora (Desm.) Höhn.

Leotiomycetes genera incertae sedis

P

 

France, Portugal

Phillips (2000)

Truncatella angustata (Pers.) S. Hughes*

Sporocadaceae

P, E

 

France, Iran, Portugal, Spain, Switzerland

Nag Raj (1993), Casieri et al. (2009), Gonzalez and Tello (2011), Arzanlou et al. (2013), Maharachchikumbura et al. (2016)

T. pitospora (M.E.A. Costa & Sousa da Câmara) Bissett

Sporocadaceae

P

 

Portugal

Nag Raj (1993)

Typhula viticola (Peck) Berthier

Typhulaceae

S

 

USA

Berthier (1976)

Ulocladium sp.

Pleosporaceae

E

 

South Africa, Spain

Halleen et al. (2003), Gonzalez and Tello (2011)

Umbelopsis isabellina (Oudem.) W. Gams*

Mucoraceae

S

 

Switzerland

Casieri et al. (2009)

Valsaria insitiva (Tode) Ces. & De Not.

Valsariaceae

P

 

Portugal, Spain

Phillips (2000), Unamuno (1941)

Verticillium ahlia Kleb.*

Plectosphaerellaceae

P

 

China, Japan, USA

French (1989), Kobayashi (2007), Zhang et al. (2009)

Verticillium sp.

Plectosphaerellaceae

P

 

Mexico

Alvarez (1976)

Verpa bohemica (Krombh.) J. Schröt*

Morchellaceae

E

 

Switzerland

Casieri et al. (2009)

Volutella sp.*

Nectriaceae

S

 

China

This study

Xeromyces bisporus L.R. Fraser*

Aspergillaceae

S

 

Australia

Pettersson et al. (2011)

Xerotus viticola Berk. & M.A. Curtis

Polyporaceae

S

 

USA

Berkeley (1872)

Xylaria arbuscula Sacc.

Xylariaceae

S

 

Taiwan

Ju and Rogers (1999)

Xylaria hypoxylon (L.) Grev.

Xylariaceae

E

 

Spain

Gonzalez and Tello (2011)

Xylaria sp.*

Xylariaceae

S

 

China

This study

Zetiasplozna thuemenii (Speg.) Nag Raj

Sporocadaceae

S

 

Italy

Nag Raj (1993)

Life mode—P pathogen, E endophyte, S saprotroph, M mycoparasitic on powdery mildew fungi, OP opportunisitic pathogen and U unknown

*Identification is confirmed by molecular data in the studies. The records are taken from the literatures and thus may not be correct and the same taxon could be listed more than once. It would be necessary to re -examine all collections if available to confirm their identities. Even the molecular data may be needed to establish their correct names

Discussion

Before the advent of molecular data in taxonomy, studies on the fungi on Vitis were based on traditional methodology and have resulted in hundreds of records of fungi from this host genus (Table 6). Most recent studies have been related to pathogens that affect grape yield and production (Úrbez-Torres et al. 2012, 2013a, b; Dissanayake et al. 2015; Liang et al. 2016; Jayawardena et al. 2015, 2016a; Yan et al. 2015; Chethana et al. 2017) and have resulted in well-resolved taxonomy as they have used molecular data. However, studies on saprobes using molecular data and culture-independent techniques have not been used to identify the fungi on Vitis to date. In this study, we therefore provide the first work comparing saprobes on Vitis sp. using both traditional and culture-independent approaches, with well-resolved taxonomic identifications based on molecular analyses. The taxa derived from both approaches are compared as the same samples were used in the study. We have also established the saprotrophic communities associated with both wine and table grapevine cultivars and demonstrate cultivar specific communities for each grapevine cultivar. A checklist of fungi of Vitis is also provided which is an important resource for viticulture.

Microfungi collected from China, Italy, Russia and Thailand

Sixty-seven saprotrophic taxa from 46 genera were identified in this study (Table 1). Using traditional methodology and analyses of molecular data, we identified two new species, and 41 new host or distribution records for V. vinifera. Taxonomic details, descriptions, photographic plates and phylogenetic analyses are provided in Jayawardena et al. (2018). Some of these genera have a wide distribution. For example, botryosphaerious and Colletotrichum taxa have a wide distribution. These taxa are well-known pathogens and can be spread to other countries undetectable through the exportation of rootstocks. Some genera are only known from one or two countries. This may be due to the lack of data on the fungi associated with this host.

Comparisons of traditional and culture-independent approaches for characterizing the saprotrophic fungal communities associated with two cultivars of Vitis vinifera

Most previous studies on fungi on grapevine have relied on traditional approaches (Table 6). Some recent identification of isolated taxa have incorporated analyses of ITS sequence data (Guo et al. 2003; Promputtha et al. 2007), but this was shown not to be accurate (Ko et al. 2011). The most recent studies on fungal pathogens of grapevine have incorporated multigene analysis to accurately resolve taxa (Dissanayake et al. 2015; Jayawardena et al. 2015; Yan et al. 2015; Chethana et al. 2017).

Most previous studies did not address the total community of fungi on Vitis vinifera. Pancher et al. (2012) carried out an extensive study on endophytes on this host, showing that how various anthropic and nonanthropic factors shape microbial communities. There have been extensive studies on the disease causing agents with more than 150 taxa known to cause various diseases of grapevine. For example, Colletotrichum species cause grape ripe rot of Vitis vinifera worldwide (Jayawardena et al. 2016b). There have however, been no investigation on the saprobes of grapevines using molecular identification and there has been no study using mycobiome analysis to reveal saprotrophic communities. The study of saprotrophs is important, as they not only decay dead leaves and branches, thus beneficial recyclers, but they may also become pathogens when conditions are suitable.

This study therefore fills this void by establishing the saprotrophic fungi on Vitis vinifera using both traditional and culture-independent approaches. In this study we did not obtain similar results from the two methods. In the traditional method, 45 species belonging to 30 genera were identified (Table 2), while in culture-independent method 226 OTUs’ and 72 genera were identified. Even though we isolated directly from the fruiting bodies, some fungi were not able to grow on media. Several single spore isolations were unsuccessful. This may be due to the availability of nutrient content, pH, temperature, and presence of inhibitors and the time of incubation. The number of isolates obtained was less than the actual fungal community and can be misinterpreted (Hugenholtz et al. 1998). These conditions make it difficult to accurately identify and document the vast number of unrecognized taxa (Lücking and Moncada 2017). For example, in this study the total identified taxa from the traditional method were 45. Therefore, to overcome the constraints of traditional methods, culture-independent techniques are proposed as an alternative technique (Hoppe et al. 2016).

The aim of environmental sequence nomenclature is to place names of species of fungi that would otherwise be left undescribed (Lücking and Moncada 2017). These techniques can provide sequence reads almost 1000 times more than the traditional DNA sequencing methods (Lücking and Moncada 2017). Lücking and Moncada (2017) showed that a formally recognized unnamed lichenicolous basidiomycete can be considered as a new genus, with seven new species, although there is no physical type specimens are available. These authors also suggested that this would allow the recognition of thousands of species of voucher less taxa detected through environmental sequencing techniques. However, there are several constrains to NGS methods. DNA may not be recovered from all genotypes and the results of NGS can be biased towards the most abundant organisms at the time of sampling (Ward et al. 1990). The reason for this is that the relative abundance (Fig. 5) of microbial species in a natural habitat is rarely equal. Usually, with a few species being predominant among a larger group of common species makes it difficult to identify the species that are actually present. NGS are mainly based on analysis of ITS regions (Schoch et al. 2012). However, due to the high variability of ITS regions (ITS1 and ITS2), reliable sequence alignments are difficult to obtain for some fungal taxa. Therefore, this method is not reliable for species level identification. The identification levels are usually reported at the genus level or even higher taxonomic levels, such as family or order (Purahong et al. 2018). Another constraint of NGS is that the correspondence of OTU with species can be unreliable. OTUs are defined based on the similarity threshold, usually with a 97% (Sneath and Sokal 1973). However, some species have genes that are 97% similar, which will result in merged OTUs containing multiple species. In the same way, a single species may have paralogs that are < 97% similar, causing the species to be split across two or more species. Some identified clusters, even when a majority, may be false, due to the artifacts including reading errors and chimeras (Sneath and Sokal 1973). Assessing species richness and diversity of a microbial community using culture-independent method (rarefaction curves), suggests that OTUs are observations of organisms with ‘negligible error’. Also, it suggests that the number of reads correlates well with the total number of individuals present in the community. However, if the majority of OTUs are experimental artifacts, the traditional species richness estimations cannot be applied. The measures between sample variations will tend to reflect differences in artifact frequencies rather than biological differences (Sokal and Sneath 1963).
Fig. 5

Relative abundance of the top 10% phylum from different samples of the cultivars Carbanate Gernischet and Red Globe of Vitis vinifera

Artifacts can be occurred due to several reasons. PCR amplification steps can be affected by preferentially/differentially that can hinder the detection of some genotypes when analysing bulk DNA extracts from a substrate (Kanagawa 2003). Primer mismatches, a lower rate of primer hybridization, occurrence of heteroduplexes and chimeric amplicons can generate additional signals that do not correspond to the genotypes in the same samples (Suzuki and Giovannoni 1996; Kanagawa 2003). Also, the analysis of fungal rRNA genes limits identification to the genus or family level (Anderson and Cairney 2004).

Dissanayake et al. (2018) in her study using paired-end Illumina sequencing with 55, 822 high quality sequences per endophyte sample (saturated rarefaction curves for all samples) revealed 59 OTUs (the majority containing genera level identification) that were similar to genera revealed by the traditional method (28 species).

Traditional versus culture-independent methods: can matching of these two approaches enable us to identify correct fungal taxonomic information at genus and species levels?

In this study, taxa (OTUs) of Aspergillus, Botrytis, Cladosporium, Clonostachys, Fusarium, Penicillium, Phoma and Talaromyces were identified using both traditional and culture-independent approaches. Some fast growing fungi may be dominant in the culture plates, even though in the natural habitat they may be minorities. Many hyphomycetes tend to grow faster than the other groups of fungi. So, they may suppress the growth of other important, dominant fungi. The fast growing fungi (hyphomycetes) identified in the traditional method such as Mucor and Rhizopus were not recognized in the culture-independent method. The majority of the genera identified in the traditional method are phytopathogens, while in the culture-independent method the majority are saprotrophs. In the traditional method using both morphological and molecular approaches, we were able to identify many taxa to species level, although in six cases the identification is only up to the genus level due to lack of data. We have generated a phytogenetic tree for the genus Colletotrichum using the strains identified in the traditional approach as well as the OTU identified in the culture-independent method. OTU-234, was identified as Glomerellaceae sp. in the culture-independent approach. The blastn result of OTU-234 in NCBI shows 100% similarity to many strains of C. gloeosporioides. Two-hundred and fifteen basepairs of OTU-234 were used in the alignment (Supplementary Fig. S6). In the phylogenetic tree constructed using the ex-type strains of gloeosporioides complex and the truncatum complex, OTU-234 cluster within the truncatum complex, closely to C. curcumae (Supplementary Fig. S7). This example also provides evidence that the NGS sequences is not reliable to identify an organism to the species level. However, in the culture-independent technique we were able to identify 90 out of 226 OTUs to species level, and the rest were identified to genera or family level. These may not be correctly identified as in general NGS fungal taxa identification may be only accurate to the genus level (Purahong et al. 2018), which suggests that the sequence data from the culture-independent approach is inadequate to accurately identify species. The overlap between the two methods in identifying the taxa to the species level is negligible.

Matching between the traditional and culture-independent data allows us to have a better understanding concerning the functional information of the fungal OTUs resulting from culture-independent methods. Next generation sequencing often results in sequences that are associated with taxa, which have not been reported in previous studies (Tejesvi et al. 2010; Ko et al. 2011; Taylor et al. 2016). However, as most of these OTUs are identified to genus or family level, it makes it difficult to relate whether these are actually correctly identified and whether the use of this method is important. In the preparation of the checklist of fungi on Vitis species, the authors had to eliminate most of the taxa that were identified using NGS, as those data can be unreliable. In our study, we compared the sequence similarity between the two cultivars using a 90% similarity of ITS1 sequence data, followed by a manual BLAST based identification of the respective OTUs. We considered the ITS similarity at 98–99% as the same species (Garnica et al. 2016; Jeewon and Hyde 2016). In this criterion, identification of genera can be bias/difficult as some of the data in databases have mistakes or they may be inaccurate. The increase of the ITS similarity to 99–100% can give us better and reliable identification of the species. However, ITS sequence data alone will not be able to identify the complexes genera such as Colletotrichum and Diaporthe to their species level. For a better resolution of these genera protein coding gene regions are required.

Can direct matching between traditional and culture-independent methods help to identify the rare taxa?

Our results show that some singletons, which were usually removed as artifacts or errors of the NGS may actually be real OTUs. In this study, we found two OTUs (Botryospaeria OTU-178 and Ascomycota OTU-213) as singletons and removed them from the analysis. However, with direct matching, we found that these OTUs are Botryospaeria dothidea and Coniella vitis. Therefore, we can assume that not all the singletons are artifacts and matching between traditional and culture-independent methods can help to identify the real rare taxa in the fungal community.

Potential effect of grape cultivars (table grape (Red Globe) and wine grape (Carbanate Gernischet) on fungal saprotrophic community composition and richness

Another aspect of this study was to study whether there is any difference in the fungal communities based on cultivars. In the present study, traditional and culture-independent approaches allows the identification of potential roles of the saprotrophs in the two grapevine cultivars. In this study we identified more than 10 main and important fungal pathogens of grapevine using both methods. With the evaluation of both community composition and community diversity we were able to identify that the fungal communities of the two grape cultivars appear to be different. Alternaria vitis, Albifrimbria viridis, Bipolaris maydis, Botryosphaeria dothidea, Botrytis cinerea, Colletotrichum hebeinse, C. truncatum, C. viniferum, Didymella pomorum, Dothiorella sarmentorum, Epiccocum nigrum, Fusarium sp., Mucor circinelloides, Paraphoma chrysanthemicola, Neopestalotiopsis clavispora, Stagonosporopsis sp.1, Minimedusa sp., Peniophora sp., Penicillium brevicompactum and P. citrinum were recorded only from Red Globe cultivar while Albifimbria verrucaria, Neopestalotiopsis vitis, Pythium amasculinum, Stagonosporopsis sp.2, Trichoderma lixii and Septoriella allojunci were recorded from Carbanate Gernischet cultivar in the traditional method. In the culture-independent approach, Acremonium chrysogenum (OTU-195), Apodus sp. (OTU-235), Ascomycota (OTU-80, 99, 182, 222, 253), Aspergillus sp. (OTU-116, 199), Candida mucifera (OTU-227), Cylindrocarpon sp. (OTU-171), Dactylellina phymatopaga (OTU-58), Davidiella tassiana (OTU-86), Deroxomyces sp. (OTU-225), Fungal (OTU-245, 254), Fusarium cf. dimerum (OTU-162), Helotiales (OTU-91), Hypocreales (OTU-65), Kernia nitida (OTU-184), Kernia pachypleura (OTU-211), Lecanicilium dimorphum (OTU-101), Lentinus squarrosulus (OTU-249), Lophiostoma sp. (OTU-142), Microascales (OTU-138), Metarhizium pinghaense (OTU-210), Myceliophthora fergusii (OTU-198), Myrothecium sp. (OTU-238), Nectriaceae (OTU-97, 194), Papulospora equi (OTU-148), Phialosimplex caninus (OTU-187), Psathyrellaceae (OTU-145), Pseudallescheria angusta (OTU-183), Pyronemataceae (OTU-237), Remersonia sp. (OTU 108), Sordariomycetes (OTU-128), Sordariales (OTU-196, 200, 214), Xylaria sp. (OTU-159) were found only in association with the Red Globe cultivar while Acremonium sp. (OTU-188), Apllosporella yalgorensis (OTU-85), Arachnomyces kanei (OTU-170), Aspergillus melleus (OTU-143), Aspergillus wentii (OTU-175), Cadophora luteo-olivaceae (OTU-146), Ceratobasidiaceae (OTU-219), Chaetomium carinthiacum (OTU-177), Chysisporium lobatum (OTU-150), Cladosporium grevilleae (OTU-121), Dothideomycetes (OTU-140), Eurotiales (OTU-76), Fungal (OTU-82, 104, 165), Gymnascella aurantiaca (OTU-151), Hansfodia sp. (OTU-232), Hypocreales (OTU-49, 92, 202), Lasiophaeriaceae (OTU-189), Leptosphaeria sp. (OTU-205), Magnoporthaceae (OTU- 141, 149), Microascales (OTU-114), Microascus sp. (OTU-185), Microdochium sp. (OTU-225), Nectriaceae (OTU-218), Penicillium ilerdanum (OTU-163), Penicillium neocrassum (OTU-168), Podospora communis (OTU-190), Scopulariopsis sp. (OTU-164), Sordariales (OTU-133), Spiromastix princeps (OTU-139), Thielavia basicola (OTU-155), Trichomaceae (OTU-156, 166) were recorded on from Carbanate Gernischet cultivar.

The difference of the two fungal communities can be due to the geographic variation of the cultivars. This can be a result from the interactions with specific V. vinifera varieties and its soil and climatic conditions (Bokulich et al. 2014). Red Globe cultivar was collected in Beijing, which is a region in North of China and Carbanate Gernischet cultivar was collected from Yunnan which is in the southern part of the country. The difference between the fungal communities in regions may be a function of a neutral process, where these different communities established by chance and lack of species dispersal allows these communities to persist (Martiny et al. 2006). This difference can also be due to the Baas Becking hypothesis, which states that there is no limit to the range of species but that selection sorts these species and defines community composition and diversity in any one area (Hanson et al. 2012). Climate can also co-relates with differences in fungal communities in China, as one moves North up in China, the climate becomes increasingly cold and dry so the pattern of lower fungal species richness in the northern most regions hints that selection might have a role in determining these patterns.

Plant pathogens and endophytes in the saprotrophic fungal community

Species richness and distribution patterns of saprotrophic fungi in a vineyard can provide important insights into the roles of each fungal group for the stability and functioning of its respective ecosystem (Kubartova et al. 2012). However, knowledge of saprotrophic fungi associated with grapevine is very much limited. In this study, we identified 17 primary and six species of secondary pathogens of grapevine as saprobes using the traditional method, while 27 OTUs were identified as both primary and secondary pathogens from dead material of Vitis vinifera in the culture-independent method.

Species of Alternaria are responsible in causing berry rots, raisin molds and rots as well as pedicel and rachis diseases (Barbe and Hewitt 1965; Gonzalez and Tello 2011; Tao et al. 2014, Ariyawansa et al. 2015) and also considered as wound and secondary invaders. Alternaria alternata and A. vitis were isolated in this study. Aspergillus is a causal agent of berry rots as well as a wound and secondary invader (Hewitt 2015). In our study A. aculeatus and A. niger were recorded using the traditional method, while A. aculeatus was also recorded from culture-independent method. Botryosphaerious taxa are well-known to be associated with grapevine canker and die back (Úrbez-Torres et al. 2012, 2013a, b). In our study we identified Botryosphaeria dothidea and Dothiorella sarmentorum as saprotrophs using traditional methodology. Lasiodiplodia was recorded in the culture-independent method.

Botrytis is another genus that we obtained in both traditional and independent approaches. Botrytis cinerea is a pathogen of grapevine causing Botrytis bunch rot and blight all over the world (Fournier et al. 2013; Hyde et al. 2014; Javed et al. 2017). Cladosporium was also recorded in both approaches. Species of this genus cause minor foliage diseases of grapevine, as well as bunch rots (Bensch et al. 2015). Clonostachys is another genus recorded in both approaches. Clonostachys rosea is known to cause root rot of grapevine in Switzerland (Casieri et al. 2009). Colletotrichum hebeiense, C. truncatum and C. viniferum were recorded in the traditional method. Species of this genus cause grape ripe rot affecting the quality and production of grapevine (Yan et al. 2015). Diaporthe eres is another pathogen of grapevine causing die back (Lawrence et al. 2015; Baumgartner et al. 2013; Cinelli et al. 2016; Fischer et al. 2016; Bastide et al. 2017), which was recorded via the traditional methodology as well as via the culture-independent approach.

Species of Fusarium cause wilt disease of grapevine (Castillo-Pando et al. 2001; Gonzalez and Tello 2011). This genus was recorded in both approaches. Neopestalotiopsis vitis recorded from traditional method is a pathogen causing fruit rot, die back and leaf spots of grapevine (Jayawardena et al. 2015, 2016a). Coniella vitis is a pathogen causing white rot of grapes, identified using traditional methods (Chethana et al. 2017). Species of Penicillium are wound and secondary pathogens of grapevines causing bunch rot (Kim et al. 2007). Rhizopus oryzae is another wound and secondary pathogen causing bunch rots of grapevines (Hewitt 2015).

Several genera were identified only in the culture-independent method. Aplosporella is known to cause lesions on grapevine stems in China (Tai 1979). Claviceps is known to be a pathogen on grasses and cereals, but has not been recorded as a pathogen of grapevine (Mey et al. 2002). Therefore, this study provides the first record of this genus on V. vinifera. Cylindrocarpon species are known to cause the black foot disease of grapevine (Abreo et al. 2010, 2012; Mohammadi et al. 2013a, b). Devriesia is a facultative pathogen, but there are no records of this species on V. vinifera (Seifert et al. 2004). Therefore, this study provides the first record of this genus on V. vinifera. Species of Leptosphaeria has been reported as endophytes and saprotrophs of grapevine (Crane and Shearer 1991). However, some species of this genus can be pathogenic to some economically important crops (Fitt et al. 2006). Monographella is a known leaf pathogen on rice, barley, maize and wheat (Daamen et al. 1991; Hock et al. 1992; Tatagiba et al. 2015). However, there are no records of species of this genus associated with grapevine. Therefore, this study provides the first record of Monographella associated with grapevine. Species of Phaeoacremonium are causal agents of Esca disease around the world (Garcia-Benavides et al. 2013). Species of Trichothecium are known to cause berry rot of grapevine, but this is not considered as a major pathogen on grapevine (Oh et al. 2014).

Even though genus Volutella is a facultative pathogen causing leaf spot and cankers (Henricot et al. 2000; Shi and Hsiang 2014), there is no record of this genus occurring on grapevine. Therefore, this study provides the first record of Volutella associated with V. vinifera as a saprotroph.

Among the 45 identified saprotrophic taxa, 17 are well known pathogens of Vitis vinifera causing severe yield as well as economic losses to viticulture worldwide (Table 2). Six secondary pathogens of were also identified in this study. Most of the pathogens tend to survive or overwinter on dead plant material as saprotrophs and act as the primary inoculums once the conditions are favourable (Armijo et al. 2016).

Many studies have shown that most pathogenic fungi can survive unsuitable conditions, such as cold during the winter, by changing their life mode to saprotrophs, and become active pathogens again once the conditions are suitable. Therefore, dead plant materials are the potential primary inocula for plant pathogens in vineyards. In order to avoid this problem, vineyards must be kept clean. If there are any dead grapevines they must be removed and if possible should be burned. This will reduce the pathogenic fungi from year to year.

Checklist of fungi on Vitis

Nine-hundred and five micro- and macro- fungal taxa reported on Vitis species are listed in this study. This is an updated worldwide checklist of fungi on Vitis. These taxa are distributed in 156 families and 343 genera. For each species, family, life mode, diseases caused and the known locality as well as references are provided.

Notes

Acknowledgements

This work was financially supported by Beijing Talent Programm for Dr. Jiye Yan, CARS-29 and JNKYT201605.

Supplementary material

13225_2018_398_MOESM1_ESM.pdf (1.2 mb)
Supplementary material 1 (PDF 1223 kb)

References

  1. Abad ZG, Abad JA, Cacciola SO, Pane A, Faedda R, Moralejo E, Perez-Sierra A, Abad-Campos P, Alvarez-Bernaola LA, Bakonyi J, Jozsa A, Herrero ML, Burgess TI, Cunnington JH, Smith IW, Balci Y, Blomquist C, Henricot B, Denton G, Spies C, McLeod A, Belbahri L, Cooke D, Kageyama K, Uematsu S, Kurbetli I, Degirmenci K (2014) Phytophthora niederhauserii sp. nov., a polyphagous species associated with ornamentals, fruit trees and native plants in 13 countries. Mycologia 106:431–447PubMedGoogle Scholar
  2. Abreo E, Martinez S, Bettucci L, Lupo S (2010) Morphological and molecular characterization of Campylocarpon and Cylindrocarpon spp. associated with black foot disease of grapevines in Uruguay. Australas Plant Pathol 39:446–452Google Scholar
  3. Abreo E, Lupo S, Bettucci L (2012) Fungal community of grapevine trunk diseases: a continuum of symptoms? Sydowia 64:1–12Google Scholar
  4. Agusti-Brisach C, Pérez-Sierra A, García-Figueres F, Montón C, Armengol J (2011) First report of dampingoff caused by Cylindrocarpon pauciseptatum on Pinus radiata in Spain. Plant Dis 95:874Google Scholar
  5. Agusti-Brisach C, Alaniz S, Gramaje D, Perez-Sierra A, Armengol J (2012) First report of Cylindrocladiella parva and Cylindrocladiella peruviana associated with black-foot disease of grapevine in Spain. Plant Dis 96:1381Google Scholar
  6. Agusti-Brisach C, Cabral A, Gonzalez-Dominguez E, Perez-Sierra A, Leon M, Abad-Campos P, Garcia-Jimenez J, Oliveira H, Armengol J (2016) Characterization of Cylindrodendrum, Dactylonectria and Ilyonectria isolates associated with loquat decline in Spain, with description of Cylindrodendrum alicantinum sp. nov. Eur J Plant Pathol 145:103–118Google Scholar
  7. Ahmad S (1969) Fungi of West Pakistan. Biol Soc Pak Monogr 5(Suppl. 1):1–110Google Scholar
  8. Ahmad S (1978) Ascomycetes of Pakistan, Part II. Biol Soc Pak Monogr 8:1–144Google Scholar
  9. Ahmad S, Iqbal SH, Khalid AN (1997) Fungi of Pakistan. Sultan Ahmad Mycological Society of Pakistan, LahoreGoogle Scholar
  10. Akgul DS, Savas NG, Eskalen A (2014a) First report of wood canker caused by Botryosphaeria dothidea, Diplodia seriata, Neofusicoccum parvum, and Lasiodiplodia theobromae on grapevine in Turkey. Plant Dis 98:568Google Scholar
  11. Akgul DS, Savas NG, Onder S, Ozben S, Kaymak S (2014b) First report of Campylocarpon fasciculare causing black foot disease of grapevine in Turkey. Plant Dis 98:1277Google Scholar
  12. Akgul DS, Gungor Savas N, Teker T, Keykubat B, Mayorquin JS, Eskalen A (2015) Fungal trunk pathogens of Sultana seedless vineyards in Aegean region of Turkey. Phytopathol Mediterr 54:380–393Google Scholar
  13. Alaniz S, Leon M, Vicent A, Garcia-Jimenez J, Abad-Campos P, Armengol J (2007) Characterization of Cylindrocarpon species associated with black foot disease of grapevine in Spain. Plant Dis 91:1187–1193Google Scholar
  14. Alaniz S, Armengol J, Leon M, Garcia-Jimenez J, Abad-Campos P (2009) Analysis of genetic and virulence diversity of Cylindrocarpon liriodendra and C. macrodidymum associated with black foot disease of grapevine. Mycol Res 113:16–23PubMedGoogle Scholar
  15. Alexopoulos CJ (1940) Some fungi from Greece. Mycologia 32:336–358Google Scholar
  16. Alfieri Jr SA, Langdon KR, Wehlburg C, Kimbrough JW (1984) Index of plant diseases in Florida (revised). Florida Department of Agriculture and Consumer Services, Division of Plant Industry Bulletin, vol 11, pp 1–389Google Scholar
  17. Alfieri SA Jr, Langdon KR, Kimbrough JW, El-Gholl NE, Wehlburg C (1994) Diseases and disorders of plants in Florida. Florida Department of Agriculture and Consumer Services, TallahasseeGoogle Scholar
  18. Al-Saadoon AH, Ameen MKM, Hameed MA, Al-Badran A, Ali Z (2012) First report of grapevine dieback caused by Lasiodiplodia theobromae and Neoscytalidium dimidiatum in Basrah, Southern Iraq. Afr J Biotechnol 11:16165–16171Google Scholar
  19. Alvarez MG (1976) Primer catalogo de enfermedades de plantas Mexicanas. Fitofilo 71:1–169Google Scholar
  20. Alves A, Linaldeddu BT, Deidda A, Scanu B, Phillips AJL (2014) The complex of Diplodia species associated with Fraxinus and some other woody hosts in Italy and Portugal. Fungal Divers 67:143–156Google Scholar
  21. Amrani L, Corio-Costet M-F (2006) A single nucleotide polymorphism in the ß-tubulin gene distinguishing two genotypes of Erysiphe necator expressing different symptoms on grapevine. Plant Pathol 55:505–512Google Scholar
  22. Anderson IC, Cairney JW (2004) Diversity and ecology of soil fungal communities: increased understanding through the application of molecular techniques. Environ microbiol 6:769–779PubMedGoogle Scholar
  23. Ann PJ, Chang T-T, Ko W-H (2002) Phellinus noxius brown root rot of fruit and ornamental trees in Taiwan. Plant Dis 86:820–826Google Scholar
  24. Anonymous (1960) Index of plant diseases in the United States. U.S.D.A. Agricultural Handbook 165:1–531Google Scholar
  25. Anonymous (1979) List of plant diseases in Taiwan. The Plant Protection Society of The Republic of China, TaichungGoogle Scholar
  26. Ariyawansa HA, Thambugala KM, Manamgoda DS, Jayawardena R, Camporesi E, Boonmee S, Wanasinghe DN, Phookamsak R, Hongsanan S, Singtripop C, Chukeatirote E (2015) Towards a natural classification and backbone tree for Pleosporaceae. Fungal Divers 71:85–139Google Scholar
  27. Armijo G, Schlechter R, Agurto M, Muñoz D, Nuñez C, Arce-Johnson P (2016) Grapevine pathogenic microorganisms: understanding infection strategies and host response scenarios. Front Plant Sci 7:382PubMedPubMedCentralGoogle Scholar
  28. Arnold GRW (1986) Lista de Hongos Fitopatogenos de Cuba. Ministerio de Cultura Editorial Cientifico-Tecnica, HabanaGoogle Scholar
  29. Arthur JC (1918) Uredinales of Guatemala based on collections by E.W.D. Holway. I. Introduction. Coleosporiaceae and Uredinaceae. Am J Bot 5:325–336Google Scholar
  30. Arzanlou M, Moshari S, Bakhshi M, Khodaie S (2012) Botryosphaeria dothidea associated with grapevine decline disease in Iran. Australas Plant Dis Notes 7:197–200Google Scholar
  31. Arzanlou M, Narmani A, Moshari S, Khodaei S, Babai-Ahari A (2013) Truncatella angustata associated with grapevine trunk disease in Northern Iran. Arch Phytopathol Pflanzenschutz 46:1168–1181Google Scholar
  32. Arzanlou M, Narmani A, Khodaei S, Moshari S (2014) Pome and stone fruit trees as possible resevoir hosts for Phaeoacremonium spp., the causal agents of grapevine esca disease, in Iran. Arch Phytopathol Pflanzenschutz 47:717–727Google Scholar
  33. Auger J, Esterio M, Ricke G, Perez I (2004a) Black dead arm and basal canker of Vitis vinifera cv. red globe cause by Botryosphaeria obtuse in Chile. Plant Dis 88:1286Google Scholar
  34. Auger J, Esterio M, Perez I, Gubler WD, Eskalen A (2004b) First report of Phaeomoniella chlamydospora on Vitis vinifera and French American hybrids in Chile. Plant Dis 88:1285Google Scholar
  35. Bai J-K (ed) (2000) Flora Fungorum Sinicorum. Sphaeropsidales, Phoma, Phyllosticta, vol 15. Science Press, BeijingGoogle Scholar
  36. Baker RED, Dale WT (1951) Fungi of Trinidad and Tobago. Mycol Pap 33:1–123Google Scholar
  37. Bakhshi M, Arzanlou M (2017) Multigene phylogeny reveals a new species and novel records and hosts in the genus Ramularia from Iran. Mycol Progr 16:703–712Google Scholar
  38. Bakhshi M, Arzanlou M, Babai-Ahari A (2012) Comprehensive check list of Cercosporoid fungi from Iran. Plant Pathol Quar 2:44–55Google Scholar
  39. Balmas V, Scherm B, Ghignone S, Salem AOM, Cacciola SO, Migheli Q (2005) Characterisation of Phoma tracheiphila by RAPD-PCR, microsatellite-primed PCR and ITS rDNA sequencing and development of specific primers for in planta PCR detection. Eur J Plant Pathol 111:235–247Google Scholar
  40. Baloyi MA, Halleen F, Mostert L, Eskalen A (2013) First report of Togninia minima perithecia on esca- and Petri-diseased grapevines in South Africa. Plant Dis 97:1247Google Scholar
  41. Barbe GD, Hewitt WB (1965) Principal fungus in summer bunch rot of grapes. Phytopathology 55:815Google Scholar
  42. Baroncelli R, Sreenivasaprasad S, Lane CR, Thon MR, Sukno SA (2014) First report of Colletotrichum acutatum sensu lato (Colletotrichum godetiae) causing anthracnose on grapevine (Vitis vinifera) in the United Kingdom. New Dis Rep 29:26Google Scholar
  43. Barr ME (1990) Some dictyosporous genera and species of Pleosporales in North America. N Y Bot Gard 62:1–92Google Scholar
  44. Barr ME (1992) Notes on the Lophiostomataceae (Pleosporales). Mycotaxon 45:191–221Google Scholar
  45. Baskarathevan J, Jaspers MV, Jones EE, Ridgway HJ (2008) Distribution of Botryosphaeria species causing grapevine dieback and decline in New Zealand vineyards. NZ Plant Protect 61:392Google Scholar
  46. Baskarathevan J, Jaspers MV, Ridgway HJ, Eirian JE (2012) Incidence and distribution of Botryosphaeriaceous species in New Zealand vineyards. Eur J Plant Pathol 132:549–560Google Scholar
  47. Bastide F, Serandat I, Gombert J, Laurent E, Morel E, Kolopp J, Guillermin PL, Hamon B, Simoneau P, Berruyer R, Poupard P (2017) Characterization of fungal pathogens (Diaporthe angelicae and D. eres) responsible for umbel browning and stem necrosis on carrot in France. Plant Pathol 66:239–253Google Scholar
  48. Batista AC, Ciferri R (1962) The Chaetothyriales. Sydowia 3:1–129Google Scholar
  49. Batra LR (1973) Nematosporaceae (Hemiascomycetidae): taxonomy, pathogenicity, distribution, and vector relationships. U.S.D.A. Agric Res Serv Tech Bull 1469:1–71Google Scholar
  50. Baumgartner K, Fujiyoshia PT, Travadon R, Castlebury LA, Wilcox WF, Rolshausen PE (2013) Characterization of species of Diaporthe from wood cankers of grape in eastern North American vineyards. Plant Dis 97:912–920Google Scholar
  51. Beale RE, Pitt D (1990) Biological and integrated control of Fusarium basal rot of Narcissus using Minimedusa polyspora and other micro-organisms. Plant Pathol 39:477–488Google Scholar
  52. Bechet M, Sapta-Forda A (1981) Investigation on the growth, development and control of Alternaria vitis Cav., the pathogen of alternariosis of grapevine. Romania Univ’ersitatea Babes-Bloya, pp 147–156Google Scholar
  53. Begon M, Harper JL, Townsend CR (1993) Ecology: Individuals, Population and Communities, 3rd edn. Blackwell Science, BostonGoogle Scholar
  54. Begoude AD, Slippers B, Wingfeld MJ, Roux J (2010) Botryosphaeriaceae associated with Terminalia catappa in Cameroon, South Africa and Madagascar. Mycol Progr 9:101–123Google Scholar
  55. Benavides PG, Zamorano PM, Ocete CA, Maistrello L, Ocete R (2013) Biodiversity of pathogenic wood fungi isolated from Xylotrechus arvicola (Olivier) galleries in vine shoots. OENO One 47:73–81Google Scholar
  56. Bendezu-Euribe MV, Alvarez LA (2012) The perfect stage of powdery mildew of grapevine caused by Erysiphe necator found in Peru. Plant Dis 96:768Google Scholar
  57. Benjamin CR, Slot A (1969) Fungi of Haiti. Sydowia 23:125–163Google Scholar
  58. Bensch K, Groenewald JZ, Braun U, Dijksterhuis J, de Jesús Y-MM, Crous PW (2015) Common but different: the expanding realm of Cladosporium. Stud Mycol 82:23–74PubMedPubMedCentralGoogle Scholar
  59. Berkeley MJ (1872) Notices of North American fungi. Grevillea 1:33–39Google Scholar
  60. Berndt R (2004) A checklist of Costa Rican rust fungi. In: Agerer R, Piepenbring M, Blanz P (eds) Frontiers in Basidiomycete Mycology. IHW-Verlag, BerlinGoogle Scholar
  61. Berraf-Tebbal A, Bouznad Z, Santos JM, Coelho MA, Peros J-P, Phillips AJL (2011) Phaeoacremonium species associated with Eutypa dieback and esca of grapevines in Algeria. Phytopathol Mediterr 50:S86–S97Google Scholar
  62. Berraf-Tebbal A, Guereiro MA, Phillips AJL (2014) Phylogeny of Neofusicoccum species associated with grapevine trunk disease in Algeria, with decription of Neofusicoccum algeriense sp. nov. Phytopathol Mediterr 53:416–427Google Scholar
  63. Berthier J (1976) Monographie des Typhula, Pistillaria et des genres voisins. Bull Soc Linn Lyon 45:1–213Google Scholar
  64. Bezerra JL, De Lima TEF (2012) Phaeotrichoconis crotalariae, endophytic on Vitis labrusca, in Brazil. Mycotaxon 120:291–294Google Scholar
  65. Billones RG, Ridgway HJ, Jones EE, Jaspers MV (2010) First report of Neofusicoccum macroclavatum as a canker pathogen of grapevine in New Zealand. Plant Dis 94:1504Google Scholar
  66. Blair JE, Coffey MD, Park SY, Geiser DM, Kang S (2008) A multi-locus phylogeny for Phytophthora utilizing markers derived from complete genome sequences. Fungal Genet Biol 45:266–277PubMedGoogle Scholar
  67. Bobev S (2009) Reference guide for the diseases of cultivated plants. http://nt.ars-grin.gov/fungaldatabases
  68. Boesewinkel HJ (1982) A list of 142 new plant disease recordings from New Zealand and short notes on three diseases. Australas Plant Pathol 11:40–43Google Scholar
  69. Boidin J, Lanquetin P (1987) Le genre Scytinostroma Donk (basidiomycetes, Lachnocladiaceae). Biblioth Mycol 114:1–130Google Scholar
  70. Bokulich NA, Subramanian S, Faith JJ, Gevers D, Gordon JI, Knight R, Mills DA, Caporaso JG (2013) Quality-filtering vastly improves diversity estimates from Illumina amplicon sequencing. Nat Methods 10:57–59PubMedGoogle Scholar
  71. Bokulich NA, Thorngate JH, Richardson PM, Millis DA (2014) Microbial biogeography of wine grapes is conditioned by cultivar, vintage and climate. Proc Natl Acad Sci 111:E139–E148PubMedGoogle Scholar
  72. Bolay A (2005) Powdery mildews of Switzerland (Erysiphaceae). Cryptogr Helv 20:1–176Google Scholar
  73. Booth C (1966) The genus Cylindrocarpon. Mycol Pap 104:1–56Google Scholar
  74. Brasier CM, Sanchez-Hernandez E, Kirk SA (2003) Phytophthora inundata sp. nov., a part heterothallic pathogen of trees and shrubs in wet or flooded soils. Mycol Res 107:477–484PubMedGoogle Scholar
  75. Braun U (1998) A monograph of Cercosporella, Ramularia and allied genera (Phytopathogenic Hyphomycetes), vol 2. IHW-Verlag, Eching, p 337Google Scholar
  76. Braun U, Crous PW, Dugan F, Groenewald JE, De Hoog GS (2003) Phylogeny and taxonomy of Cladosporium-like hyphomycetes, including Davidiella gen. nov., the teleomorph of Cladosporium s. str. Mycol Prog 2:3–18Google Scholar
  77. Brenckle JF (1918) North Dakota fungi—II. Mycologia 10:199–221Google Scholar
  78. Briceno EX, Latorre BA (2007) Outbreaks of Cladosporium rot associated with delayed harvest wine grapes in Chile. Plant Dis 91:1060Google Scholar
  79. Briceno EX, Latorre BA (2008) Characterization of Cladosporium rot in grapevines, a problem of growing importance in Chile. Plant Dis 92:1635–1642Google Scholar
  80. Bucher VVC, Hyde KD, Pointing SB, Reddy CA (2004) Production of wood decay enzymes, mass loss and lignin solubilization in wood by marine ascomycetes and their anamorphs. Fungal Divers 15:1–14Google Scholar
  81. Burdsall HH Jr (1976) A new species of Laeticorticium (Aphyllophorales, Corticiaceae) from the southern Appalachians. J Elisha Mitchell Sci Soc 91:243–245Google Scholar
  82. Burdsall HH Jr (1985) A contribution to the taxonomy of the genus Phanerochaete. Mycol Mem 10:1–165Google Scholar
  83. Burgess TI, Barber PA, Hardy J (2005) Bothryosphaeria spp. associated with Eucalyptus in Western Australia including description of Fusicoccum macroclavatum sp. nov. Australas Plant Pathol 34:557–567Google Scholar
  84. Buritica P (1999) La familia Phakopsoraceae en el neotropico III, generos: Batistopsora y Phakopsora. Rev Acad Colomb Cienc 23:271–305Google Scholar
  85. Buritica P, Pardo Cardona VM (1996) Flora Uredineana Colombiana. Rev Acad Colomb Cienc 20:183–236Google Scholar
  86. Cai L, Udayanga D, Manamgoda DS, Maharachchikumbura SSN, McKenzie EHC, Guo LD, Liu XZ, Bahkali A, Hyde KD (2011) The need to carry out re-inventory of plant pathogenic fungi. Trop Plant Pathol 36:205–213Google Scholar
  87. Campbell WA, Miller JH, Thompson GE (1950) Notes on some wood-decaying fungi of Georgia. Plant Dis Rep 34:128–134Google Scholar
  88. Candolfi-Arballo O, Valenzuela-Solano C, Gubler WD, Hernández-Martínez R (2010) Botryosphaeriaceae species associated with grapevine decline in Mexico. Phytopathol Mediterr 49:105–106Google Scholar
  89. Cannon PF, Hawksworth DL, Sherwood-Pike MA (1985) The British ascomycotina: An annotated checklist. Commonwealth Mycological Institute, Kew, SurreyGoogle Scholar
  90. Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD, Costello EK, Fierer N, Peña AG, Goodrich JK, Gordon JI, Huttley GA (2010) QIIME allows analysis of high-throughput community sequencing data. Nat Methods 7:335–336PubMedPubMedCentralGoogle Scholar
  91. Carlucci A, Frisullo S (2009) First report of Diplodia corticola on grapevine in Italy. J Plant Pathol 91:231–240Google Scholar
  92. Carlucci A, Cibelli F, Lops F, Raimondo ML (2015) Characterization of Botryosphaeriaceae species as causal agents of trunk disease on Grapevines. Plant Dis 99:1678–1688Google Scholar
  93. Carlucci A, Lops F, Mostert L, Halleen F, Raimondo ML (2017) Occurrence fungi causing black foot on young grapevines and nursery rootstock plants in Italy. Phytopathol Mediterr 56:10–39Google Scholar
  94. Carmaran CC, Novas MV (2003) A review of spegazzini taxa of Periconia and Sporocybe after over 115 years. Fungal Divers 14:67–76Google Scholar
  95. Carraro L, Maifreni M, Bartolomeoli I, Martino ME, Novelli E, Frigo F, Marino M, Cardazzo B (2011) Comparison of culture-dependent and -independent methods for bacterial community monitoring during Montasio cheese manufacturing. Res Microbiol 162:231–239PubMedGoogle Scholar
  96. Carter MV (1991) The status of Eutypa lata as a pathogen. Phytopathol Pap 32:1–59Google Scholar
  97. Cash EK (1952) A record of the fungi named by J.B. Ellis (Part 1). U.S.D.A. Spec Publ 2:1–165Google Scholar
  98. Cash EK (1953) A record of the fungi named by J.B. Ellis (Part 2). U.S.D.A. Spec Publ 2:167–345Google Scholar
  99. Cash EK (1954) A record of the fungi named by J.B. Ellis (Part 3). U.S.D.A. Spec Publ 2:347–518Google Scholar
  100. Casieri L, Hofstetter V, Viret O, Gindro K (2009) Fungal communities living in the wood of different cultivars of young Vitis vinifera plants. Phytopathol Mediterr 48:73–83Google Scholar
  101. Castellani E, Ciferri R (1937) Prodromus Mycoflorae Africae Orientalis Italicae. Istituto Agricolo Coloniale Italiano, FirenzeGoogle Scholar
  102. Castillo-Pando M, Somers A, Green CD, Priest M, Sriskathades M (2001) Fungi associated with dieback of Semillon grapevines in the Hunter Valley of New South Wales. Australas Plant Pathol 30:59–63Google Scholar
  103. Cavara F (1888) Intorno al disseccamento dei grappoli della vite. Atti dell’Istituto Botanico della Università e Laboratorio Crittogamico di Pavia 1:293–324Google Scholar
  104. Cavara F (1889) I Funghi Parassiti delle Piante Coltivate ed Utili Essicati, Delineati e Descriti: 21Google Scholar
  105. Chandra S (1974) Some new leaf-spot diseases from Allahabad (India). Nova Hedwig 47:35–102Google Scholar
  106. Chardon CE, Toro RA (1930) Mycological explorations of Colombia. J Dept Agric Porto Rico 14:195–369Google Scholar
  107. Chatasiri S, Ono Y (2008) Phylogeny and taxonomy of the Asian grapevine leaf rust fungus, Phakopsora euvitis, and its allies (Uredinales). Mycoscience 49:66–74Google Scholar
  108. Chebil S, Fersi R, Yakoub A, Chenenaoui S, Chattaoui M, Melki I, Zemni H, Rhouma A, Durante G, Zacchi E, Mliki A (2014) First report of Botryosphaeria dothidea, Diplodia seriata, and Neofusicoccum luteum associated with canker and dieback of grapevines in Tunisia. Plant Dis 98:420Google Scholar
  109. Checa J (2004) Dictyosporic Dothideales. Flora Mycol Iber 6:1–162Google Scholar
  110. Chen Q, Jiang JR, Zhang GZ, Cai L, Crous PW (2015) Resolving the Phoma enigma. Stud Mycol 82:137–217PubMedPubMedCentralGoogle Scholar
  111. Chethana KWT, Zhou Y, Zhang W, Liu M, Xing QK, Li XH, Yan JY (2017) Coniella vitis sp. nov. is the common pathogen of white rot in Chinese vineyards. Plant Dis 101:2123–2136Google Scholar
  112. Chiarappa L (1959) Wood decay of the grapevine and its relationship with black measles disease. Phytopathology 49:510–519Google Scholar
  113. Chicau G, Aboim-Inglez M, Cabral S, Cabral JPS (2000) Phaeoacremonium chlamydosporum and Phaeoacremonium angustius associated with esca and grapevine decline in Vinho Verde grapevines in northwest Portugal. Phytopathol Mediterr 39:80–86Google Scholar
  114. Cho WD, Shin HD (eds) (2004) List of plant diseases in Korea, 4th edn. Korean Society of Plant Pathology, SuwonGoogle Scholar
  115. Chomnunti P, Hongsanan S, Aguirre-Hudson B, Tian Q, Peršoh D, Dhami MK, Alias AS, Xu J-C, Liu X-Z, Stadler M, Hyde KD (2014) The sooty moulds. Fungal Divers 66:1–36Google Scholar
  116. Choueiri E, Jreijiri F, Chlela P, Louvet G, Lecomte P (2006) Occurrence of grapevine decline and first report of black dead arm associated with Botryosphaeria obtusa in Lebanon. Plant Dis 90:115Google Scholar
  117. Choueiri E, Jreijiri F, El Amil R, Chlela P, Bugaret Y, Liminana JM, Mayet V, Lecomte P (2009) First report of black foot disease associated with Cylindrocarpon sp. in Lebanon. J Plant Pathol 91:231–240Google Scholar
  118. Chupp C (1953) Monograph of the fungus genus Cercospora. Author, IthacaGoogle Scholar
  119. Ciferri R (1929) Micoflora Domingensis. Lista de los hongos hasta la fecha indicados en Santo Domingo. Publ Estac Estac Agron Moca Ser B Bot 14:1–260Google Scholar
  120. Ciferri R (1961) Mycoflora Domingensis Integrata. Quaderno 19:1539Google Scholar
  121. Cinelli T, Mondello V, Marchi G, Burruano S, Alves A, Mugnai L (2016) First report of Diaporthe eres associated with cane blight of grapevine (Vitis vinifera) in Italy. Plant Dis 100:532Google Scholar
  122. Cloete M, Fischer M, Mostert L, Halleen F (2014) A novel Fomitiporia species associated with esca on grapevine in South Africa. Mycol Prog 13:303–311Google Scholar
  123. Cloete M, Fischer M, Mostert L, Halleen F (2015) Hymenochaetales associated with esca-related wood rots on grapevine with a special emphasis on the status of esca in South African vineyards. Phytopathol Mediterr 54:299–312Google Scholar
  124. Cloete M, Fischer M, Du Plessis IL, Mostert L, Halleen F (2016) A new species of Phellinus sensu stricto associated with esca on grapevine in South Africa. Mycol Prog 15:25Google Scholar
  125. Comont G, Mayet V, Corio-Costet MF (2016) First report of Lasiodiplodia viticola, Spencermartinsia viticola and Diplodia intermedia associated with Vitis vinifera grapevine decline in French vineyards. Plant Dis 100:2328Google Scholar
  126. Cook RP, Dubé AJ (1989) Host–pathogen index of plant diseases in South Australia. South Australian Department of Agriculture, AdelaideGoogle Scholar
  127. Cooke MC (1878) Ravenel’s American fungi. Grevillea 6:129–146Google Scholar
  128. Cooke WB (1983) The 1979 Oklahoma foray. Mycologia 75:752–755Google Scholar
  129. Correia KC, Camara MPS, Barbosa MAG, Sales R, Agusti-Brisach C, Gramaje D, Leon M, Garcia-Jimenez J, Abad-Campos P, Armengol J, Michereff SJ (2013) Fungal trunk pathogens associated with table grape decline in Northeastern Brazil. Phytopathol Mediterr 52:380–387Google Scholar
  130. Correia KC, Silva MA, Netto MSB, Vieira WAS, Camara MPS, Michereff SJ (2016a) First report of grapevine dieback caused by Neoscytalidium hyalinum in Brazil. Plant Dis 100:213Google Scholar
  131. Correia KC, Silva MA, de Morais Jr MA, Armengol J, Phillips AJL, Camara MPS, Michereff SJ (2016b) Phylogeny, distribution and pathogenicity of Lasiodiplodia species associated with dieback of table grape in the main Brazilian exporting region. Plant Pathol 65:92–103Google Scholar
  132. Costa MEA, Camara MS (1952) Species Aliquae Mycologicae Lusitaniae. Portugaliae Acta Biol Ser A 3:294–307Google Scholar
  133. Coutinho IBL, Freire FCO, Lima CS, Lima JS, Goncalves FJT, Machado AR, Silva AMS, Cardoso JE (2017) Diversity of genus Lasiodiplodia associated with perennial tropical fruit plants in northeastern Brazil. Plant Pathol 66:90–104Google Scholar
  134. Crane JL, Shearer CA (1991) A nomenclator of Leptosphaeria V. Cesati & G. DeNotaris. Ill Nat Hist Surv Biol Notes 34:1–355Google Scholar
  135. Crous PW, Braun U (2003) Mycosphaerella and its anamorphs: 1. Names published in Cercospora and Passalora. Centraalbureau voor Schimmelcultures, UtrechtGoogle Scholar
  136. Crous PW, Gams W (2000) Phaeomoniella chlamydospora gen. et comb. nov., a causal organism of Petri grapevine decline and esca. Phytopathol Mediterr 39:112–118Google Scholar
  137. Crous PW, Braun U, Wingfield MJ, Wood AR, Shin HD, Summerell BA, Alfenas AC, Cumagun CJR, Groenewald JZ (2009) Phylogeny and taxonomy of obscure genera of microfungi. Persoonia 22:139–161PubMedPubMedCentralGoogle Scholar
  138. Crous PW, Wingfield MJ, Guarro J, Hernandez-Restrepo M, Sutton DA, Acharya K, Barber PA, Boekhout T, Dimitrov RA, Duenas M, Dutta AK, Gene J, Gouliamova DE, Groenewald M, Lombard L, Morozova OV, Sarkar J, Smith MTh, Stchigel AM, Wiederhold NP, Alexandrova AV, Antelmi I, Armengol J, Barnes I, Cano-Lira JF, Castaneda-Ruiz RF, Contu M, PrR Courtecuisse, da Silveira AL, Decock CA, de Goes A, Edathodu J, Ercole E (2015) Fungal Planet description sheets: 320–370. Persoonia 34:167–266PubMedPubMedCentralGoogle Scholar
  139. Crous PW, Wingfield MJ, Burgess TI, St J Hardy GE, Barber PA, Alvarado P, Barnes CW, Buchanan PK, Heykoop M, Moreno G, Thangavel R, van der Spuy S, Barili A, Barrett S, Cacciola SO, Cano-Lira JF, Crane C, Decock C, Gilbertoni TB, Guarro J, Guevara-Suarez M, Hubka V, Kolarik M, Lira CRS, Ordonez ME, Padamsee M, Ryvarden L, Soares AM, Stchigel AM, Sutton DA, Vizzini A, Weir BS, Acharya K, Aloi F (2017) Fungal Planet description sheets: 558–624. Persoonia 38:240–384PubMedPubMedCentralGoogle Scholar
  140. Cruywagen EM, Slippers B, Roux J, Wingfield MJ (2017) Phylogenetic species recognition and hybridisation in Lasiodiplodia: a case study on species from baobabs. Fungal Biol 121:420–436PubMedGoogle Scholar
  141. Cunningham GH (1965) Polyporaceae of New Zealand. Bull N Z Dept Ind Res 164:1–304Google Scholar
  142. Cunnington J (2003) Pathogenic fungi on introduced plants in Victoria. A host list and literature guide for their identification. Department of Primary Industries, VictoriaGoogle Scholar
  143. Cunnington JH, Priest MJ, Powney RA, Cother NJ (2007) Diversity of Botryosphaeria species on horticultural plants in Victoria and New South Wales. Australas Plant Pathol 36:157–159Google Scholar
  144. da Silva MA, Correia KC, Barbosa MAG, Camara MPS, Gramaje D, Michereff SJ (2017) Characterization of Phaeoacremonium isolates associated with petri disease of table grape in Northeastern Brazil, with description of Phaeoacremonium nordesticola sp. nov. Eur J Plant Pathol 149:695–709Google Scholar
  145. Daamen RA, Langerak CJ, Stol W (1991) Surveys of cereal diseases and pests in the Netherlands 3. Monographella nivalis and Fusarium spp. in winter wheat fields and seed lots. Neth J Plant Pathol 97:105–114Google Scholar
  146. Damm U, Crous PW, Fourie PH (2007) Botryosphaeriaceae as potential pathogens of Prunus species in South Africa, with descriptions of Diplodia africana and Lasiodiplodia plurivora sp. nov. Mycologia 99:664–680PubMedGoogle Scholar
  147. Damm U, Woudenberg JHC, Cannon PF, Crous PW (2009) Colletotrichum species with curved conidia from herbaceous hosts. Fungal Divers 39:45–87Google Scholar
  148. Damm U, Cannon PF, Woudenberg JHC, Crous PW (2012) The Colletotrichum acutatum species complex. Stud Mycol 73:37–113PubMedPubMedCentralGoogle Scholar
  149. Daranagama DA, Camporesi E, Jeewon R, Liu XZ, Stadler M, Lumyong S, Hyde KD (2016) Taxonomic rearrangement of Anthostomella (Xylariaceae) based on a multigene phylogeny and morphology. Cryptogam Mycol 37:509–538Google Scholar
  150. de Sousa Dias MR, Lucas MT (1972) Fungi Lusitaniae XXIII. Agron. Lusit 33:173–184Google Scholar
  151. de Sousa Dias MR, Lucas MT, Lopes MC (1987) Fungi Lusitaniae XXX. Agron Lusit 42:179–188Google Scholar
  152. de Wet J, Slippers B, Preisig O, Wingfield BD, Tsopelas P, Wingfield MJ (2009) Molecular and morphological characterization of Dothiorella casuarinae sp. nov. and other Botryosphaeriaceae with diplodia-like conidia. Mycologia 101:503–511PubMedGoogle Scholar
  153. Deighton FC (1976) Studies on Cercospora and allied genera. VI. Pseudocercospora Speg., Pantospora Cif. and Cercoseptoria Petr. Mycol Pap 140:1–168Google Scholar
  154. Deighton J (2016) Fungi in ecosystem processes, vol 31. CRC Press, Boca RatonGoogle Scholar
  155. Denaree JB, Runner GA (1942) Control of grape diseases and insects in Eastern United States. Diseases principally of Amaerican bunch grapes. US Dept Agr Farm Bull 1893:1–28Google Scholar
  156. Dennis RWG (1964) Remarks on the genus Hymenoscyphus S.F. Gray, with observations on sundry species referred by Saccardo and others to the genera Helotium Pezizella or Phialea. Persoonia 3:29–80Google Scholar
  157. Dennis RWG (1970) Kew Bulletin Additional Series III. Fungus flora of Venezuela and adjacent countries. Verlag von J Cramer, WeinheimGoogle Scholar
  158. Diaz GA, Latorre BA (2014) Infection caused by Phaeomoniella chlamydospora associated with esca-like symptoms in grapevine in Chile. Plant Dis 98:351–360Google Scholar
  159. Diaz GA, Prehn D, Latorre BA (2011) First report of Cryptovalsa ampelina and Eutypella leprosa associated with grapevine trunk diseases in Chile. Plant Dis 95:490Google Scholar
  160. Diaz GA, Elfar K, Latorre BA (2012) First report of Seimatosporium botan associated with trunk disease of grapevine (Vitis vinifera) in Chile. Plant Dis 96:1696Google Scholar
  161. Diaz G, Auger J, Besoain X, Bordeu E, Latorre BA (2013) Prevalence and pathogenicity of fungi associated with grapevine trunk diseases in Chilean vineyards. Cien Inv Agr 40:327–339Google Scholar
  162. Dingley JM, Fullerton RA, McKenzie EHC (1981) Survey of agricultural pests and diseases. Technical Report, vol 2. Records of fungi, bacteria, algae, and angiosperms pathogenic on Plants in Cook Islands, Fiji, Kiribati, Niue, Tonga, Tuvalu, and Western Samoa. F.A.O., RomeGoogle Scholar
  163. Dissanayake AJ, Zhang W, Mei L, Chukeatirote E, Yan JY, Li XH, Hyde KD (2015) Lasiodiplodia pseudotheobromae causes pedicel and peduncle discolouration of grapes in China. Australas Plant Pathol 10:21Google Scholar
  164. Dissanayake AJ, Purahong W, Wubet T, Hyde KD, Wei Z, Xu HY, Zhang GJ, Yuan FC, Liu M, Xing Q, Li XH, Yan JY (2018) Direct comparison of culture dependent and cultire independent molecular approaches reveal the diversity of fungal endophytic communities in stems of grapevine (Vitis vinifera). Fungal Divers (Under review)Google Scholar
  165. Dohadwala MM, Vita JA (2009) Grapes and Cardiovascular Disease. J Nutr 139:1788S–1793SPubMedPubMedCentralGoogle Scholar
  166. Doidge EM (1950) The South African fungi and lichens to the end of (1945). Bothalia 5:1–1094Google Scholar
  167. Doilom MW, Shuttleworth LA, Roux J, Chukeatirote E, Hyde KD (2015) Botryosphaeriaceae associated with Tectona grandis (teak) in northern Thailand. Phytotaxa 233:1–26Google Scholar
  168. Du Z, Fan X-L, Hyde KD, Yang Q, Liang Y-M, Tian C-M (2016) Phylogeny and morphology reveal two new species of Diaporthe form Betula spp. in China. Phytotaxa 269:090–102Google Scholar
  169. Duarte S, Pascoal C, Cássio F, Bärlocher F (2006) Aquatic hyphomycete diversity and identity affect leaf litter decomposition in microcosms. Oecologia 147:658–666PubMedGoogle Scholar
  170. Dudka IO, Heluta VP, Tykhonenko YY, Andrianova TV, Hayova VP, Prydiuk MP, Dzhagan VV, Isikov VP (2004) Fungi of the Crimean Peninsula. M.G. Kholodny Institute of Botany, National Academy of Sciences of Ukraine, KievGoogle Scholar
  171. Dugan FM, Schubert K, Braun U (2004) Check-list of Cladosporium names. Schlechtendalia 11:1–103Google Scholar
  172. Dupont J, Laloui W, Roquebert MF (1998) Partial ribosomal DNA sequences show an important divergence between Phaeoacremonium species isolated from Vitis vinifera. Mycol Res 102:631–637Google Scholar
  173. Dupont J, Laloui W, Magnin S, Larignon P, Roquebert M-F (2000) Phaeoacremonium viticola, a new species associated with Esca disease of grapevine in France. Mycologia 92:499–504Google Scholar
  174. Dupont J, Magnin S, Cesari C, Gatica M (2002) ITS and β-tubulin markers help delineate Phaeoacremonium species, and the occurrence of P. parasiticum in grapevine disease in Argentina. Mycol Res 106:1143–1150Google Scholar
  175. Ebbels DL, Allen DJ (1979) A supplementary and annotated list of plant diseases, pathogens and associated fungi in Tanzania. Phytopathol Pap 22:1–89Google Scholar
  176. Edgar RC (2004) Muscle: a multiple sequence alignment method with reduced time and space complexity. BMC Bioinformatics 5:113PubMedPubMedCentralGoogle Scholar
  177. Edgar RC (2013) UPARSE: highly accurate OTU sequences from microbial amplicon reads. Nat Methods 10:996–998PubMedGoogle Scholar
  178. Edgar RC, Haas BJ, Clemente JC, Quince C, Knight R (2011) UCHIME improves sensitivity and speed of chimera detection. Bioinformatics 27:2194–2200PubMedPubMedCentralGoogle Scholar
  179. El-Buni AM, Rattan SS (1981) Check list of Libyan Fungi. Al Faateh University, Fac Sci, Dept. Bot, TripoliGoogle Scholar
  180. Elenkin AA (1909) Title unknown. Bolezni Rast 4:68Google Scholar
  181. Ellis JB, Everhart BM (1904) New species of fungi from various localities. J Mycol 10:167–170Google Scholar
  182. Epstein L (2008) Botryosphaeria-related dieback and control investigated in noncoastal California grapevines. Calif Agric 62:161–166Google Scholar
  183. Erwin DC, Ribeiro OK (1996) Phytophthora diseases worldwide. APS Press, St. PaulGoogle Scholar
  184. Esfandiari E, Petrak F (1950) Pilze aus Iran. Sydowia 4:11–38Google Scholar
  185. Eskalen A, Rooney-Latham S, Gubler WD (2005) First report of perithecia of Phaeoacremonium viticola on grapevine (Vitis vinifera) and ash tree (Fraxinus latifolia) in California. Plant Dis 89:686–686Google Scholar
  186. Essakhi S, Mugnai L, Crous PW, Groenewald JZ, Surico G (2008) Molecular and phenotypic characterisation of novel Phaeoacremonium species isolated from esca diseased grapevines. Persoonia 21:119–134PubMedPubMedCentralGoogle Scholar
  187. Fadrosh DW, Ma B, Gajer P, Sengamalay N, Ott S, Brotman RM, Ravel J (2014) An improved dual-indexing approach for multiplexed 16S rRNA gene sequencing on the Illumina MiSeq platform. Microbiome 2:6PubMedPubMedCentralGoogle Scholar
  188. Faedda R, Agosteo GE, Schena L, Mosca S, Frisullo S, di San Magnano, Lio G, Cacciola SO (2011) Colletotrichum clavatum sp. nov. identified as the causal agent of olive anthracnose in Italy. Phytopathol Mediterr 50:283–302Google Scholar
  189. Farr ML (1973) An annotated list of Spegazzini’s fungus taxa, Vol. 1. Biblioth Mycol 35:1–823Google Scholar
  190. Farr DF, Castlebury LA, Rossman AY, Erincik O (2001) Greeneria uvicola, cause of bitter rot of grapes, belongs in the Diaporthales. Sydowia 53:185–199Google Scholar
  191. Farr DF, Elliott M, Rossman AY, Edmonds RL (2005) Fusicoccum arbuti sp. nov. causing cankers on Pacific madrone in western North America with notes on Fusicoccum dimidiatum, the correct name for Scytalidium dimidiatum and Nattrassia mangiferae. Mycologia 97:730–741PubMedGoogle Scholar
  192. Fautrey F, Lambotte JBE (1896) Espèces nouvelles ou rares de la Côte d’Or. Revue Mycologique Toulouse. 18:68–71Google Scholar
  193. Ferrada EE, Diaz GA, Zoffoli JP, Latorre BA (2014) First report of blossom blight caused by Sclerotinia sclerotiorum on Japanese plum, nectarine, and sweet cherry orchards in Chile. Plant Dis 98:695Google Scholar
  194. Fischer M, Edwards J, Cunnington JH, Pascoe IG (2005) Basidiomycetous pathogens on grapevine: a new species from Australia—Fomitiporia australiensis. Mycotaxon 92:85–96Google Scholar
  195. Fischer M, Schneider P, Kraus C, Molnar M, Dubois C, D’Aguiar D, Haag N (2016) Grapevine trunk disease in German viticulture: occurence of lesser known fungi and first report of Phaeoacremonium viticola and P. fraxinopennsylvanicum. Vitis 55:145–156Google Scholar
  196. Fitt BD, Brun H, Barbetti MJ, Rimmer SR (2006) World-wide importance of phoma stem canker (Leptosphaeria maculans and L. biglobosa) on oilseed rape (Brassica napus). In: Fitt BDL, Evans N, Howlett BJ, Cooke BM (eds) Sustainable strategies for managing Brassica napus (oilseed rape) resistance to Leptosphaeria maculans (phoma stem canker). Springer, Dordrecht, pp 3–15Google Scholar
  197. Foister CE (1961) The economic plant diseases of Scotland. Techn Bull Dept Agric Fish Scotland 1:1–210Google Scholar
  198. Forster H, Coffey MD (1993) Molecular taxonomy of Phytophthora megasperma based on mitochondrial and nuclear DNA polymorphisms. Mycol Res 97:1101–1112Google Scholar
  199. Fotouhifar K-B, Hedjaroude G-A, Leuchtmann A (2010) ITS rDNA phylogeny of Iranian strains of Cytospora and associated teleomorphs. Mycologia 102:1369–1382PubMedGoogle Scholar
  200. Fourie PH, Halleen F (2002) Investigation on the occurence of Phaeomoniella chlamydospora in canes of rootstock mother vines. Australas Plant Pathol 31:425–426Google Scholar
  201. Fournier E, Gladieux P, Giraud T (2013) The ‘Dr Jekyll and Mr Hyde fungus’: noble rot versus gray mold symptoms of Botrytis cinerea on grapes. Evol Applic 6:960–969Google Scholar
  202. French AM (1987) California plant disease host index. Part 1: fruit and nuts. California Department of Food Agriculture, SacramentoGoogle Scholar
  203. French AM (1989) California plant disease host index. California Department of Food Agriculture, SacramentoGoogle Scholar
  204. Gadgil PD (2005) Fungi on trees and shrubs in New Zealand. In: Fungi of New Zealand, vol 4. Fungal Diversity Press, Hong KongGoogle Scholar
  205. Gao Z-M, Li Y-M, Li X-L, Zhang Z-H, Yiny J-F (2009) Comparison of the biological characteristics of Botrytis cinerea isolates from different hosts. Mycosystema 28:370–377Google Scholar
  206. Gaponenko NI (1965) Survey of the fungi of Bukhara. Akad Sa UzbekhGoogle Scholar
  207. García B, López L, Velázquez M, Pérez-Moreno J (1998) Mycorrhizal and saprotrophic macrofungi in declining sacred-fir stands. Micol Neotrop Apl 11:9–21Google Scholar
  208. Garcia-Benavides P, Martin Zamorano P, Ocete Perez CA, Maistrello L, Ocete Rubio R (2013) Biodiversity of pathogenic wood fungi isolated from Xylotrechus arvicola (Olivier) galleries in vine shoots. J Int Sci Vigne Vin 47:73–81Google Scholar
  209. Garcia-Blazquez G, Constantinescu O, Telleria MT, Martin MP (2006) Preliminary checklist of Albuginales and Peronosporales (Chromista) reported from the Iberian Peninsula and Balearic Islands. Mycotaxon 98:185–188Google Scholar
  210. Garnica S, Riess K, Schön ME, Oberwinkler F, Setaro SD (2016) Divergence times and phylogenetic patterns of Sebacinales, a highly diverse and widespread fungal lineage. PLoS ONE 11:e0149531PubMedPubMedCentralGoogle Scholar
  211. Gatica M, Cesari C, Magnin S, Dupont J (2001) Phaeoacremonium species and Phaeomoniella chlamydospora in vines showing “hoja de malvon” and young vine decline symptoms in Argentina. Phytopathol Mediterr 40:S317–S324Google Scholar
  212. Ge Q, Chen Y, Xu T (2009) Flora Fungorum Sinicorum. Pestalotiopsis, vol 38. Science Press, Beijing, p 235Google Scholar
  213. Georghiou GP, Papadopoulos C (1957) A second list of Cyprus fungi. Government of Cyprus, Department of Agriculture, NicosiaGoogle Scholar
  214. Gerlach W, Ershad D (1970) Beitrag zur Kenntnis der Fusarium und Cylindrocarpon-Arten in Iran. Nova Hedwig 20:725–784Google Scholar
  215. Giatgong P (1980) Host index of plant diseases in Thailand, 2nd edn. Mycology Branch, Plant Pathology and Microbiology Division, Department of Agriculture and Cooperatives, BangkokGoogle Scholar
  216. Gilbertson RL, Martin KJ, Lindsey JP (1974) Annotated check list and host index for Arizona wood-rotting fungi. Univ Arizona Agric Exp Sta Techn Bull 209:1–48Google Scholar
  217. Gilman JC (1932) First supplementary list of parasitic fungi from Iowa. Iowa State Coll J Sci 6:357–365Google Scholar
  218. Gilman JC, Archer WA (1929) The Fungi of Iowa Parasitic on Plants. Iowa State Coll J Sci 3:299–507Google Scholar
  219. Gimenez-Jaime A, Aroca A, Raposo R, Garcia-Jimenez J, Armengol J (2006) Occurrence of fungal pathogens associated with grapevine nurseries and the decline of young vines in Spain. J Phytopathol 154:598–602Google Scholar
  220. Gomes RR, Glienke C, Videira SIR, Lombard L, Groenewald JZ, Crous PW (2013) Diaporthe: a genus of endophytic, saprobic and plant pathogenic fungi. Persoonia 31:1–41PubMedPubMedCentralGoogle Scholar
  221. Gonzalez CD, Chaverri P (2017) Corinectria, a new genus to accommodate Neonectria fuckeliana and C. constricta sp. nov. from Pinus radiata in Chile. Mycol Prog 16(11–12):1015–1027Google Scholar
  222. Gonzalez Fragoso R (1916) Bosquejo de una Florula Hispalense de Micromicetos. Trab Mus Nac Ci Nat Ser Bot 10:1–221Google Scholar
  223. Gonzalez Fragoso R (1917) Fungi novi vel minus cognitarum horti botanici matritense. Trab Mus Nac Ci Nat Ser Bot 12:1–99Google Scholar
  224. Gonzalez Fragoso R (1921) Algunos Demaciaceos de la Flora espanola. Bol Real Soc Esp Hist Nat 21:93–99Google Scholar
  225. Gonzalez V, Tello ML (2011) The endophytic mycota associated with Vitis vinifera in central Spain. Fungal Diver 47:29–42Google Scholar
  226. Goos RD (2010) The Mycota of Rhode Island: a checklist of the fungi recorded in Rhode Island (including lichens and myxomycetes). R I Nat Hist Surv 4:222Google Scholar
  227. Gorter GJMA (1977) Index of plant pathogens and the diseases they cause in cultivated plants in South Africa. Republic South Africa Dept Agric Techn Serv. Pl Protect Res Inst Sci Bull 392:1–177Google Scholar
  228. Graham AB, Johnston PR, Weir BS (2009) Three new Phaeoacremonium species on grapevines in New Zealand. Australas Plant Pathol 38:505–513Google Scholar
  229. Gramaje D, Alaniz S, Perez Sierra A, Abad-Campos P, Garcia-Jimenez J, Armengol J (2008) First report of Phaeoacremonium scolyti causing petri disease of grapevine in spain. Plant Dis 92:836Google Scholar
  230. Gramaje D, Armengol J, Mohammadi H, Banihashemi Z, Mostert L (2009) Novel Phaeoacremonium species associated with petri disease and esca of grapevine in Iran and Spain. Mycologia 101:920–929PubMedGoogle Scholar
  231. Gramaje D, Aguilar MI, Armengol J (2011) First report of Phaeoacremonium krajdenii causing petri disease of grapevine in Spain. Plant Dis 95:615Google Scholar
  232. Grand LF (ed) (1985) North Carolina Plant Disease Index. North Carolina Agric Res Serv Techn Bull 240:1–157Google Scholar
  233. Grasso S (1984) Infezioni di Fusarium oxysporum e di Cylindrocarpon destructans associate a una moria di giovani piante di vite in Sicilia. Inf Fitopatol 1:59–63Google Scholar
  234. Greene HC (1955) Notes on Wisconsin parasitic fungi. XXI. Trans. Wisconsin Acad Sci 44:29–43Google Scholar
  235. Greene HC (1956) Notes on Wisconsin parasitic fungi. XXII. Trans. Wisconsin Acad Sci 45:177–191Google Scholar
  236. Greene HC (1963) Notes on Wisconsin parasitic fungi. XXIX. Trans Wisconsin Acad Sci 52:229–253Google Scholar
  237. Greene HC (1966) Notes on Wisconsin parasitic fungi. XXXII. Trans Wisconsin Acad Sci 55:147–166Google Scholar
  238. Greuter W, Poelt J, Raimondo FM (1991) A checklist of Sicillian fungi. Bocconea 2:222Google Scholar
  239. Guba EF (1961) Monograph of Monochaetia and Pestalotia. Harvard University Press, CambridgeGoogle Scholar
  240. Guerber JC, Liu B, Correll JC, Johnston PR (2003) Characterization of diversity in Colletotrichum acutatum sensu lato by sequence analysis of two gene introns, mtDNA and intron RFLPs, and mating compatibility. Mycologia 95:872–895PubMedGoogle Scholar
  241. Guo Y-L, Liu X-J (eds) (2003) Flora Fungorum Sinicorum. Mycovellosiella, Passalora, Phaeoramularia, vol. 20 Science Press, BeijingGoogle Scholar
  242. Guo LD, Huang GR, Wang Y, He WH, Zheng WH, Hyde KD (2003) Molecular identification of white morphotype strains of endophytic fungi from Pinus tabulaeformis. Mycol Res 107:680–688PubMedGoogle Scholar
  243. Haas BJ, Gevers D, Earl AM, Feldgarden M, Ward DV, Giannoukos G, Ciulla D, Tabbaa D, Highlander SK, Sodergren E, Methé B (2011) Chimeric 16S rRNA sequence formation and detection in Sanger and 454-pyrosequenced PCR amplicons. Genome Res 21:494–504PubMedPubMedCentralGoogle Scholar
  244. Halleen F, Crous PW, Petrini O (2003) Fungi associated with healthy grapevine cuttings in nurseries, with special reference to pathogens involved in the decline of young vines. Australas Plant Pathol 32:47–52Google Scholar
  245. Hammer Ø, Harper DAT, Ryan PD (2001) PAST: paleontological statistics software package for education and data analysis. Palaeontol Electron 4:1–9Google Scholar
  246. Hanlin RT (1963) A revision of the Ascomycetes of Georgia. Georgia Agric Exp Sta Mimeo Ser ns 175:1–65Google Scholar
  247. Hanlin RT (1966) Host index to the Basidiomycetes of Georgia. Georgia Agric Exp Sta Mimeo Ser ns 260:1–30Google Scholar
  248. Hansford CG (1947) New or interesting tropical fungi—I. Proc Linn Soc London 158:28–50Google Scholar
  249. Hanson CA, Fuhrman JA, Horner-Devine MC, Martiny JBH (2012) Beyond biogeographic patterns:processes shaping the microbial landscape. Nat RevMicrobiol 10:497–506Google Scholar
  250. Harvey JM (1955) A method of forecasting decay in California storage grapes. Phytopathology 45:229–232Google Scholar
  251. Henricot B, Pérez Sierra A, Prior C (2000) A new blight disease on Buxus in the UK caused by the fungus Cylindrocladium. Plant Pathol 49:805–805Google Scholar
  252. Hernandez JC (2004) Bases Corologicas de Flora Micologica Iberica. Adiciones y numeros 2179–2238. Cuad Trab Fl Micol Iber 20:1–94Google Scholar
  253. Hewitt WB (1951) Grape dead-arm control. Plant Dis Rep 35:142–143Google Scholar
  254. Hewitt WB (2015) Miscellaneous berry rots and raisin molds. In: Gubler WD, Uyemoto JK (eds) Compendium of grape diseases, disorders and pests (Wilcox WF. American phytopathological society, USA, pp 22–24Google Scholar
  255. Hirayama K, Tanaka K (2011) Taxonomic revision of Lophiostoma and Lophiotrema based on reevaluation of morphological characters and molecular analyses. Mycoscience 52:401–412Google Scholar
  256. Hirooka Y, Rossman AY, Zhuang W-Y, Salgado-Salazar C, Chaverri P (2013) Species delimitation for Neonectria coccinea group including the causal agents of beech bark disease in Asia, Europe, and North America. Mycosystema 32:485–517Google Scholar
  257. Hock J, Dittrich U, Renfro BL, Kranz J (1992) Sequential development of pathogens in the maize tarspot disease complex. Mycopathologia 117:157–161Google Scholar
  258. Hofstetter V, Buyck B, Croll D, Viret O, Couloux A, Gindro K (2012) What if esca disease of grapevine were not a fungal disease? Fungal Divers 54:51–67Google Scholar
  259. Holevas CD, Chitzanidis A, Pappas AC, Tzamos EC, Elena K, Psallidas PG, Alivizatos AS, Panagopoulos CG, Kyriakopoulou PE, Bem FP, Lazscaris DN (2000) Disease agents of cultivated plants observed in Greece from 1981 to 1990. Benaki Phytopathol Inst Kiphissia Athens 19:1–96Google Scholar
  260. Hoppe B, Purahong W, Wubet T, Kahl T, Bauhus J, Arnstadt T, Hofrichter M, Buscot F, Krüger D (2016) Linking molecular deadwood-inhabiting fungal diversity and community dynamics to ecosystem functions and processes in Central European forests. Fungal Divers 77:367–379Google Scholar
  261. Hrustic J, Delibasic G, Stankovic I, Grahovac M, Krstic B, Bulajic A, Tanovic B (2015) Monilinia spp. causing brown rot of stone fruit in Serbia. Plant Dis 99:709–717Google Scholar
  262. Hsieh W-H, Goh T-K (1990) Cercospora and similar fungi from Taiwan. Maw Chang Book, TaipeiGoogle Scholar
  263. Huang F, Udayanga D, Wang X, Hou X, Mei X, Fu Y, Hyde KD, Li H (2015) Endophytic Diaporthe associated with Citrus: a phylogenetic reassessment with seven new species from China. Fungal Biol 119:331–347PubMedGoogle Scholar
  264. Hugenholtz P, Goebel BM, Pace NR (1998) Impact of culture-independent studies on the 23 emerging phylogenetic view of bacterial diversity. J Bacteriol 180:4765–4774PubMedPubMedCentralGoogle Scholar
  265. Hyde KD, Bussaban B, Paulus B, Crous PW, Lee S, Mckenzie EH, Photita W, Lumyong S (2007) Diversity of saprobic microfungi. Biodivers Conserv 16:7–35Google Scholar
  266. Hyde Kevin D, Abd-Elsalam Kamel, Cai Lei (2010) Morphology: still essential in a molecular world. Mycotaxon 114:439–451Google Scholar
  267. Hyde KD, Nilsson RH, Alias SA, Ariyawansa HA, Blair JE, Cai L, de Cock AWAM, Dissanayake AJ, Glockling SL, Goonasekara ID, Gorczak M, Hahn M, Jayawardena RS, van Kan JAL, Laurence MH, Lévesque CA, Li XH, Liu JK, Maharachchikumbura SSN, Manamgoda DS, Martin FN, McKenzie EHC, McTaggart AR, Mortimer PE, Nair PVR, Pawłowska J, Rintoul TL, Shivas RG, Spies CFJ, Summerell BA, Taylor PWJ, Terhem RB, Udayanga D, Vaghefi N, Walther G, Wilk M, Wrzosek M, Xu JC, Yan JY, Zhou N (2014) One stop shop: backbones trees for important phytopathogenic genera: I. Fungal Divers 67:21–125Google Scholar
  268. Hyde KD, Hongsanan S, Jeewon R, Bhat DJ, McKenzie EHC, Jones EBG, Phookamsak R, Ariyawansa HA, Boonmee S, Zhao Q, Abdel-Aziz FA, Abdel-Wahab MA, Banmai S, Chomnunti P, Cui BK, Daranagama DA, Das K, Dayarathne MC, de Silva NI, Dissanayake AJ, Doilom M, Ekanayaka AH, Gibertoni TB, Góes-Neto A, Huang SK, Jayasiri SC, Jayawardena RS, Konta S, Lee HB, Li WJ, Lin CG, Liu JK, Lu YZ, Luo ZL, Manawasinghe IS, Manimohan P, Mapook A, Niskanen T, Norphanphoun C, Papizadeh M, Perera RH, Phukhamsakda C, Richter C, de Santiago ALCMA, Drechsler-Santos ER, Senanayake IC, Tanaka K, Tennakoon TMDS, Thambugala KM, Tian Q, Tibpromma S, Thongbai B, Vizzini A, Wanasinghe DN, Wijayawardene NN, Wu HX, Yang J, Zeng XY, Zhang H, Zhang JF, Bulgakov TS, Camporesi E, Bahkali AH, Amoozegar AM, Araujo-Neta LS, Ammirati JF, Baghela A, Bhatt RP, Bojantchev S, Buyck B, da Silva GA, de Lima CLF, de Oliveira RJV, de Souza CAF, Dai YC, Dima B, Duong TT, Ercole E, Mafalda-Freire F, Ghosh A, Hashimoto A, Kamolhan S, Kang JC, Karunarathna SC, Kirk PM, Kytövuori I, Lantieri A, Liimatainen K, Liu ZY, Liu XZ, Lücking R, Medardi G, Mortimer PE, Nguyen TTT, Promputtha I, Raj KNA, Reck MA, Lumyong S, Shahzadeh-Fazeli SA, Stadler M, Soudi MR, Su HY, Takahashi T, Tangthirasunun N, Uniyal P, Wang Y, Wen TC, Xu JC, Zhang ZK, Zhao YC, Zhou JZ, Zhu L (2016) Fungal diversity notes 367–490: taxonomic and phylogenetic contributions to fungal taxa. Fungal Divers 80:1–270Google Scholar
  269. Hyde KD, Norphanphoun C, Abreu VP, Bazzicalupo A, Chethana KT, Clericuzio M, Dayarathne MC, Dissanayake AJ, Ekanayaka AH, He MQ, Hongsanan S, Huang SK, Jayasiri SC, Jayawardena RS, Karunarathna A, Konta S, Kušan I, Lee H, Li J, Lin CG, Liu NG, Lu YZ, Luo ZL, Manawasinghe IS, Mapook A, Perera RH, Phookamsak R, Phukhamsakda C, Siedlecki I, Soares AM, Tennakoon D, Tian Q, Tibpromma S, Wanasinghe DN, Xiao YP, Yang J, Zeng XY, Abdel-Aziz FA, Li WJ, Senanayake IC, Shang QJ, Daranagama DA, de Silva NI, Thambugala KM, Abdel-Wahab MA, Bahkali AH, Berbee ML, Boonmee S, Bhat DJ, Bulgakov TS, Buyck B, Camporesi E, Castañeda-Ruiz RF, Chomnunti P, Doilom M, Dovana F, Gibertoni TB, Jadan M, Jeewon R, Jones EBG, Kang JC, Karunarathna SC, Lim YW, Liu JK, Liu ZY, Plautz HL Jr, Lumyong S, Maharachchikumbura SSN, Matočec N, McKenzie EHC, MeŠić A, Miller D, Pawlowska J, Pereira OL, Promputtha I, Romero AI, Ryvarden L, Su HY, Suetrong S, Tkalčec Z, Vizzini A, Wen TC, Wisitrassameewong K, Wrzosek M, Xu JC, Zhao Q, Zhao RL, Mortimer P (2017) Fungal diversity notes 603–708: taxonomic and phylogenetic notes on genera and species. Fungal Divers 87:1–235Google Scholar
  270. Jackson HS (1931) The rusts of South America based on the Holway collections—V. Mycologia 23:463–503Google Scholar
  271. Jarvis WR, Traquair JA (1984) Bunch rot of grapes caused by Aspergillus aculeatus. Plant Dis 68:718–719Google Scholar
  272. Javed S, Javaid A, Anwar W, Majeed RA, Akhtar R, Naqvi SF (2017) First Report of Botrytis Bunch Rot of Grapes Caused by Botrytis cinerea in Pakistan. Plant Dis 101:1036Google Scholar
  273. Jayawardena RS, Zhang W, Liu M, Maharachchikumbura SSN, Zhou Y, Huang J-B, Nilthong S, Wang Z-Y, Li XH, Yan JY, Hyde KD (2015) Identification and characterization of Pestalotiopsis-like fungi related to grapevine diseases in China. Fungal Biol 119:348–361PubMedGoogle Scholar
  274. Jayawardena RS, Liu M, Maharachchikumbura SS, Zhang W, Xing Q, Hyde KD, Nilthong S, Li X, Yan J (2016a) Neopestalotiopsis vitis sp. nov. causing grapevine leaf spot in China. Phytotaxa 258:63–74Google Scholar
  275. Jayawardena RS, Hyde KD, Damm U, Cai L, Liu M, Li XH, Zhang W, Zhao WS, Yan JY (2016b) Notes on currently accepted species of Colletotrichum. Mycosphere 7:1192–1260Google Scholar
  276. Jayawardena RS, Hyde KD, Chethana KWT, Daranagama DA, Dissanayake AJ, Goonasekara ID, Manawasinghe IS, Mapook A, Jayasiri SC, Karunarathne A, Li C-G, Phukhamsakda C, Senanayake IC, Wanasinghe DN, Camporesi E, Bulgakov TS, Li XH, Liu M, Zhang W, Yan JY (2018) Mycosphere Notes 102–168: saprotrophic fungi on Vitis in China, Italy, Russia and Thailand. Mycosphere 9:1–114Google Scholar
  277. Jeewon R, Hyde KD (2016) Establishing species boundaries and new taxa among fungi: recommendations to resolve taxonomic ambiguities. Mycosphere 7:1669–1677Google Scholar
  278. Jenkins AE, Bitancourt AA (1940–1963) Myrangiales Selecti Exsiccati. Nos. 1–550. Exsiccati setGoogle Scholar
  279. Jones DR, Baker RH (2007) Introductions of non-native plant pathogens into Great Britain, (1970–2004). Plant Pathol 56:891–910Google Scholar
  280. Ju Y-M, Rogers JD (1995) Pareutypella gen. nov. for two long-ostiolate pyrenomycetes from Taiwan. Mycologia 87:891–895Google Scholar
  281. Ju Y-M, Rogers JD (1999) The Xylariaceae of Taiwan (excluding Anthostomella). Mycotaxon 73:343–440Google Scholar
  282. Kakalikova L, Jankura E, Srobarova A (2009) First report of Alternaria bunch rot of grapevines in Slovakia. Australas Plant Pathol 4:68–69Google Scholar
  283. Kamal (2010) Cercosporoid fungi of India. Bishen Singh Mahendra Pal Singh, Dehra Dun, p 351Google Scholar
  284. Kanagawa T (2003) Bias and artifacts in multitemplate polymerase chain reaction (PCR). J Biosci Bioengin 96:317–323Google Scholar
  285. Kanematsu S, Minaka N, Kobayashi T, Kudo A, Ohtsu Y (2000) Molecular phylogenetic analysis of Ribosomal DNA internal transcribed spacer regions and comparison of fertility in Phomopsis isolates from fruit trees. J Gen Plant Pathol 66:191–201Google Scholar
  286. Kantschaveli LA (1928) New species of fungi from Georgia. Bolezni Rastenij 17:81–94Google Scholar
  287. Karimi MR, Mahmoodi B, Kazemiyan M (2001) First report of esca of grapevine in Iran. Phytopathol Mediterr 40:S481Google Scholar
  288. Kepley JB, Reeves FB, Jacobi WR, Adams GC (2015) Species associated with Cytospora canker on Populus tremuloides. Mycotaxon 130:783–805Google Scholar
  289. Kern FD, Thurston HW Jr, Whetzel HH (1934) Uredinales. Monogr Univ Puerto Rico B 2:262–303Google Scholar
  290. Khan S, Kamal M (1974) Additions to the parasitic fungi of West Pakistan—III. Mycopathol Mycol Appl 52:29–43Google Scholar
  291. Kim J-D, Shin HD (1998) Taxonomic studies on Cercospora and allied genera in Korea (I). Korean J Mycol 26:327–341Google Scholar
  292. Kim WK, Sang HK, Woo SK, Park MS, Paul NC, Yu SH (2007) Six species of Penicillium associated with blue mold of grape. Mycobiology 35:180–185PubMedPubMedCentralGoogle Scholar
  293. Ko TWK, Stephenson SL, Bahkali AH, Hyde KD (2011) From morphology to molecular biology: can we use sequence data to identify fungal endophytes? Fungal Divers 50:113Google Scholar
  294. Kobayashi T (2007) Index of fungi inhabiting woody plants in Japan. Host, distribution and literature. Zenkoku-Noson-Kyoiku Kyokai Publishing, TokyoGoogle Scholar
  295. Koike ST, Bettiga LJ, Nguyen TT, Gubler WD (2016) First report of Cylindrocladiella lageniformis and C. peruviana as grapevine pathogens in California. Plant Dis 100:1783–1784Google Scholar
  296. Kõljalg U, Nilsson RH, Abarenkov K, Tedersoo L, Taylor AF, Bahram M, Bates ST, Bruns TD, Bengtsson-Palme J, Callaghan TM, Douglas B (2013) Towards a unified paradigm for sequence-based identification of fungi. Mol Ecol 22:5271–5277PubMedGoogle Scholar
  297. Konstantinia-Sulidu A (1939) Parasitische Pilze Mazedoniens. Hedwig 78:284–298Google Scholar
  298. Korf RP, Pearson RC, Zhuang WY, Dubos B (1986) Pseudopezicula (Helotiales, Peziculoideae), a new discomycete genus for pathogens causing an angular leaf scorch of grapes (“Rotbrenner”). Mycotaxon 26:457–471Google Scholar
  299. Koshkelova EN, Frolov IP (1973) Microflora of Kopet-Dag lowland and Central Karakum (micromycetes). Ylym, AshkhabadGoogle Scholar
  300. Kotlaba F (1997) Some uncommon or rare polypores (Polyporales s.l.) collected on uncommon hosts. Czech Mycol 50:133–142Google Scholar
  301. Kozich JJ, Westcott SL, Baxter NT, Highlander SK (2013) Schloss PD: development of a dual-index sequencing strategy and curation pipeline for analyzing amplicon sequence data on the MiSeq Illumina sequencing platform. Appl Environ Microbiol 79:5112–5120PubMedPubMedCentralGoogle Scholar
  302. Kubatova A, Kolarik M, Pazoutova S (2004) Phaeoacremonium rubrigenum-Hyphomycete associated with bark beetles found in Czechia. Folia Microbiol 49:99–104Google Scholar
  303. Kubartova A, Ottosson E, Dahlberg A, Stenlid J (2012) Patterns of fungal communities among and within decaying logs, revealed by 454sequencing. Mol Ecol 21:4514–4532PubMedGoogle Scholar
  304. Kummuang N, Smith BJ, Diehl SV, Graves CH Jr (1996) Muscadine grape berry rot diseases in Mississippi: disease identification and incidence. Plant Dis 80:238–243Google Scholar
  305. Kunin V, Engelbrektson A, Ochman H, Hugenholtz P (2010) Wrinkles in the rare biosphere: pyrosequencing errors can lead to artificial inflation of diversity estimates. Environ Microbiol 12:118–123PubMedGoogle Scholar
  306. Kuntze O (1898) Revisio generum plantarum: vascularium omnium atque cellularium multarum secundum leges nomeclaturae internationales cum enumeratione plantarum exoticarum in itinere mundi collectarum. A. Felix 3:1–576Google Scholar
  307. Kuo K-C, Leu L-S (1998) Phomopsis vitimegaspora: a new pathogenic Phomopsis from vines. Mycotaxon 66:497–499Google Scholar
  308. Lane C, Kirk P (2012) Introduction to fungal plant pathogens. CAB International, Cambridge, pp 1–6Google Scholar
  309. Langrell SRH, Morel O, Robin C (2011) Touchdown nested multiplex PCR detection of Phytophthora cinnamomi and P. cambivora from French and English chestnut grove soils. Fungal Biol 115:672–682PubMedGoogle Scholar
  310. Lardner R, Stummer BE, Sosnowski MR, Scott ES (2005) Molecular identification and detection of Eutypa lata in grapevine. Mycol Res 109:799–808PubMedGoogle Scholar
  311. Larignon P, Dubos B (1997) Fungi associated with esca disease in grapevine. Eur J Plant Pathol 103:147–157Google Scholar
  312. Larignon P, Dubos B (2001) The villainy of black dead arm. Wines Vines 82:86–89Google Scholar
  313. Larsen MJ, Nakasone KK (1984) Additional new taxa of Laeticorticium (Aphyllophorales, Corticiaceae). Mycologia 76:528–532Google Scholar
  314. Larter LNH, Martyn EB (1943) A preliminary list of plant diseases in Jamaica. Mycol Pap 8:1–16Google Scholar
  315. Latorre BA, Guerrero MJ (2001) First report of shoot blight of grapevine caused by Sclerotinia sclerotiorum in Chile. Plant Dis 85:1122Google Scholar
  316. Lawrence DP, Travadon R, Baumgartner K (2015) Diversity of Diaporthe species associated with wood cankers of fruit and nut crops in northern California. Mycologia 107:926–940PubMedGoogle Scholar
  317. Lawrence DP, Travadon R, Pouzoulet J, Rolshausen PE, Wilcox WF, Baumgartner K (2017a) Characterization of Cytospora isolates from wood cankers of declining grapevine in North America, with the descriptions of two new Cytospora species. Plant Pathol 66:713–725Google Scholar
  318. Lawrence DP, Peduto Hand F, Gubler WD, Trouillas FP (2017b) Botryosphaeriaceae species associated with dieback and canker disease of bay laurel in northern California with the description of Dothiorella californica sp. nov. Fungal Biol 121:347–360PubMedGoogle Scholar
  319. Lee Y-H, Cho W-D, Kim WK, Jin K-S, Lee E-J (1991) Report on host-unrecorded diseases identified from economical crops in Korea. Res Rep Rural Developm Admin 33:15–19Google Scholar
  320. Li W, Liu J, Bhat DJ, Camporesi E, Xu J, Hyde KD (2014) Introducing the novel species, Dothiorella symphoricarposicola, snowberry in Italy. Cryptog Mycol 35:257–270Google Scholar
  321. Li GJ, Hyde KD, Zhao RN, Hongsanan S, Abdel-Aziz FA, AbdelWahab MA, Alvarado P, Alves-Silva G, Ammirati JF, Ariyawansa HA, Baghela A, Bahkali AH, Beug M, Bhat DJ, Bojantchev D, Boonpratuang T, Bulgakov TS, Camporesi E, Boro MC, Ceska O, Chakraborty D, Chen JJ, Chethana KWT, Chomnunti P, Consiglio G, Cui BK, Dai DQ, Dai YC, Daranagama DA, Das K, Dayarathne MC, Crop ED, De Oliveira RJV, de Souza CAF, de Souza JI, Dentinger BTM, Dissanayake AJ, Doilom M, Drechsler-Santos ER, Ghobad-Nejhad M, Gilmore SP, Góes-Neto A, Gorczak M, Haitjema GH, Hapuarachchi KK, Hashimoto A, He MQ, Henske JK, Hirayama K, Iribarren MJ, Jayasiri SC, Jayawardena RS, Jeon SJ, Jerónimo GH, Jesus AL, Jones EBG, Kang JC, Karunarathna SC, Kirk PM, Konta S, Kuhnert E, Langer E, Lee HS, Lee HB, Li WJ, Li XH, Liimatainen K, Lima DX, Lin CG, Liu JK, Liu XZ, Liu ZY, Luangsa-ard JJ, Lücking R, Lumbsch HT, Lumyong S, Leaño EM, Marano AV, Matsumura M, McKenzie EHC, Mongkolsamrit S, Mortimer PE, Nguyen TTT, Niskanen T, Norphanphoun C, O’Malley MA, Parnmen S, Pawłowska J, Perera RH, Phookamsak R, Phukhamsakda C, Pires-Zottarelli CLA, Raspe´ O, Reck MA, Rocha SCO, de Santiago ALCMA, Senanayake IC, Setti L, Shang QJ, Singh SK, Sir EB, Solomon KV, Song J, Srikitikulchai P, Stadler M, Suetrong S, Takahashi H, Takahashi T, Tanaka K, Tang LP, Thambugala KM, Thanakitpipattana D, Theodorou MK, Thongbai B, Thummarukcharoen T, Tian Q, Tibpromma S, Verbeken A, Vizzini A, Vlasa´k J, Voigt K, Wanasinghe DN, Wang Y, Weerakoon G, Wen HA, Wen TC, Wijayawardene NN, Wongkanoun S, Wrzosek M, Xiao YP, Xu JC, Yan JY, Yang J, Yang SD, Hu Y, Zhang JF, Zhao J, Zhou LW, Persˇoh D, Phillips AJL, Maharachchikumbura SSN (2016) Fungal divers notes 253–366: taxonomic and phylogenetic contributions to fungal taxa. Fungal Divers 78:1–237Google Scholar
  322. Li WJ, Bhat DJ, Camporesi E, Tian Q, Wijayawardene NN, Dai DQ, Phookamsak R, Chomnunti P, Bahkali AH, Hyde KD (2015) New asexual morph taxa in Phaeosphaeriaceae. Mycosphere 6:681–708Google Scholar
  323. Liang C, Jayawardena RS, Zhang W, Wang X, Liu M, Liu L, Zang C, Xu X, Hyde KD, Yan J, Li X, Zhao K (2016) Identification and characterization of Pseudocercospora species causing grapevine leaf spot in China. J Phytopathol 164:75–85Google Scholar
  324. Linaldeddu BT, Deidda A, Scanu B, Franceschini A, Serra S, Berraf-Tebbal A, Zouaoui Boutiti M, Ben Jamaa ML, Philips AJL (2015) Diversity of Botryosphaeriaceae species associated with grapevine and other woody hosts in Italy, Algeria and Tunisia, with descriptions of Lasiodiplodia exigua and Lasiodiplodia mediterranea sp. nov. Fungal Divers 71:201–214Google Scholar
  325. Linaldeddu BT, Deidda A, Scanu B, Franceschini A, Alves A, Abdollahzadeh J, Phillips AJL (2016) Phylogeny, morphology and pathogenicity of Botryosphaeriaceae, Diatrypaceae and Gnomoniaceae associated with branch diseases of hazelnut in Sardinia (Italy). Eur J Plant Pathol 146:259–279Google Scholar
  326. Litzenberger SC, Farr ML, Lip HT (1962) A preliminary list of Cambodian plant diseases. Div Agric Nat Res, USAID Minist Agric Phnom-Penh, CambodiaGoogle Scholar
  327. Liu PSW (1977) A supplement to a host list of plant diseases in Sabah, Malaysia. Phytopathol Pap 21:1–49Google Scholar
  328. Liu X-J, Guo Y-L (eds) (1998) Flora Fungorum Sinicorum. Pseudocercospora, vol 9. Science Press, BeijingGoogle Scholar
  329. Liu JK, Hyde KD, Jones EBG, Ariyawansa HA, Bhat DJ, Boonmee S, Maharachchikumbura S, McKenzie EHC, Phookamsak R, Phukhamsakda C, Shenoy BD, Abdel-Wahab MA, Buyck B, Chen J, Chethana KWT, Singtripop C, Dai DQ, Dai YC, Daranagama DA, Dissanayake AJ, Doliom M, D’souza MJ, Fan XL, Goonasekara ID, Hirayama K, Hongsanan S, Jayasiri SC, Jayawardena RS, Karunarathna SC, Li WJ, Mapook A, Norphanphoun C, Pang KL, Perera RH, Peršoh D, Pinruan U, Senanayake IC, Somrithipol S, Suetrong S, Tanaka K, Thambugala KM, Tian Q, Tibpromma S, Udayanga D, Wijayawardena NN, Wanasinghe D, Wisitrassameewong K, Abdel-Aziz FA, Adamčík S, Bahkali AH, Boonyuen N, Bulgakov T, Callac P, Chomnunti P, Greiner K, Hashimoto A, Hofstetter V, Kang JC, Lewis D, Li XH, Liu XX, Liu ZY, Matumura M, Mortimer PE, Rambold G, Randrianjohany E, Sato G, Sri-Indrasutdhi V, Tian CM, Verbeken A, von Brackel W, Wang Y, Wen TC, Xu JC, Yan JY, Zhao RL, Camporesi E (2015) Fungal diversity notes 1–110: taxonomic and phylogenetic contributions to fungal species. Fungal Divers 72:1–197Google Scholar
  330. Liu QL, Li GQ, Li JQ, Chen SF (2016a) Botrytis eucalypti, a novel species isolated from diseased Eucalyptus seedlings in South China. Mycol Progr 15:1057–1079Google Scholar
  331. Liu M, Zhang W, Zhou Y, Liu Y, Yan JY, Li XH, Jayawardena RS, Hyde KD (2016b) First report of twig anthracnose on grapevine caused by Colletotrichum nymphaeae in China. Plant Dis 100:2530Google Scholar
  332. Lombard L, Houbraken J, Decock C, Samson RA, Meijer M, Réblová M, Groenewald JZ, Crous PW (2016) Generic hyper-diversity in Stachybotriaceae. Persoonia 36:156PubMedPubMedCentralGoogle Scholar
  333. Longland JM, Sutton TB (2008) Factors affecting the infection of fruit of Vitis vinifera by the bitter rot pathogen Greeneria uvicola. Phytopathology 98:580–584PubMedGoogle Scholar
  334. Lorsuwan C, Tontyaporn S, Visarathanonth N, Manoch L, Kakishima M (1984) Materials for the rust flora in Thailand I. Trans Mycol Soc Jpn 25:57–65Google Scholar
  335. Lotz-Winter H, Hofmann T, Kirschner R, Kursawe M, Trampe T, Piepenbring M (2011) Fungi in the Botanical Garden of the University of Frankfurt. Z Mykol 77:89–122Google Scholar
  336. Lu B, Hyde KD, Ho WH, Tsui KM, Taylor JE, Wong KM, Yanna, Zhou D (2000) Checklist of Hong Kong Fungi. Fungal Diversity Press, Hong KongGoogle Scholar
  337. Lubbe CM, Denman S, Cannon PF, Groenewald JZ, Lamprecht SC, Crous PW (2004) Characterization of Colletotrichum species associated with diseases of Proteaceae. Mycologia 96:1268–1279PubMedGoogle Scholar
  338. Lücking R, Moncada B (2017) Dismantling Marchandiomphalina into Agonimia (Verrucariaceae) and Lawreymyces gen. nov. (Corticiaceae): setting a precedent to the formal recognition of thousands of voucherless fungi based on type sequences. Fungal Divers 84:119–138Google Scholar
  339. Luongo L, Santori A, Riccioni L, Belisario A (2011) Phomopsis sp. associated with post-harvest fruit rot of kiwifruit in Italy. J Plant Pathol 93:205–209Google Scholar
  340. Luque J, Martos S, Phillips AJL (2005) Botryosphaeria viticola sp. nov. on grapevines: a new species with a Dothiorella anamorph. Mycologia 97:1111–1121PubMedGoogle Scholar
  341. Luque J, Martos S, Aroca A, Raposo R, Garcia-Figueres F (2009) Symptoms and fungi associated with declining mature grapevine plants in northeast Spain. J Plant Pathol 91:381–390Google Scholar
  342. Magoč T, Salzberg SL (2011) FLASH: fast length adjustment of short reads to improve genome assemblies. Bioinformatics 27:2957–2963PubMedPubMedCentralGoogle Scholar
  343. Magyar D, Shoemaker RA, Bobvos J, Crous PW, Groenewald JZ (2011) Pyrigemmula, a novel hyphomycete genus on grapevine and tree bark. Mycol Progr 10:307–314Google Scholar
  344. Maharachchikumbura SSN, Guo LD, Chukeatirote E, Bahkali AH, Hyde KD (2011) Pestalotiopsis—morpholgy, phylogeny, biochemsitry and diversity. Fungal Divers 50:167–187Google Scholar
  345. Maharachchikumbura SSN, Crous PW, Groenewald JZ, Xu J, Hyde KD (2014) Pestalotiopsis revisited. Stud Mycol 79:121–186PubMedPubMedCentralGoogle Scholar
  346. Maharachchikumbura SN, Hyde KD, Jones EBG, McKenzie EHC, Huang SK, Abdel-Wahab MA, Daranagama DA, Dayarathne M, D’souza MJ, Goonasekara ID, Hongsanan S, Jayawardena RS, Kirk PM, Konta S, Liu JK, Liu Z-Y, Norphanphoun C, Pang KL, Perera RH, Senanayake IC, Shang Q, Shenoy BD, Xiao Y, Bahkali AH, Kang J, Somrothipol S, Suetrong S, Wen T, Xu J (2015) Towards a natural classification and backbone tree for Sordariomycetes. Fungal Divers 72:199Google Scholar
  347. Maharachchikumbura SSN, Larigon P, Hyde KD, Al-Sadi AM, Liu Z (2016) Characteriztion of Neopestalotiopsis, Pestalotiopsis and Truncatella species associated with grapevine trunk disease in France. Phytopathol Mediterr 55:380–390Google Scholar
  348. Mahdian S, Zafari D (2017) First report of table grape blue mold caused by Penicillium sumatrense in Iran. Plant Dis 101:244Google Scholar
  349. Makovetz S (1933) Contributions to the mycoflora of the Ukraine. Bull Jard Bot Kieff 16:71–87Google Scholar
  350. Maluta D-R, Larignon P (1991) Pied-noir: mieux vaut prévenir. Viticulture 11:71–72Google Scholar
  351. Manamgoda DS, Rossman AY, Castlebury LA, Crous PW, Madrid H, Chukeatirote E, Hyde KD (2014) The genus Bipolaris. Stud Mycol 79:221–288PubMedPubMedCentralGoogle Scholar
  352. Maneval WE (1937) A list of the Missouri Fungi; with special reference to plant pathogens and wood-destroying species. Univ Missouri Stud Sci Ser 12:1–150Google Scholar
  353. Marais PG (1979) Fungi associated with root rot in vineyards in the Western Cape. Phytophylactica 11:65–68Google Scholar
  354. Marais PG (1980) Fungi associated with decline and death of nursery grapevines in the Western Cape. Phytophylactica 12:9–13Google Scholar
  355. Marchesi JR, Ravel J (2015) The vocabulary of microbiome research: a proposal. Microbiome 3:31PubMedPubMedCentralGoogle Scholar
  356. Marin-Felix Y, Groenewald JZ, Cai L, Chen Q, Marincowitz S, Barnes I, Bensch K, Braun U, Camporesi E, Damm U, de Beer ZW, Dissanayake A, Edwards J, Giraldo A, Hernández-Restrepo M, Hyde KD, Jayawardena RS, Lombard L, Luangsa-ard J, McTaggart AR, Rossman AY, Sandoval-Denis M, Shen M, Shivas RG, Tan YP, van der Linde EJ, Wingfield MJ, Wood AR, Zhang JQ, Zhang Y, Crous PW (2017) Genera of phytopathogenic fungi: GOPHY 1. Stud Mycol 86:99–216PubMedPubMedCentralGoogle Scholar
  357. Martin MT, Cobos R (2007) Identification of fungi associated with grapevine decline in Castilla y Leon (Spain). Phytopathol Mediterr 46:18–25Google Scholar
  358. Martin MT, Martin L, de-Francisco MT, Cobos R (2009) First report of Lasiodiplodia theobromae and Cryptovalsa ampelina associated with grapevine decline from Castilla y Leon, Spain. Plant Dis 93:545Google Scholar
  359. Martin MT, Martin L, Cuesta MJ, Garcia-Benavides P (2011a) First report of Cylindrocarpon pauciseptatum associated with grapevine decline from Castilla y Leon, Spain. Plant Dis 95:361Google Scholar
  360. Martin MT, Martin L, Cuesta MJ (2011b) First report of Neofusicoccum mediterraneum and N. austral causing decay in Vitis vinifera in Castilla y Leon, Spain. Plant Dis 95:876Google Scholar
  361. Martin FN, Blair JE, Coffey MD (2014) A combined mitochondrial and nuclear multilocus phylogeny of the genus Phytophthora. Fungal Genet Biol 66:19–32PubMedGoogle Scholar
  362. Martiny JBH, Bohannan BJM, Brown JH, Colwell RK, Fuhrman JA, Green JL, Horner-Devine MC, Kane M, Krumins JA, Kuske CR, Morin PJ, Naeem S, Ovreås L, Reysenbach AL, Smith VH, Staley JT (2006) Microbial biogeography: putting microorganisms on the map. Nat Rev Microbiol 4:102–112PubMedGoogle Scholar
  363. Mathur RS (1979) The Coelomycetes of India. Bishen Singh Mahendra Pal Singh, DelhiGoogle Scholar
  364. Mayorquin JS, Wang DH, Twizeyimana M, Eskalen A (2016) Identification, distribution, and pathogenicity of Diatrypaceae and Botryosphaeriaceae associated with citrus branch canker in the Southern California desert. Plant Dis 100:2402–2413Google Scholar
  365. McDonald V, Eskalen A (2011) Botrysphaeriaceae species associated with avacado branch cankers in California. Plant Dis 95:1465–1473Google Scholar
  366. McKirdy SJ, Riley IT, Cameron IJ (1999) First report of grapevine downy mildew (Plasmopara viticola) in commercial viticulture in Western Australia. Plant Dis 83:301Google Scholar
  367. McLeod A, Botha WJ, Meitz JC, Spies CFJ, Tewoldemedhin YT, Mostert L (2009) Morphological and phylogenetic analyses of Pythium species in South Africa. Mycol Res 113:933–951PubMedGoogle Scholar
  368. Melnik VA, Popushoi IS (1992) Imperfect fungi on species of trees and shrubs (U.S.S.R.). Unknown journal or publisherGoogle Scholar
  369. Mena-Portales J, Delgado-Rodriguez G, Heredia-Abarca G (2000) New combinations for species of Sporidesmium s.l. Bol Soc Micol Madrid 25:265–269Google Scholar
  370. Mendes MAS, da Silva VL, Dianese JC, Ferreira M, Santos CD, Gomes NE, Urben A, Castro C (1998) Fungos em Plantas no Brasil. Embrapa-SPI/Embrapa-Cenargen, BrasiliaGoogle Scholar
  371. Mey G, Oeser B, Lebrun MH, Tudzynski P (2002) The biotrophic, non-appressorium-forming grass pathogen Claviceps purpurea needs a Fus3/Pmk1 homologous mitogen-activated protein kinase for colonization of rye ovarian tissue. Mol Plant Microbe Interact 15:303–312PubMedGoogle Scholar
  372. Michailides TJ, Peacock W, Christensen P, Morgan DP, Felts D (2002) First report of Aspergillus vine canker of table grapes caused by Aspergillus niger. Plant Dis 86:75Google Scholar
  373. Milholland RD (1994) Macrophoma rot. In: Pearson RC, Goheen AC (eds) Compendium of grape diseases. APS Press, St PaulGoogle Scholar
  374. Miller JW (1991) Bureau of Plant Pathology. Tri-ol Tech Rep Div Pl Ind Florida 30:2–4Google Scholar
  375. Mills SD, Foerster H, Coffey MD (1991) Taxonomic structure of Phytophthora cryptogea and P. drechsleri based on isozyme and mitochondrial DNA analyses. Mycol Res 95:31–48Google Scholar
  376. Mirzaei S, Nahvi MJ, Khaledi E, Abdollahzadeh J, Amini J, Abrinbana M (2015) Molecular and morphological characterization of Endoconidioma populi from Kurdistan province, Iran. Mycol Iran 2:127–133Google Scholar
  377. Mitchell JI, Zuccaro A (2006) Sequences, the environment and fungi. Mycologist 20:62–74Google Scholar
  378. Mohammadi H, Banihashemi Z (2012) First report of Phaeoacremonium inflatipes and Phaeoacremonium mortoniae associated with grapevine Petri disease in Iran. J Agric Sci Technol 14:1405–1414Google Scholar
  379. Mohammadi H, Banihashemi Z, Gramaje D, Armengol J (2013a) Fungal pathogens associated with grapevine trunk diseases in Iran. J Agric Sci Technol 15:137–150Google Scholar
  380. Mohammadi H, Gramaje D, Banihashemi Z, Armengol J (2013b) Characterization of Diplodia seriata and Neofusicoccum parvum associated with grapevine decline in Iran. J Agric Sci Technol 15:603–616Google Scholar
  381. Moller WJ, Kasimatis AN, Kissler JJ (1974) A dying arm disease of grape in California. Plant Dis Rep 58:869–871Google Scholar
  382. Mondello V, Lo Piccolo S, Conigliaro G, Alfonzo A, Torta L, Burruano S (2013) First report of Neofusicoccum vitifusiforme and presence of the Botryosphaeriaceae species associated with Botryosphaeria dieback of grapevine in Sicily (Italy). Phytopathol Mediterr 52:388–396Google Scholar
  383. Montagne JFC (1856) Sylloge generum specierumque plantarum cryptogamarum, vol 1. J. B. Bailliere, Paris, pp. 1–498Google Scholar
  384. Moralejo E, Clemente A, Descals E, Belbahri L, Calmin G, Lefort F, Spies CFJ, McLeod A (2008) Pythium recalcitrans sp. nov. revealed by multigene phylogenetic analysis. Mycologia 100:310–319PubMedGoogle Scholar
  385. Morgan DP, Michailides TJ (2004) First report of melting decay of ‘Red Globe’ grapes in California. Plant Dis 88:1047Google Scholar
  386. Mostert L, Crous PW, Kang JC, Phillips AJL (2001) Species of Phomopsis and a Libertella sp. occurring on grapevines with specific reference to South Africa: morphological, cultural, molecular and pathological characterization. Mycologia 93:146–167Google Scholar
  387. Mostert L, Halleen F, Creaser ML, Crous PW (2004) Cryptovalsa ampelina, a forgotten shoot and cane pathogen of grapevines. Australas Plant Pathol 33:295–299Google Scholar
  388. Mostert L, Halleen F, Fourie P, Crous PW (2006) A review of Phaeoacremonium species involved in Petri disease and esca of grapevines. Phytopathol Mediterr 45:12–29Google Scholar
  389. Mouchacca J (2009) Novel fungal taxa from the arid Middle East introduced prior to the year 1940. II. Anamorphic fungi: hypomycetes. Cryptog Mycol 30:199–222Google Scholar
  390. Mugnai L, Graniti A, Surico G (1999) Esca (black measles) and brown wood-streaking: two old and elusive diseases of grapevines. Plant Dis 83:404–418Google Scholar
  391. Mujica F, Oehrens B (1967) Segunda addenda a flora fungosa Chilena. Boletin Tecnico 27:1–78Google Scholar
  392. Mujica F, Vergara C (1945) Flora fungosa Chilena. Indice preliminar de los huespedes de los hongos chilenos y sus referencias bibliograficas. Imprenta StanleyGoogle Scholar
  393. Mulenko W, Majewski T, Ruszkiewicz-Michalska M (2008) A preliminary checklist of micromycetes in Poland, vol 9. W. Szafer Institute of Botany, Polish Academy of Sciences, p 752Google Scholar
  394. Mundkur BB (1943) Indian species of Phakopsora and Bubakia. Mycologia 35:538–545Google Scholar
  395. Mundkur BB, Thirumalachar MJ (1946) Revisions of and additions to Indian fungi. I. Mycol Pap 16:1–27Google Scholar
  396. Muthumary J, Qaiser AS, Sutton BC (1986) Reassessment of Monochaetia terminaliae. Trans Br Mycol Soc 87:103–108Google Scholar
  397. Nag Raj TR (1988) Redisposals and redescriptions in the Monochaetia-Seiridium, Pestalotia-Pestalotiopsis complexes. VIII. On the status of Monochaetia camelliae, M. osyridella and Pestalotia gaurae. Mycotaxon 32:121–132Google Scholar
  398. Nag Raj TR (1993) Coelomycetous anamorphs with appendage-bearing conidia. Mycologue Publications, Waterloo, pp 1–1101Google Scholar
  399. Nag Raj TR, Kendrick B (1975) A monograph of Chalara and allied genera. Wilfrid Laurier University Press, OntarioGoogle Scholar
  400. Nagorny P (1930) Die pilsflora der Kaukasischen Weinreve. Trav Jard Bot Tiflis Ser II 5:1–201Google Scholar
  401. Nakagiri A, Tadayoshi ITO, Hatamoto M (1994) Brown zonate spot of grape caused by Briosia ampelophaga. Jpn J Phytopathol 60:608–612Google Scholar
  402. Nakaune R, Tatsuki M, Matsumoto H, Ikoma Y (2016) First report of a new postharvest disease of grape caused by Cadophora luteo-olivacea. J Gen Plant Pathol 82:116–119Google Scholar
  403. Nasyrov O (1964) Some species of fungi Imperfecti, new for Turkmenistan in the valley of the middle Ama-Darya. Akad Nauk Turkmen SSR Iav Ser Biol Nauk 3:1–116Google Scholar
  404. Nattrass RM (1961) Host lists of Kenya fungi and bacteria. Mycol Pap 81:1–46Google Scholar
  405. Navarrete F, Abreo E, Bettucci L, Martinez S, Lupo S (2009) First report of Greeneria uvicola as cause of grapevine dead-arm dieback in Uruguay. Australas Plant Dis Notes 4:117–119Google Scholar
  406. Netto MSB, Assuncao IP, Lima GSA, Marques MW, Lima WG, Monteiro JHA, Michereff SJ, Phillips AJL, Camara MPS, de Queiroz Balbino V (2014) Species of Lasiodiplodia associated with papaya stem-end rot in Brazil. Fungal Divers 67:127–141Google Scholar
  407. Netto MSB, Lima WG, Correia KC, Da Silva CFB, Thon M, Martins RB, Miller RNG, Michereff SJ, Camara MPS (2017) Analysis of phylogeny, distribution, and pathogenicity of Botryosphaeriaceae species associated with gummosis of Anacardium in Brazil, with a new species of Lasiodiplodia. Fungal Biol 121:437–451PubMedGoogle Scholar
  408. Nguyen NH, Song Z, Bates ST, Branco S, Tedersoo L, Menke J, Schilling JS, Kennedy PG (2015) FUNGuild: an open annotation tool for parsing fungal community datasets by ecological guild. Fungal Ecol 20:241–248Google Scholar
  409. Niessl G (1871) Beiträge zur Kenntniss der Pilze. Beschreibung neuer und wenig bekannter Pilze. Verhandlungen des Naturforschenden Vereines in Brünn 10:153–217Google Scholar
  410. Nogueira AF Jr, Fischer IH, Braganca CAD, Massola NS Jr, Amorim L (2016) Identification of Botryosphaeriaceae species that cause stylar-end rot of guavas and characterisation of the disease monocycle. Eur J Plant Pathol 144:271–287Google Scholar
  411. Nomura Y, Takamatsu S, Fujioka K (2003) Teleomorph of Erysiphe necator var. necator on Vitis vinifera and Ampelopsis brevipedunculata var. heterophylla (Vitaceae) newly found in Japan. Mycoscience 44:157–158Google Scholar
  412. Norse D (1974) Plant diseases in Barbados. Phytopathol Pap 18:1–38Google Scholar
  413. O’Donnell K, Cigelnik E, Nirenberg HI (1998) Molecular systematics and phylogeography of the Gibberella fujikuroi species complex. Mycologia 90:465–493Google Scholar
  414. Oh S-Y, Nam K-W, Yoon D-H (2014) Identification of Acremonium acutatum and Trichothecium roseum isolated from grape with white stain symptom in Korea. Mycobiology 42:269–273PubMedPubMedCentralGoogle Scholar
  415. Ono Y (2000) Taxonomy of the Phakopsora ampelopsidis species complex on vitaceous hosts in Asia includes a new species, P. euvitis. Mycologia 92:154–173Google Scholar
  416. Ono Y (2016) Mixed infections of grapevine leaf rusts Phakopsora meliosmae-myrianthae and P. montana in Japan. J Gen Plant Pathol 82:149–153Google Scholar
  417. Orieux L, Felix S (1968) List of plant diseases in Mauritius. Phytopathol Pap 7:1–48Google Scholar
  418. Oudemans P, Coffey MD (1991) Isozyme comparison within and among worldwide sources of three morphologically distinct species of Phytophthora. Mycol Res 95:19–30Google Scholar
  419. Ozben S, Demirci F, Degirmenci K, Uzunok S (2012) First report of Cylindrocarpon macrodidymum associated with black foot diseases of Grapevine in Turkey. Plant Dis 96:762Google Scholar
  420. Padwick GW (1946) Notes on Indian fungi. IV. Mycol Pap 17:1–12Google Scholar
  421. Pan FY, Huang Y, Lin L, Zhou YM, Wei RF, Guo WF, Yin L, Lu J (2016) First report of Colletotrichum capsici causing grape ripe rot in Guangxi, China. Plant Dis 100:2531Google Scholar
  422. Pancher M, Ceol M, Corneo PE, Longa CMO, Yousaf S, Pertot I, Campisano A (2012) Fungal endophytic communities in grapevines (Vitis vinifera L.) respond to crop management. Appl Environ Microbiol 78:4308–4317PubMedPubMedCentralGoogle Scholar
  423. Pande A (2008) Ascomycetes of Peninsular India. Scientific Publishers (India), JodhpurGoogle Scholar
  424. Pantidou ME (1973) Fungus–host index for Greece. Benaki Phytopathological Institute, Kiphissia, AthensGoogle Scholar
  425. Paolinelli-Alfonso M, Villalobos-Escobedo JM, Rolshausen P, Herrera-Estrella A, Galindo-Sánchez C, López-Hernández JF, Hernandez-Martinez R (2016) Global transcriptional analysis suggests Lasiodiplodia theobromae pathogenicity factors involved in modulation of grapevine defensive response. BMC Genomics 17:615PubMedPubMedCentralGoogle Scholar
  426. Pardo Cardona VM (1998) Distribucion de las especies colombianas de Uredinales segun los grupos taxonomicos de sus hospederos. Rev Fac Nal Agr Medellin 51:285–319Google Scholar
  427. Park M-J, Choi Y-J, Hong S-B, Shin H-D (2010) Genetic variability and mycohost association of Ampelomyces quisqualis isolates inferred from phylogenetic analyses of ITS rDNA and actin gene sequences. Fungal Biol 114:235–247PubMedGoogle Scholar
  428. Parkinson LE, Shivas RG, Dann EK (2017) Pathogenicity of Nectriaceous fungi on avocado in Australia. Phytopathology 107:1479–1485PubMedGoogle Scholar
  429. Parris GK (1959) A revised host index of Mississippi plant diseases. Miss State Univ Bot Dept Misc Publ 1:1–146Google Scholar
  430. Pascoe I, Cottral E (2000) Developments in grapevine trunk diseases research in Australia. Phytopathol Mediterr 39:68–75Google Scholar
  431. Passerini (1872) Erb Critt Ital Ser 2:595Google Scholar
  432. Patil MS, Mahamulkar SH (1999) Studies on Meliolaceae of India IV. Indian Phytopathol 52:245–253Google Scholar
  433. Paul YS, Thakur VK (2006) Indian Erysiphaceae. Scientific Publishers (India), JodhpurGoogle Scholar
  434. Pavlic-Zupanc D, Piskur B, Slippers B, Wingfield MJ, Jurc D (2015) Molecular and morphological characterization of Dothiorella species associated with di