RECK and TIMP-2 mediate inhibition of MMP-2 and MMP-9 by Annona muricata

Abstract

Up-regulation of MMP-2 and MMP-9 plays a significant role in promoting cancer progression by degrading the components of the extracellular matrix, thereby enhancing the migration of tumor cells. Although the anti-proliferative and apoptotic effect of Annona muricata is well established, its effect on MMP-2 and MMP-9, a major target in several types of cancers, has not been studied. Powdered samples of various parts of A. muricata like fruit, stem, seed, and twig extracted using aqueous methanol showed significant dose-dependent inhibition of MMP-2 and MMP-9 in a highly metastatic fibrosarcoma cell line, HT1080. Additionally, these extracts also up-regulated the expression of several endogenous inhibitors of MMP-2 and MMP-9 like REversion-inducing Cysteine-rich protein with Kazal motifs (RECK) and Tissue Inhibitor of Metalloproteinase-2 (TIMP-2). Furthermore, primary cells developed from tumor tissues obtained from patients not exposed to chemotherapy, also exhibited similar results. Remarkably, the inhibition of MMP-2 and MMP-9 observed was tumor specific, with the A. muricata fruit extract showing only 2% inhibition in cells obtained from normal tissues, when compared to 60% inhibition observed in cells obtained from tumor samples. The present study elucidates a novel mechanism by which A. muricata extracts selectively exhibit their anti-cancer activity in tumor cells by down-regulating MMP-2 and MMP-9 that are important biomarkers in cancer.

Introduction

Matrix metalloproteinases (MMPs), a group of zinc-dependent endopeptidases that are associated with several patho-physiological conditions like cancer, arthritis, angiogenesis and tissue repair (Coussens and Werb 1996; Seki et al. 1995; Gill and Parks 2008), play a significant role in degradation of the components of extracellular matrix (ECM) (Gong et al. 2014). Among the different MMPs, MMP-2 and MMP-9 play a significant role in cancer progression by cleaving the major components of the extracellular matrix, thereby promoting the invasion of tumor cells (Kusukawa et al. 1993; Stetler-Stevenso and Yu 2001; Itoh et al. 1999; Hao et al. 2007; Ray and Stetler-Stevenson 1995; Festuccia et al. 1999). The secretion of MMPs is usually balanced by their endogenous modulators that help in maintaining tissue homeostasis (Naylor et al. 1994; Visse and Nagase 2003). This balance is destroyed in cancer cells resulting in excessive degradation of ECM, thereby promoting the invasion of cancer cells to different sites (Nagase 1998; Bourboulia and Stetler-Stevenson 2010). The endogenous inhibitors known to regulate MMPs are Tissue Inhibitor of Metalloproteinases (TIMPs) and REversion-inducing Cysteine-rich protein with Kazal motifs (RECK). These inhibitors regulate MMP-2 and MMP-9 by competitively inhibiting their proteolytic activity or by functionally antagonizing them (Strongin et al. 1995; Takahashi et al. 1998).

Although the importance of MMPs as a therapeutic target was recognized in 1985 and several efforts have been made for the past 3 decades to develop MMP inhibitors, to date, no MMP inhibitor has been successfully developed as anti-tumor drug, except for Doxycycline that has been used to treat periodontal diseases (Preshaw et al. 2004; Acharya et al. 2004).

The present study aims at understanding the regulation of MMP-2 and MMP-9 by natural product extracts of Annona muricata, known for its anti-cancer property. Earlier studies in the laboratory have shown the effect of several natural product extracts on MMP-2 and MMP-9 which are known to play key roles in various pathological conditions (Omanakuttan et al. 2012; Nambiar et al. 2016; Yang et al. 2015; Sunilkumar et al. 2017). A. muricata was used traditionally for treating various ailments including cancer and improving the quality of life (Paul et al. 2013; Moghadamtousi et al. 2015). The extracts of A. muricata was known to possess anti-rheumatic (Padma et al. 1998), anti-viral (Jaramillo et al. 2000), anti-parasitic (Adeyemi et al. 2008) and emetic (Hamizah et al. 2012) properties. Additionally, the fruit, leaves and stem of A. muricata possessed anti-proliferative and apoptotic properties (Liu et al. 2016; Syed Najmuddin et al. 2016; Deep et al. 2016). Although A. muricata has shown several anti-cancer properties, their effect on MMP-2 and MMP-9, one of the major targets for cancer progression have not been studied yet. Employing a highly metastatic cell line, fibrosarcoma (HT1080), the present study clearly elucidates the role of various extracts of A. muricata in inhibiting MMP-2 and MMP-9. The conditioned media of the cells treated with fruit, stem, seed and twig extracts for 24 h demonstrated a significant inhibition of gelatinase activity from a concentration as low as 1µg/ml. These results were also observed with primary cell lines developed in the laboratory using naïve tumor samples obtained from surgically removed breast lump tissues of patients. Additionally, the gelatinase inhibitory activity exhibited by these extracts was remarkably selective towards tumor cells when compared to normal cells. Furthermore, A. muricata extracts significantly up-regulated the expression of the endogenous inhibitors of MMP-2 and MMP-9 like TIMP-2 and RECK. Thus the present study demonstrates a novel molecular mechanism by means of which the extracts of A. muricata inhibit MMP-2 and MMP-9 activity that are up-regulated in most cancers.

Materials and methods

Materials

The media, antibiotics and other cell culture requirements including RPMI, DMEM, Penicillin, Streptomycin, Amphotericin and Trypsin EDTA were obtained from Sigma Aldrich (USA) and FBS was procured from Gibco, Life technologies (USA). Collagenase Type 1, Hyaluronidase Type 2 and Mammary Epithelial Growth Supplement used for primary cell isolation were purchased from Sigma Aldrich (USA). DMSO was purchased from Sigma-Aldrich (Germany). MTT and TRI Reagent® were obtained from Sigma Aldrich (USA). cDNA kit MultiScribeTM reverse transcription kit was procured from ABI (USA). All the antibodies were purchased from cell signalling Inc. (USA). MPER extraction buffer was obtained from Thermo Fisher Scientific Inc. (USA) and Super Signal West Dura Extended Duration Substrate was procured from Thermo Scientific (USA).

Preparation of Annona muricata extracts

The plant parts (Accession number: SNMH1001; obtained from the internationally accredited herbarium of Sree Narayana Mangalam College, Ernakulam, Kerala, India (recognized by New York Botanical Garden)) were collected, air dried (50°C) and powdered. The powdered samples were mixed in aqueous methanol (1:1 proportion of methanol and water) and sonicated for 30 minutes. The mixture was filtered to remove debris. This was followed by flash evaporation at 55°C to remove the solvent. The dried A. muricata extracts obtained after flash evaporation was solubilised in DMSO and used for further experimentation. The solvents used for extraction were of HPLC grade.

Cell culture

HT1080 cells (fibrosarcoma) obtained from National Centre for Cell Science, Pune, Maharashtra, India) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% fetal bovine serum (FBS) (v/v) with 1% penicillin, 1% streptomycin and 0.1% amphotericin B.

Primary cell culture isolation

Human tumor samples were obtained from patients diagnosed with breast cancer but have not undergone chemotherapy, hormone therapy or radiation therapy. The procedures were performed in accordance with the protocol approved by the Bioethical Committee of the Regional Cancer Centre Trivandrum, Kerala (Approval No. HEC No: 03/2013 of February 18, 2012). Signed informed consent form was obtained from patients prior to the surgery. The breast samples obtained were confirmed for malignancy by the pathologist using haematoxylin and eosin (H&E) staining. The specimens were fixed in formalin overnight at room temperature and then embedded in paraffin blocks after a series of isopropanol-xylene dehydration steps. The paraffin blocks as 4μm tissue sections were examined by a pathologist, according to standard protocols, for confirming the presence of malignant and non- malignant cells. All the samples obtained were characterised as low grade Luminal A breast cancer, ER and PR positive, Her 2/Neu negative. The tissue samples collected in aseptic conditions were transferred to RPMI media containing 10% FBS, supplemented with penicillin/streptomycin and amphotericin B. The tissue samples were washed with HBSS (Hanks Balanced Salt Solution with 6% antibiotic) several times to remove blood and fat, followed by fragmentation into small pieces and immersing in dissociation media (RPMI with 1.25 µg/ml of collagenase (type 1) and 1.25 µg/ml of hyaluronidase (type II). After digestion, the dissociated cells were collected by filtration through 100 µm nylon mesh and centrifuged at 4°C for 10 minutes at 1800 rpm. The pellet obtained was finally resuspended in RPMI media with 10% FBS and mammary epithelial growth supplement (recombinant human epidermal growth factor 10 ng/ml; recombinant human insulin 5 µg/ml; hydrocortisone 0.5 µg/ml) and incubated at 37°C and 5% CO2. This process was repeated once again with the non-digested tissue recovered from the nylon mesh, and finally the dissociated cells were pooled. The cells obtained were treated with various concentrations of A. muricata extracts for 24 h and the conditioned media was collected after centrifugation and used to assess MMP activity employing gelatin zymography.

Cellular studies

HT1080 cells were treated with different concentrations of A. muricata extracts for 24 h. The conditioned media was mixed with 4X sample buffer without β-mercaptoethanol (62.5 mM Tris-HCl, pH 6.8, 10% glycerol, 1% SDS, and 0.00625% (w/v) bromophenol blue) and loaded in a 10% SDS-polyacrylamide gel containing gelatin (2 mg/ml) followed by electrophoresis at 120 V for 150 min. The gels were washed in 2.5% Triton X-100 (v/v) for 30 min and then incubated overnight at 37°C in developing buffer (50 mM Tris–HCl, pH 7.6, 200 mM NaCl, 5 mM CaCl2 and 0.2% (v/v) Brij-35). Digestion bands were quantified using ImageJ software after staining and destaining.

MTT assay

Cells (5000/well) were treated in a 96-well plate with different concentrations of A. muricata extracts for 24 h. MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay was used to assess the viability of cells in the presence of these extracts. The absorbance was read at 590 nm and 620 nm after solubilising MTT with DMSO.

cDNA synthesis and real-time PCR analysis

HT1080 cells (80% confluency) were treated with various concentrations of A. muricata extracts for 24 h. The total RNA was extracted using TRI Reagent® (Sigma-Aldrich, USA) as per the manufacturer’s recommendations. 100 ng of RNA was converted to cDNA using MultiScribeTM reverse transcription kit (ABI, USA) followed by quantitative PCR using the SYBR method. Real time PCR analysis was performed using StepOnePlus (ABI, USA). The amplification conditions were: 95°C (10 min; initial activation) followed by 40 cycles at 95°C for 15 s, 60°C for 15 s and 72°C for 15 s. Relative mRNA levels were quantified using the ΔΔCT method and normalized to endogenous GAPDH.-fold change of gene expression was calculated by the following formula:

$$ \Delta {\text{C}}_{\text{T}} = {\text{ C}}_{\text{T,X}} {-}{\text{ C}}_{\text{T,R}} $$
$$ \Delta \Delta {\text{CT}} = \Delta {\text{C}}_{\text{T,q}} {-} \, \Delta {\text{C}}_{\text{T,cb}} $$

Fold gene expression = 2 (−∆∆CT), where CT, X = threshold cycle for target amplification, CT, R = threshold cycle for reference amplification, ΔCT, q = ΔCT of sample (q), ΔCT, cb = ΔCT of the reference sample (cb)

The primers used for PCR were: TIMP-2 Forward primer-5′-AGAAGAGCCTGAACCACAGGTA-3′; Reverse primer 5′- TTCTTGTAGTTGCCCGTGGT-3′.GAPDH Forward - 5′- AATCCCATCACCATCTTCCAG -3′, GAPDH reverse - 5′- AAATGAGCCCCAGCCTTC -3′.

Western blotting

Cell lysates prepared in MPER extraction buffer, were separated by SDS-PAGE followed by transfer to nitrocellulose membrane. Membranes were blocked in PBS containing 5% (w/v) BSA with 0.1% Tween 20, followed by incubation with RECK antibody. The blot was developed using Super Signal West Dura Extended Duration Substrate (34076, Thermo Scientific). The bands were quantified using ImageJ software.

Transwell matrigel invasion assay

Cell invasion assay was performed using a 24-well Transwell chamber (Corning, 6.5 mm; 8 μm pore size). For invasion assay, the filter of the Transwell chamber was coated with Matrigel (20 µg/ml, Becton Dickinson Labware, USA) overnight at 37°C. HT1080 cells (50,000 cells) were treated with 100 µg/ml of Annona muricata extracts in 200 μl serum-free media and placed in the upper chamber. DMEM with 10% FBS was added to the lower chamber as a chemo-attractant. Cells were incubated at 37°C and allowed to invade through the chamber for 24 h. The non-invaded cells on the upper membrane surface of the insert were completely removed with a cotton tip, and the migratory cells attached to the membrane surface were fixed with 4% paraformaldehyde and stained with crystal violet solution (0.1%). Images were taken by using ZEISS Inverted phase contrast microscope.

Spheroid invasion assay

96-well plates were pre- coated with 1.5% agarose and HT1080 cells were seeded for spheroid formation. The single spheroid formed was then transferred to another plate coated with collagen at a concentration of 3 mg/ml. The spheroids were treated with 100 µg/ml of different A. muricata extracts and incubated for 24 h at 37°C. Images were taken using ZEISS Inverted phase contrast microscope. The spindle-like protrusions indicating the invasion of cells into the surrounding invasion matrix was quantified using ImageJ.

Statistical analysis

Statistical analysis was conducted using Prism (GraphPad Software Inc., San Diego, CA). One-way analysis of variance was used for statistical comparisons. All values are expressed as the mean + SEM from three independent experiments.

Results

Regulation of MMP-2 and MMP-9 activity by A. muricata extracts

A well-balanced regulation of the degradation of the extracellular matrix plays a crucial role in deciding the fate of the cell. Up-regulated MMPs play a prominent role in degrading the components of the basement membrane, thereby helping in invasion of cancer cells. Fibrosarcoma cells (HT1080) were treated with varying concentrations of fruit, stem, seed and twig extracts of A. muricata (1 μg/ml, 10 μg/ml, 100 μg/ml and 1 mg/ml) for 24 h and the conditioned media was used for gelatin zymography. As evident from figure 1A–D, the activity of MMP-2 and MMP-9 was inhibited in a dose-dependent manner on treatment with varying concentrations of A. muricata extracts. MTT assay was performed to confirm that the reduced gelatinase activity was not due to cytotoxicity. HT1080 cells were treated with different concentrations of A. muricata extracts for 24 h and the cell viability was measured using MTT assay. Results obtained from cell viability assay clearly demonstrated that most of the A. muricata extracts were not toxic at lower concentrations. Interestingly, the fruit extract was not toxic even at the highest concentration tested i.e. 1000 μg/ml although it showed significant gelatinase inhibition from concentrations as low as 10 μg/ml (figure 1E).

Figure 1
figure1

Regulation of gelatinase activity by A. muricata extracts. Zymogram showing gelatinase activity of conditioned media from HT1080 cells treated with DMSO, 1 µg, 10 µg, 100 µg and 1000 µg of A. muricata twig (A), seed (B), fruit (C) and stem extract (D). A representative plot of percentage inhibition observed in the zymogram. MTT assay showing the effect of various concentrations of the extracts on HT1080 cells after treatment for 24 h (E). Each bar represents the Mean ± SE of triplicate determinations from three independent experiments. ****P < 0.0001; ***P < 0.001; **P < 0.01; *P < 0.1; ns, not significant (one-way analysis of variance with Dunnett’s multiple-comparison post-test).

A. muricata extracts inhibit MMP-2 and MMP-9 by regulating the expression of its endogenous inhibitors (TIMP-2, RECK)

The secretion of MMPs is counter-balanced by their endogenous inhibitors and helps in maintaining tissue homeostasis in normal cells. However, most of these endogenous modulators are down-regulated in conditions like cancer. The endogenous inhibitors like RECK and TIMP-2 play a prominent role in regulation of MMPs. RECK inhibits MMPs either by functionally antagonizing them or by competitively inhibiting their proteolytic activity (Takahashi et al. 1998). MMP activity is also regulated by naturally occurring specific inhibitors known as TIMPs. When TIMP-2 is present in low amounts, it is known to enhance the activation process by concentrating MMP-2 to the site where MT1-MMP, an endogenous activator of MMP is available (Bourboulia and Stetler-Stevenson 2010). Since RECK and TIMP-2 regulates the activity of MMP-2 and MMP-9, the role of fruit, stem, seed and twig extracts of A. muricata in modulating the expression of the endogenous inhibitors was analyzed using Western blotting and real-time PCR analysis respectively. As seen in figure 2A, the twig and stem extracts of A. muricata showed a significant 2- to 3-fold increase, with the fruit extract showing a remarkable 10-fold increase in the expression of RECK protein, thereby suggesting the role of RECK in mediating the inhibition of MMP-2 and MMP-9 by these extracts. The effect of A. muricata extracts on TIMP-2 expression was studied using real-time PCR analysis. As evident from figure 2B, a significant 3-fold induction in TIMP-2 expression levels were seen when the cells were treated with 10 µg/ml of fruit, seed and twig extracts of A. muricata. These results suggest that the inhibition of MMP-2 and MMP-9 observed in the presence of fruit, seed and twig extracts of A. muricata could be mediated through the regulation of endogenous inhibitors like TIMP-2 and RECK.

Figure 2
figure2

Regulation of RECK and TIMP-2 expression by A. muricata extracts. (A) Western blot analysis showing the effect of various extracts on RECK expression in HT1080 cells treated with varying concentrations of the extracts (1 µg to 50 µg) for 24 h. A representative blot of actin is shown. (B) Real-time PCR analysis of HT1080 cells treated with varying concentrations of the extracts (1 µg to 50 µg) for 24 h using primers specific for TIMP-2. GAPDH was used as the internal control. The control used was DMSO. Each bar represents the Mean ± SE of triplicate determinations from three independent experiments. ****P < 0.0001; *P < 0.1 (one-way analysis of variance with Dunnett’s multiple-comparison post-test).

Selective inhibition of the gelatinase activity by A. muricata in primary cells isolated from tumor tissues

Since primary cells mimic the tumor microenvironment better, the effect of A. muricata extracts were studied on primary cells isolated from tumor and normal tissues (adjacent to the tumor tissue) obtained from surgically removed breast lump tissues of patients not exposed to any kind of therapy. The primary cells were treated with different concentrations of A. muricata extracts for 24 h and the conditioned media obtained was used for gelatin zymography. As evident from our results (figure 3A to D), a dose- dependent inhibition of gelatinase activity was seen in the tumor cells treated with varying concentrations of A. muricata extracts. Most of the A. muricata extracts showed greater than 50% inhibition of gelatinase activity in tumor cells at a concentration as low as 10 µg/ml. To demonstrate the selectivity of A. muricata extracts for cancer cells, the normal cells were also treated with the extract for 24 h and their effect on gelatinase activity was studied using zymography. The extract from A. muricata fruit showed a remarkable selectivity (~60% inhibition) towards tumor cells when compared to normal cells (~2% inhibition) at a concentration of 10 µg/ml. Similarly, the other extracts also exhibited greater inhibition of MMP-2 and MMP-9 in tumor cells when compared to normal cells (figure 3E). These results suggest that the inhibition of MMP-2 and MMP-9 observed was more specific to the tumor cells.

Figure 3
figure3

Regulation of gelatinase activity in primary cells by Annona muricata extracts. Zymogram and a representative plot of the zymogram showing gelatinase activity of conditioned media from primary tumor cells treated with DMSO, 1 µg and 10 µg of Annona twig (A), seed (B), fruit (C) and stem extract (D). (E) A representative plot of percentage inhibition observed in the zymogram showing a comparison between normal and tumor cells treated with 10 µg/ml of different extracts. Each bar represents the Mean ± S.E. of triplicate determinations from three independent experiments. ****P < 0.0001; ***P < 0.001; P < 0.01; *P < 0.1 (one-way analysis of variance with Dunnett’s multiple-comparison post-test).

Effect of Annona muricata extracts on cell invasion in 2D and 3D spheroid models

Metalloproteinase activity is strongly implicated in cell invasion and control of ECM degradation. To investigate the role of A. muricata extracts in the invasion of HT1080 cells, a transwell invasion assay was performed. Incubation of HT1080 cells with various A. muricata extracts significantly reduced their invasive capacity at a concentration of 100 µg/ml (figure 4A). To understand the role of Annona muricata extracts in the invasion of 3D cells, HT1080 spheroids were formed on pre-coated agarose plates. Once formed, these spheroids were embedded in an invasion matrix composed of collagen followed by treatment with the different A. muricata extracts at a concentration of 100 µg/ml for 24 h. The spindle-like protrusions indicating the invasion of cells into the surrounding invasion matrix was recorded and quantified. Control spheroids were found to radially invade the collagen matrix, whereas the number of cells that invaded the surrounding matrix were significantly reduced on treatment with 100 µg/ml of A. muricata extracts for 24 h (figure 4B and C).

Figure 4
figure4

Effect of A. muricata extracts on invasion of HT1080 cells in 2D and 3D spheroids. (A) 2D Invasion assay was carried out in HT1080 cells in the presence of A. muricata extracts. After 24 h of incubation with the extracts, the cells on the bottom side of the filter was fixed and stained with crystal violet. (B) 3D spheroid invasion assay was performed using HT1080 cells in the presence of A. muricata extracts. (C) Representative plot of the number of cells that invaded through the collagen matrix. Each bar represents the Mean ± S.E. ****P < 0.0001; ***P < 0.001 (one-way analysis of variance with Dunnett’s multiple-comparison post-test).

Discussion

Up-regulation of several matrix metalloproteinases (MMPs) has been associated with various stages of cancer progression like metastasis. Among the different MMPs, MMP-2 and MMP-9 are known to play a prominent role in promoting cancer progression by degrading the major components of the extracellular matrix. Identification of MMP inhibitors (MMPIs) has eluded clinical utility for almost 30 years and multiple failed clinical trials of these inhibitors in cancer have reduced interest among the scientists in pursuing MMPIs as a valid therapeutic approach. Knowing the multifaceted roles played by MMPs in several disease conditions, the re-evaluation of MMP inhibition as a therapeutic modality is of utmost importance.

The present study clearly elucidates for the first time, a novel mechanism by means of which A. muricata extracts regulates the activity of MMP-2 and MMP-9. Studies performed using a highly metastatic cell line, HT1080 indicated a dose-dependent inhibition of MMP-2 and MMP-9 activity when the cells were treated with different A. muricata extracts for 24 h (figure 1A–D). Furthermore, the results from MTT assay clearly suggest that the decrease in gelatinase activity was not due to cytotoxicity (figure 1E). In addition to the inhibition of gelatinase activity, the effect of the A. muricata extracts were studied on the various endogenous inhibitors like TIMP-2 and RECK, which play a predominant role in post-translational regulation of MMP-2 and MMP-9. The findings from the study clearly demonstrate the up-regulation of both RECK and TIMP-2 in the presence of these extracts, with the fruit extract of A. muricata showing nearly 10-fold and 3-fold increase in RECK and TIMP-2 expression respectively figure 2A and B), thereby suggesting that the A. muricata extracts inhibit MMP-2 and MMP-9 by up regulating the endogenous inhibitors. A similar dose dependent inhibition of gelatinase activity was observed (figure 3A–D) in primary cells isolated from tumor and normal tissues (adjacent to the tumor tissue) of patients. Interestingly, the gelatinase inhibition observed in patient samples was specific to the tumor cells. The different A. muricata extracts showed greater inhibition of MMP-2 activity in the tumor cells compared to normal cells, with the fruit extract showing greater than 50% inhibition in tumor cells compared to ~3% inhibition in normal cells (figure 3E). Additionally, a significant inhibition of invasion was observed in HT1080 in both 2D and 3D spheroid models in the presence of A. muricata extracts (figure 4).

The present study would form the basis for further elucidation of the mechanistic aspects of anti-tumor activity present in the extracts of Annona. Earlier studies on Annona muricata have established the role of acetogenins, one of the major components present in the pulp extract of Annona fruit in inhibiting NADPH oxidase (NOX) in prostate cancer cells leading to a reduction in cell proliferation, invasiveness and angiogenesis. Aberrant activation of NOX was known to generate Reactive Oxygen Species (ROS) resulting in up-regulation and down regulation of oncogenes and tumor suppressor genes respectively. Our further studies will therefore be directed towards identifying the role of active components like cyclic hexapeptides and acetogenins in inhibiting MMP-2 and MMP-9 and understanding their mechanism of action.

References

  1. Acharya MR, Venitz J, Figg WD and Sparreboom A 2004 Chemically modified tetracyclines as inhibitors of matrix metalloproteinases. Drug Resist. Updat. 7 195–208

    Article  Google Scholar 

  2. Adeyemi DO, Komolafe OA, Adewole OS, Obuotor EM and Adenowo TK 2008 Anti hyperglycemic activities of Annona muricata (Linn). Afr. J. Tradit. Complement Alternat. Med. 6 62–69

    Google Scholar 

  3. Bourboulia D and Stetler-Stevenson WG 2010 Matrix metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs): Positive and negative regulators in tumor cell adhesion. Semin. Cancer Biol. 20 161–168

    CAS  Article  Google Scholar 

  4. Coussens LM and Werb Z 1996 Matrix metalloproteinases and the development of cancer. Chem. Biol. 3 895–904

    CAS  Article  Google Scholar 

  5. Deep G, Kumar R, Jain AK, Dhar D, Panigrahi GK, Hussain A, Agarwal C, El-Elimat T, Sica VP, Oberlies NH and Agarwal R 2016 Graviola inhibits hypoxia-induced NADPH oxidase activity in prostate cancer cells reducing their proliferation and clonogenicity. Sci. Rep. 6 23135

    CAS  Article  Google Scholar 

  6. Festuccia C, Giunciuglio D, Guerra F, Villanova I, Angelucci A, Manduca P, Teti A, Albini A and Bologna M 1999 Osteoblasts modulate secretion of urokinase-type plasminogen activator (uPA) and matrix metalloproteinase-9 (MMP-9) in human prostate cancer cells promoting migration and matrigel invasion. Oncol. Res. 11 17–31

    CAS  PubMed  Google Scholar 

  7. Gill SE and Parks WC 2008 Metalloproteinases and their inhibitors: regulators of wound healing. Int. J. Biochem. Cell Biol. 40 1334–1347

    CAS  Article  Google Scholar 

  8. Gong Y, Chippada-Venkata UD and Oh WK 2014 Roles of matrix metalloproteinases and their natural inhibitors in prostate cancer progression. Cancers 6 1298–1327

    Article  Google Scholar 

  9. Hamizah S, Roslida AH, Fezah O, Tan KL, Tor YS and Tan C I 2012 Chemopreventive potential of Annona muricata L leaves on chemically-induced skin papillomagenesis in mice. Asian Pac. J. Cancer Prev. 13 2533–2539

    Article  Google Scholar 

  10. Hao L, Zhang C, Qiu Y, Wang L, Luo Y, Jin M, Zhang Y, Guo TB, Matsushima K and Zhang Y 2007 Recombination of CXCR4, VEGF, and MMP-9 predicting lymph node metastasis in human breast cancer. Cancer Lett. 253 34–42

    CAS  Article  Google Scholar 

  11. Itoh TM, Tanioka, Matsuda H, Nishimoto H, Yoshioka T, Suzuki R and Uehira M 1999 Experimental metastasis is suppressed in MMP-9-deficient mice. Clin. Exp. Metastasis 17 177–181

    CAS  Article  Google Scholar 

  12. Jaramillo MC, Arango GJ, Gonzalez MC, Robledo SM and Velez ID 2000 Cytotoxicity and antileishmanial activity of Annona muricata pericarp. Fitoterapia 71 183–186

    CAS  Article  Google Scholar 

  13. Kusukawa J, Sasaguri Y, Shima I, Kameyama T and Morimatsu M 1993 Expression of matrix metalloproteinase-2 related to lymph node metastasis of oral squamous cell carcinoma. A clinicopathologic study. Am. J. Clin. Pathol. 99 18–23

    CAS  Article  Google Scholar 

  14. Liu N, Yang HL, Wang P, Lu YC, Yang YJ, Wang L and Lee SC 2016 Functional proteomic analysis revels that the ethanol extract of Annona muricata L. induces liver cancer cell apoptosis through endoplasmic reticulum stress pathway. J. Ethnopharmacol. 189 210–217

    Article  Google Scholar 

  15. Moghadamtousi SZ, Fadaeinasab M, Nikzad S, Mohan G, Ali HM and Kadir HA 2015 Annona muricata (Annonaceae): A review of its traditional uses, isolated acetogenins and biological activities. Int. J. Mol. Sci. 16 15625–15658

    CAS  Article  Google Scholar 

  16. Nagase H 1998 Cell surface activation of progelatinase A (proMMP-2) and cell migration. Cell Res. 8 179–186

    CAS  Article  Google Scholar 

  17. Nambiar J, Bose C, Venugopal M, Banerji A, Patel TB, Kumar GB and Nair BG 2016 Anacardic acid inhibits gelatinases through the regulation of Spry2, MMP-14, EMMPRIN and RECK. Exp. Cell Res. 349 139–151

    CAS  Article  Google Scholar 

  18. Naylor MS, Stamp GW, Davies BD and Balkwill FR 1994 Expression and activity of MMPS and their regulators in ovarian cancer. Int. J. Cancer 58 50–56

    CAS  Article  Google Scholar 

  19. Omanakuttan A, Nambiar J, Harris RM, Bose C, Pandurangan N, Varghese RK, Kumar GB, Tainer JA, Banerji A, Perry JJ and Nair BG 2012 Anacardic acid inhibits the catalytic activity of matrix metalloproteinase-2 and matrix metalloproteinase-9. Mol. Pharmacol. 82 614–622

    CAS  Article  Google Scholar 

  20. Padma P, Pramod NP, Thyagarajan SP and Khosa RL 1998 Effect of the extract of Annona muricata and Petunia nyctaginiflora on Herpes simplex virus. J. Ethnopharmacol. 61 81–83

    CAS  Article  Google Scholar 

  21. Paul J, Gnanam R, Jayadeepa RM and Arul L 2013 Anti-cancer activity on Graviola, an exciting medicinal plant extract vs various cancer cell lines and a detailed computational study on its potent anti-cancerous leads. Curr. Top. Med. Chem. 13 1666–1673

    CAS  Article  Google Scholar 

  22. Preshaw PM, Hefti AF, Jepsen S, Etienne D, Walker C and Bradshaw MH 2004 Subantimicrobial dose doxycycline as adjunctive treatment for periodontitis. A review. J. Clin. Periodontol. 31 697–707

    CAS  Article  Google Scholar 

  23. Ray JM and Stetler-Stevenson WG 1995 Gelatinase A activity directly modulates melanoma cell adhesion and spreading. EMBO J. 14 908–917

    CAS  Article  Google Scholar 

  24. Seki M, Uzuki M, Ohmoto H, Yoshino K, Maeda S, Kokubun S, Sakurai M and Sawai T 1995 Matrix metalloproteinase (MMP-9) in patients with rheumatoid arthritis. Ryumachi 35 792–801

    CAS  PubMed  Google Scholar 

  25. Stetler-Stevenso WG and Yu AE 2001 Proteases in invasion: matrix metalloproteinases. Semin. Cancer Biol. 11 143–152

    Article  Google Scholar 

  26. Strongin AY, Collier I, Bannikov G, Marmer BL, Grant GA and Goldberg GI 1995 Mechanism of cell surface activation of 72-kDa type IV collagenase. Isolation of the activated form of the membrane metalloprotease. J. Biol. Chem. 270 5331–5338

    CAS  Article  Google Scholar 

  27. Sunilkumar D, Bose C, Shaji SK, Pandurangan N, Kumar GB, Banerji A and Nair BG 2017 Coconut shell derived bioactive compound Oxyresveratrol mediates regulation of Matrix metalloproteinase 9. Int. J. Pharma. Bio. Sci. 8 202–210

    Google Scholar 

  28. Syed Najmuddin SU, Romli MF, Hamid M, Alitheen NB and Nik Abd Rahman NM 2016 Anti-cancer effect of Annona muricata Linn Leaves Crude Extract (AMCE) on breast cancer cell line. BMC Complement Alternat. Med. 16 311

    Article  Google Scholar 

  29. Takahashi C, Sheng Z, Horan TP, Kitayama H, Maki M, Hitomi K, Kitaura Y, Takai S, Sasahara R M, Horimoto A, Ikawa Y, Ratzkin BJ, Arakawa T and Noda M 1998 Regulation of matrix metalloproteinase-9 and inhibition of tumor invasion by the membrane-anchored glycoprotein RECK. Proc. Natl. Acad. Sci. USA 95 13221–13226

    CAS  Article  Google Scholar 

  30. Visse R and Nagase H 2003 Matrix metalloproteinases and tissue inhibitors of metalloproteinases: structure, function, and biochemistry. Circ. Res. 92 827–839

    CAS  Article  Google Scholar 

  31. Yang C,Gundala SR, Mukkavilli R, Vangala S, Reid MD and Aneja R 2015 Synergistic interactions among flavonoids and acetogenins in Graviola (Annona muricata) leaves confer protection against prostate cancer. Carcinogenesis 36 656–665

    Article  Google Scholar 

Download references

Acknowledgements

We acknowledge Mata Amritanandamayi Devi, Chancellor, Amrita Vishwa Vidyapeetham (Amrita University), for being the inspiration behind this study. We would like to acknowledge Dr CM Sreejith, SNM College, Kerala, India, for helping with the process of herbarium preparation and obtaining the accession number. We acknowledge Amrita Agilent Research Centre for providing mass spectrometry data and Dr Prakash Chandran, Department of Chemistry, M.M.N.S.S. College, Kottayam, Kerala, for helping with the analysis of mass spectrometry data. This work was supported by Institutional funding (Amrita University Research) grant (BGN).

Author information

Affiliations

Authors

Corresponding author

Correspondence to Bipin G Nair.

Additional information

Corresponding editor: Rita Mulherkar

Communicated by Rita Mulherkar.

Rights and permissions

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Drishya, G., Nambiar, J., Shaji, S.K. et al. RECK and TIMP-2 mediate inhibition of MMP-2 and MMP-9 by Annona muricata. J Biosci 45, 89 (2020). https://doi.org/10.1007/s12038-020-00056-z

Download citation

Keywords

  • Annona muricata
  • fibrosarcoma
  • MMP-2 and MMP-9
  • RECK
  • TIMP-2