Advertisement

Journal of Natural Medicines

, Volume 71, Issue 1, pp 36–43 | Cite as

AU-1 from Agavaceae plants causes transient increase in p21/Cip1 expression in renal adenocarcinoma ACHN cells in an miR-34-dependent manner

  • Tomofumi Fujino
  • Akihito Yokosuka
  • Hideaki Higurashi
  • Rina Yokokawa
  • Ryo Sakurai
  • Wataru Harashima
  • Yuichi Miki
  • Yasuyuki Fujiwara
  • Yoshihiro Mimaki
  • Makio Hayakawa
Original Paper
First Online:
Received:
Accepted:

Abstract

Here, we show that AU-1, spirostanol saponin isolated from Agavaceae plants, causes a transient increase in cyclin-dependent kinase inhibitor (CDKI) p21/Cip1 through the upregulation of miRNAs, miR-34 and miR-21. AU-1 stimulated p21/Cip1 expression without exerting cytotoxicity against different types of carcinoma cell lines. In renal adenocarcinoma ACHN cells, AU-1 transiently elevated the expression level of p21/Cip1 protein without marked increases in p21/Cip1 mRNA levels. Rapid and transient increases in miR-34 and miR-21, both of which are known to upregulate p21/Cip1, were observed in AU-1-treated cells. Inhibitor for miR-34 and for miR-21 significantly blocked the AU-1-caused increase in p21/Cip1, indicating that elevation of p21/Cip1 protein by AU-1 is dependent on these microRNAs. We further clarified that NAD-dependent deacetylase SIRT1, a direct target of miR-34, is decreased by the treatment with AU-1. Furthermore, we found that SIRT1-knockdown increases p21/Cip1 protein levels in an miR-21-dependent manner. On the other hand, ectopic expression of p21/Cip1 resulted in the lowered expression of miR-34 and miR-21, suggesting that reciprocal regulation exists between p21/Cip1 and these miRNAs. We propose that the following feedback network composed of miR-34/SIRT1/miR-21/p21 is triggered by the treatment with AU-1: in cells treated with AU-1, transient elevation of miR-34 leads to the downregulation of SIRT1, thereby miR-21 is freed from SIRT1-dependent suppression. Then, elevated miR-21 upregulates p21/Cip1 protein, followed by the suppression of miR-34 expression.

Keywords

Agave utahensis p21/Cip1 miR-34 miR-21 SIRT1 

Introduction

We have been working on the role of cell cycle regulators in tumor progression or suppression, mainly focusing on the role of cyclin-dependent kinase inhibitors (CDKIs) p16/INK4a and p21/Cip1 [1, 2]. From the studies on the tumor-suppressive activities of natural compounds derived from Digitalis purpurea, we have demonstrated that the upregulation of p21/Cip1 is closely related with the tumor-suppressive activities of these compounds against certain types of carcinoma cells [3]. In a previous study, we described that AU-1 (Fig. 1), isolated as a novel spirostanol saponin derived from Agave utahensis Engelm. (Agavaceae), exerted strong cytotoxicity against HL-60 human promyelocytic leukemia cells [4]. In order to clarify whether or not AU-1 exhibits cytotoxic action against cells derived from solid types of tumor, we examined the effect of AU-1 on the growth of renal adenocarcinoma cell line ACHN. Although significant growth inhibition was not observed in ACHN cells treated with AU-1, AU-1 induced significant increases in microRNAs (miRNAs), miR-34 and miR-21, respectively. miRNAs, short non-coding RNAs that inhibit the translation and stability of their target mRNAs, are involved in various cellular processes, including the regulation of cell cycle [5]. Dysregulation of miRNAs is thought to be linked to cancer pathogenesis [6]. There are miRNAs that are upregulated in malignant tissues compared to normal tissues; on the other hand, miRNAs that are downregulated in cancer tissues also exist. miR-21 is a typical tumorigenic miRNA, which is overexpressed in different types of solid tumors, whereas miR-34 has been characterized as a tumor suppressor acting downstream of p53 [6]. By characterizing carcinoma cells that are resistant to the cytotoxic action of AU-1, we have found a novel signaling circuit composed of CDKI p21/Cip1, tumor-suppressive miRNA miR-34, oncogenic miRNA miR-21, and NAD+-dependent deacetylase SIRT1.
Fig. 1

Structure of AU-1

Materials and methods

Materials

Etoposide was purchased from Wako Pure Chemicals Industries (Osaka, Japan). (25R)-5β-spirostan-3β-yl O-β-D-glucopyranosyl-(1 → 4)-β-D-galactopyranoside (AU-1) was isolated from Agave utahensis Engelm [4]. siRNA against human SIRT1 was from Santa Cruz Biotechnology (USA). miRCURY LNA Power Inhibitor for miR-34 (4100032-100) and that for miR-21 (4100688-100) were from EXIQON (Denmark). The human renal adenocarcinoma cell line ACHN and human hepatocellular carcinoma cell line HepG2 were obtained from the American Type Culture Collection (ATCC).

Cell culture

ACHN, HepG2, and the human glioma cell line U-251 were maintained in Dulbecco’s modified eagle medium (DMEM) containing 10 % fetal calf serum (FCS), 50 units/mL penicillin G sodium salt, and 50 μg/mL streptomycin sulfate, and cultured in a humidified atmosphere of 8.5 % CO2 at 37 °C.

Construction of the p21/Cip1 expression vector

pcDNA-p21 expression vector was prepared as follows: cDNA was obtained using Ready-To-Go You-Prime First-Strand Beads (GE Healthcare Biosciences, Japan) using total RNA extracted from ACHN cells. Polymerase chain reaction (PCR) was then performed using the cDNA as template (forward primer: CGGGATCCGAAGTCAGTTCCTTGTGGA; reverse primer: GGAATTCAAGGCAGAAGATGTAGAGC), and the amplified product corresponding to the open reading frame of p21/Cip1 (GenBank no. NM000389) was subcloned into the BamHI/EcoRI site of pcDNA3.1(+) vector.

Quantification of mRNA

Quantification of mRNA was performed via real-time PCR. Briefly, 5 μg of total RNA was reverse-transcribed using Ready-To-Go You-Prime First-Strand Beads (GE Healthcare Biosciences). The resultant cDNA was then subjected to real-time PCR analysis using a TaqMan Gene Expression Assay kit (Applied Biosystems, Tokyo, Japan). mRNA levels were determined via TaqMan assay mixtures as follows: p21/Cip1 (Hs01121172) and β-actin (4310881E). Amplification and quantification were performed using the ABI PRISM 7000 Real-Time PCR System (Applied Biosystems). p21/Cip1 mRNA levels were normalized to those of β-actin mRNA as an internal control. Data were analyzed using Student’s t-test.

Quantification of miRNA

Quantification of miRNA was performed via real-time PCR. Briefly, total RNA enriched with microRNA was extracted from ACHN cells using a mirVana miRNA Isolation Kit (Life Technologies, Tokyo, Japan). Reverse transcription was performed using a TaqMan MicroRNA Reverse Transcription kit (Life Technologies) with 10 ng of total RNA. The resultant cDNA was then subjected to real-time PCR analysis using a TaqMan Gene Expression Assay kit (Life Technologies). miRNA levels were then determined via TaqMan assay mixtures as follows: miR-21 (000397), miR-34 (000426), miR-149 (000472), and miR-192 (000491). Amplification and quantification were performed using an ABI PRISM 7000 Real-Time PCR System (Applied Biosystems). Data were analyzed using Student’s t-test.

Immunoblotting

Cells were washed with PBS, and cell extracts were prepared using SDS sample buffer without loading dye. After normalization of protein content via the protein assay, the dye was added to samples, followed by SDS-PAGE and immunoblotting analyses. For the detection of p21/Cip1 and β-actin, the membranes were incubated with the primary antibody (Santa Cruz Biotechnology) for 2 h. Immunocomplexes on the PVDF membranes were visualized with enhanced chemiluminescence Western blotting detection reagents (GE Healthcare Biosciences).

Cytotoxicity assay

The cytotoxic effects of AU-1 on the growth of ACHN and HepG2 cells were examined as follows: ACHN cells seeded on 60-mm dishes at a density of 2.0 × 105 cells/dish or HepG2 cells seeded on 60-mm dishes at a density of 1.0 × 105 cells/dish were incubated in 8.5 % CO2/air for 24 h at 37 °C, followed by AU-1 treatment at various concentrations (up to 50 μM) for 24 h. Negative control cells were treated with vehicle dimethyl sulfoxide (DMSO). Positive control cells were treated with etoposide for 24 h. The cell number per dish was determined using a hemocytometer after the cells were washed.

Statistical analyses

Data are presented as the mean values ± standard error of the mean (SEM) of three experiments performed in triplicate and analyzed using Student’s t-test.

Results and discussion

AU-1 causes transient increase in CDKI p21/Cip1 without exhibiting cytotoxicity towards renal adenocarcinoma cells

Given that AU-1 exhibited potent cytotoxicity against HL-60 human promyelocytic leukemia cells [4], we examined whether or not AU-1 also showed cytotoxicity against solid tumor-derived cell line. In contrast to HL-60 cells, human renal adenocarcinoma-derived ACHN cells and human hepatocellular carcinoma HepG2 cells did not show significant sensitivity toward AU-1, while the anti-cancer agent etoposide showed remarkable cytotoxicity against ACHN cells (Fig. 2a; Table 1). In order to characterize how cell cycle regulation was affected by the treatment with AU-1, expression levels of CDKI p21/Cip1, previously found to inhibit the newly DNA synthesis in ACHN cells (data not shown), were examined at 6 and 24 h after the treatment with AU-1. Interestingly, 6-h treatment of ACHN cells with AU-1 at the dose with no cytotoxicity caused a significant increase in the level of CDKI p21/Cip1, followed by rapid decrease at 24 h after the treatment (Fig. 2b). Similar transient increase in p21/Cip1 induced by AU-1 was also observed in the human hepatocellular carcinoma cell line HepG2 (Fig. 2b) and human glioma cell line U-251 (data not shown). It should be noted that the remarkable difference was not observed between the levels of p21 mRNA in cells left untreated and that in cells treated with AU-1 for 6 or 24 h (Fig. 2c). Thus, our interest turned to the molecular mechanism of how AU-1 increased the p21/Cip1 expression in ACHN cells without impairing cell growth.
Fig. 2

AU-1 transiently elevates p21/Cip1 protein levels without inducing significant growth inhibition in renal adenocarcinoma and hepatocellular carcinoma cells. a Effect of AU-1 on the growth of ACHN and HepG2 cells was examined as described in “Materials and methods”. b ACHN and HepG2 cells were seeded at 4.0 × 105 cells/60-mm dish and treated with DMSO or 15 μM AU-1. After 6 or 24 h, cell extracts were subjected to immunoblotting for detecting p21/Cip1 and β-actin proteins. Quantification of the bands was done by densitometric analysis (Image Gauge Ver. 4.0). c ACHN cells seeded at 4.0 × 105 cells/60-mm dish were treated with DMSO or 15 μM AU-1. After 6 or 24 h, total RNA was extracted and quantification of p21/Cip1 mRNA was performed as described in “Materials and methods”. Data are presented as the mean values ± standard error of the mean (SEM) of three experiments performed in triplicate and analyzed using Student’s t-test

Table 1

Cytotoxic activities of AU-1 against ACHN and HepG2 cells

Compound

ACHN IC50 (μM)a

HepG2 IC50 (μM)a

AU-1

35.8 ± 1.40

40.0 ± 3.56

Etoposide

0.21 ± 0.05

0.32 ± 0.09

ACHN and HepG2 cells were treated with AU-1 and etoposide as described in the legend to Fig. 2a. IC50 values are presented as the mean ± standard error of the mean (SEM) of three experiments performed in triplicate. Data were analyzed using Student’s t-test

Upregulation of miR-34 and miR-21 are involved in p21/Cip1 increase by AU-1

AU-1 upregulates p21/Cip1 protein without inducing elevation of p21 mRNA levels, suggesting that the post-transcriptional regulation is responsible for the transient increase in p21/Cip1 protein. Since p21/Cip1 expression is known to be indirectly upregulated by several miRNAs, such as miR-21 [7], miR-34 [8], miR-14 [9], and miR-192 [10], we examined the levels of these miRNAs in AU-1-treated ACHN cells. As shown in Fig. 3a, miR-34 and miR-21 levels were dramatically increased in cells treated with AU-1 for 2 h. In contrast, the levels of miR-149 and miR-192 were not affected by the treatment with AU-1 (Fig. 3a). In order to examine whether or not miR-34 and miR-21 are involved in the upregulation of p21/Cip1 by AU-1, we determined the p21/Cip1 protein in ACHN cells treated with AU-1 in the presence of inhibitor for miR-34 and miR-21, an anti-sense inhibitor that targets these miRNAs. As shown in Fig. 3b, elevation of p21/Cip1 protein in cells treated with AU-1 was inhibited by inhibitor for miR-34 and miR-21. In addition, when cells were treated with miR-34 inhibitor, AU-1-induced elevation of miR-21 was almost completely blocked (Fig. 3c), indicating that miR-34 is an upstream factor of miR-21 in the pathway for p21/Cip1 increase by AU-1. From these results, it is indicated that miR-34-dependent upregulation of miR-21 is involved in the elevation of p21/Cip1 protein by AU-1.
Fig. 3

Involvement of miR-21 and miR-34 in the elevation of p21/Cip1 protein in ACHN cells treated with AU-1. a ACHN cells seeded at 1.0 × 105 cells/35-mm dish were treated with DMSO or 15 μM AU-1. b ACHN cells seeded at 1.0 × 105 cells/35-mm dish were transfected with 10 nM of miR-34 inhibitor, miR-21 inhibitor, or inhibitor control for 24 h, followed by the treatment with DMSO or 15 μM AU-1 for 6 h. c ACHN cells seeded at 1.0 × 105 cells/35-mm dish were transfected with miR-34 inhibitor or inhibitor control for 24 h, followed by the treatment with DMSO or 15 μM AU-1. a, c At the time indicated, total RNA was extracted. Quantification of miRNAs was performed as described in “Materials and methods”. Data are presented as the mean values ± SEM of three experiments performed in triplicate and analyzed using Student’s t-test. b Cell extracts were subjected to immunoblotting for detecting p21/Cip1 and β-actin proteins. Quantification of the bands was done by densitometric analysis (Image Gauge Ver. 4.0)

miR-34 upregulates p21/Cip1 protein expression via the mechanism that leads to SIRT1 suppression followed by miR21 induction

miR-34 was identified as the direct target of p53 and has been characterized as the tumor-suppressive miRNA [6]. On the other hand, miR-34 is known to inhibit the expression of silent expression regulator 1 (SIRT1) [11], an NAD-dependent deacetylase [12], leading to an increase in acetylated p53, thereby inducing cell cycle arrest or apoptosis [13]. When ACHN cells were treated with AU-1 for 6 h, SIRT1 expression was remarkably inhibited (Fig. 4a). miR-34 Inhibitor blocked the SIRT1 suppression (Fig. 4b), indicating that the transient elevation of miR-34 in response to AU-1 (as shown in Fig. 3a) results in SIRT1 suppression. While SIRT1-knockdown (Fig. 4c) caused transient but significant increase in p21/Cip1 protein (Fig. 4d), as observed in ACHN cells treated with AU-1 for 6 h (Fig. 2b), the elevation of p21/Cip1 protein in SIRT1-knockdown cells did not accompany the increase in p21/Cip1 mRNA (Fig. 4e). Given that p53 is known to upregulate p21/Cip1 expression by activating its transcription in carcinoma cells [13], SIRT1-knockdown causes post-transcriptional increase in p21/Cip1 protein, possibly through the p53-independent mechanism. Interestingly, the increase in p21/Cip1 protein induced by SIRT1-knockdown was completely inhibited by the treatment with the miR-21 inhibitor (Fig. 4f), indicating that reduced expression of SIRT1 allows miR-21 to be elevated, thereby upregulating p21/Cip1 protein. It should be noted that miR-21 is known to induce the activation of mammalian target of rapamycin (mTOR) [14, 15]. Furthermore, we have obtained preliminary data showing that upregulation of p21/Cip1 expression by AU-1 is inhibited by rapamycin (data no shown). It is expected to be revealed whether or not mTOR is involved in the upregulation of p21/Cip1 by AU-1 in the future.
Fig. 4

SIRT1 and miR-21 are involved in the regulation of p21/Cip1 protein expression in ACHN cells exposed to AU-1. a ACHN cells seeded at 1.0 × 105 cells/35-mm dish were treated with DMSO or 15 μM AU-1 for 6 or 24 h. b ACHN cells seeded at 1.0 × 105 cells/35-mm dish were transfected with miR-34 inhibitor or inhibitor control for 24 h. Then, cells were treated with DMSO or 15 μM AU-1 for 6 h. c ACHN cells seeded at 1.0 × 105 cells/35-mm dish were transfected with control or SIRT1 siRNA for 24 or 48 h. d ACHN cells were treated with control or SIRT1 siRNA as described in c for 24 or 48 h. e ACHN cells were treated with control or SIRT1 siRNA as described in c. After 24 or 48 h, total RNA was extracted, and quantification of p21/Cip1 mRNA was performed as described in “Materials and methods”. Data are presented as the mean values ± SEM of three experiments performed in triplicate and analyzed using Student’s t-test. f ACHN cells seeded at 1.0 × 105 cells/35-mm dish were transfected with miR-21 inhibitor or inhibitor control for 24 h. Then, cells were treated with control or SIRT1 siRNA for 24 h. a–c Cell extracts were subjected to immunoblotting for detecting SIRT1 and β-actin proteins. d, f Cell extracts were subjected to immunoblotting for detecting p21/Cip1 and β-actin proteins. Quantification of the bands was performed by densitometric analysis (Image Gauge Ver. 4.0)

Overexpression of p21/Cip1 decreases miR-21 and miR-34 levels

Since AU-1-induced transient increases were observed in p21/Cip1 protein as well as miR-34 and miR-21 (Figs. 2b and 3a), we hypothesized that there exists a signaling circuit that links p21/Cip1, miR-34, and miR-21 to maintain each of their expression levels in ACHN cells. In the case of miR-34 and miR-21, maximal increases were observed at 2 h after AU-1 treatment, followed by the immediate decrease at 6 h, suggesting that there is a feedback regulation that downregulates these miRNAs. Therefore, we examined the possibility as to whether or not p21/Cip1, which is significantly upregulated at 6 h after AU-1 treatment, acts as a negative feedback regulator to lower the levels of miR-34 and miR-21. As shown in Fig. 5b, miR-21 and miR-34 levels were significantly decreased by the ectopic expression of p21/Cip1 (Fig. 5a).
Fig. 5

Downregulation of miR-21 and miR-34 by ectopic expression of p21/Cip1. a ACHN cells seeded at 1.0 × 105 cells/35-mm dish were transfected with pcDNA-p21 vector or pcDNA3.1(+) vector as a control. After 24 or 48 h, cell extracts were subjected to immunoblotting for detecting p21/Cip1 and β-actin proteins. b ACHN cells were transfected with pcDNA-p21 vector or pcDNA3.1(+) vector as described in a. After 24 or 48 h, total RNA was extracted. Quantification of miRNA was performed as described in “Materials and methods”. Data are presented as the mean values ± SEM of three experiments performed in triplicate and analyzed using Student’s t-test

Thus, we propose a possible signaling circuit that is triggered by AU-1 (Fig. 6). When ACHN cells were exposed to AU-1, miR-34 levels are rapidly elevated, thereby lowering SIRT1 expression as reported previously [11]. Impaired expression of SIRT1 may cause miR-21 elevation, leading to the p53-independent/post-transcriptional increase in p21/Cip1 protein levels. Subsequently, p21/Cip suppresses miR-34 expression, resulting in the “turning off” of this circuit.
Fig. 6

Proposed mechanism showing the linkage between miR-34 and p21/Cip1 in ACHN cells treated with AU-1. In ACHN cells, AU-1 upregulates miR-34 expression, thereby suppressing its direct target SIRT1 [11]. Lowered expression of SIRT1 leads to the elevation of miR-21, followed by the upregulation of p21/Cip1 protein. Subsequently, increased p21/Cip1 downregulates miR-34 expression, then p21/Cip1 is decreased to the level comparable to that of control cells

We previously reported that naturally occurring compounds, cardenolide glycosides, caused sustained increase in the levels of p21/Cip1 protein in hepatocellular carcinoma HepG2 and renal adenocarcinoma ACHN cells, resulting in the significant impairment of their growth [3]. In contrast to the observation in the present study using AU-1, cardenolide glycosides-induced elevation of p21/Cip1 protein in ACHN cells accompanied the upregulation of p21/Cip1 mRNA, and, indeed, p53 expression was elevated in cardenolide glycosides-treated ACHN cells. Sustained increase in p21/Cip1 and resultant significant growth inhibition was also provided by the treatment of hepatocellular carcinoma cells with siRNA targeting FXR, a bile acid-activated nuclear receptor [2].

A CDKI, p21/Cip1, plays a key role in cell cycle regulation and its dysregulation may lead to tumor progression. In the present study, we have highlighted a unique signaling circuit composed of p21/Cip1, two different types of miRNAs, miR-34 and miR-21, and an NAD-dependent deacetylase, SIRT1. Among the members of this circuit, both p21/Cip1 and miR-34 are direct p53 targets and have been described as tumor-suppressive molecules [6]. On the other hand, miR-21, which has been characterized as oncogenic miRNA [6], is rather growth-promotive. SIRT1, which plays a critical role in metabolic health by deacetylating many target proteins, was originally considered to be a potential tumor promoter since it negatively regulates the tumor suppressor p53 [12]. Indeed, we have observed that SIRT1-knockdown caused the elevation of p53 protein levels in ACHN cells (data not shown). In the case of ACHN cells treated with AU-1, miR-34 is linked to p21/Cip1 through the p53-independent pathway, in which SIRT1 and miR-21 are involved, although p53 expression is slightly elevated by AU-1 (data not shown). Elucidation of the mechanism of how miR-34 is downregulated by p21/Cip1 is critical to establish AU-1 as the anti-cancer compound against solid types of tumor, since AU-1-triggered increases in miR-34 and p21/Cip1 will be sustained by blocking this negative feedback loop. In order to understand the mechanism of how certain types of tumor cells acquire resistance to tumor-suppressive compounds, further insight should be addressed to the signaling circuit demonstrated in this study.

Notes

Acknowledgments

We thank Ken Ando, Toshiyuki Oshima, and Harutaka Ichikawa for their helpful advice and discussions. This work was supported, in part, by a grant from the Japan Private School Promotion Foundation.

Compliance with ethical standards

Conflict of interest

None declared.

References

  1. 1.
    Fujino T, Takeuchi A, Maruko-Ohtake A, Ohtake Y, Satoh J, Kobayashi T, Tanaka T, Ito H, Sakamaki R, Kashimura R, Ando K, Nishimaki-Mogami T, Ohkubo Y, Kitamura N, Sato R, Kikugawa K, Hayakawa M (2012) Critical role of farnesoid X receptor for hepatocellular carcinoma cell proliferation. J Biochem 152:577–586CrossRefPubMedGoogle Scholar
  2. 2.
    Fujino T, Maruko-Ohtake A, Ohtake Y, Kobayashi T, Ando K, Takeuchi A, Ohkubo Y, Hayakawa M (2015) Farnesoid X receptor knockdown provides significant growth inhibition in hepatocellular carcinoma cells while it does not interfere with the proliferation of primary human hepatocyte-derived cells. J Toxicol Sci 40:501–508CrossRefPubMedGoogle Scholar
  3. 3.
    Fujino T, Kuroda M, Matsuo Y, Kubo S, Tamura C, Sakamoto N, Mimaki Y, Hayakawa M (2015) Cardenolide glycosides from the seeds of Digitalis purpurea exhibit carcinoma-specific cytotoxicity toward renal adenocarcinoma and hepatocellular carcinoma cells. Biosci Biotechnol Biochem 79:177–184CrossRefPubMedGoogle Scholar
  4. 4.
    Yokosuka A, Jitsuno M, Yui S, Yamazaki M, Mimaki Y (2009) Steroidal glycosides from Agave utahensis and their cytotoxic activity. J Nat Prod 72:1399–1404CrossRefPubMedGoogle Scholar
  5. 5.
    Wilczynska A, Bushell M (2015) The complexity of miRNA-mediated repression. Cell Death Differ 22:22–33CrossRefPubMedGoogle Scholar
  6. 6.
    Di Leva G, Garofalo M, Croce CM (2014) MicroRNAs in cancer. Annu Rev Pathol 9:287–314CrossRefPubMedGoogle Scholar
  7. 7.
    Dellago H, Preschitz-Kammerhofer B, Terlecki-Zaniewicz L, Schreiner C, Fortschegger K, Chang MW, Hackl M, Monteforte R, Kühnel H, Schosserer M, Gruber F, Tschachler E, Scheideler M, Grillari-Voglauer R, Grillari J, Wieser M (2013) High levels of oncomiR-21 contribute to the senescence-induced growth arrest in normal human cells and its knock-down increases the replicative lifespan. Aging Cell 12:446–458CrossRefPubMedPubMedCentralGoogle Scholar
  8. 8.
    Zhao J, Lammers P, Torrance CJ, Bader AG (2013) TP53-independent function of miR-34a via HDAC1 and p21(CIP1/WAF1). Mol Ther 21:1678–1686CrossRefPubMedPubMedCentralGoogle Scholar
  9. 9.
    Wang Y, Zheng X, Zhang Z, Zhou J, Zhao G, Yang J, Xia L, Wang R, Cai X, Hu H, Zhu C, Nie Y, Wu K, Zhang D, Fan D (2012) MicroRNA-149 inhibits proliferation and cell cycle progression through the targeting of ZBTB2 in human gastric cancer. PLoS One 7:e41693CrossRefPubMedPubMedCentralGoogle Scholar
  10. 10.
    Jenkins RH, Davies LC, Taylor PR, Akiyama H, Cumbes B, Beltrami C, Carrington CP, Phillips AO, Bowen T, Fraser DJ (2014) miR-192 induces G2/M growth arrest in aristolochic acid nephropathy. Am J Pathol 184:996–1009CrossRefPubMedGoogle Scholar
  11. 11.
    Yamakuchi M, Ferlito M, Lowenstein CJ (2008) miR-34a repression of SIRT1 regulates apoptosis. Proc Natl Acad Sci U S A 105:13421–13426CrossRefPubMedPubMedCentralGoogle Scholar
  12. 12.
    Vaziri H, Dessain SK, Ng Eaton E, Imai SI, Frye RA, Pandita TK, Guarente L, Weinberg RA (2001) hSIR2(SIRT1) functions as an NAD-dependent p53 deacetylase. Cell 107:149–159CrossRefPubMedGoogle Scholar
  13. 13.
    el-Deiry WS, Tokino T, Velculescu VE, Levy DB, Parsons R, Trent JM, Lin D, Mercer WE, Kinzler KW, Vogelstein B (1993) WAF1, a potential mediator of p53 tumor suppression. Cell 75:817–825CrossRefPubMedGoogle Scholar
  14. 14.
    Dey N, Ghosh-Choudhury N, Kasinath BS, Choudhury GG (2012) TGFβ-stimulated microRNA-21 utilizes PTEN to orchestrate AKT/mTORC1 signaling for mesangial cell hypertrophy and matrix expansion. PLoS One 7:e42316CrossRefPubMedPubMedCentralGoogle Scholar
  15. 15.
    Bera A, Das F, Ghosh-Choudhury N, Kasinath BS, Abboud HE, Choudhury GG (2014) microRNA-21-induced dissociation of PDCD4 from rictor contributes to Akt-IKKβ-mTORC1 axis to regulate renal cancer cell invasion. Exp Cell Res 328:99–117CrossRefPubMedPubMedCentralGoogle Scholar

Copyright information

© The Japanese Society of Pharmacognosy and Springer Japan 2016

Authors and Affiliations

  • Tomofumi Fujino
    • 1
  • Akihito Yokosuka
    • 2
  • Hideaki Higurashi
    • 1
  • Rina Yokokawa
    • 1
  • Ryo Sakurai
    • 1
  • Wataru Harashima
    • 1
  • Yuichi Miki
    • 3
  • Yasuyuki Fujiwara
    • 3
  • Yoshihiro Mimaki
    • 2
  • Makio Hayakawa
    • 1
  1. 1.Department of Hygiene and Health Sciences, School of PharmacyTokyo University of Pharmacy and Life SciencesHachiōjiJapan
  2. 2.Department of Medicinal Pharmacognosy, School of PharmacyTokyo University of Pharmacy and Life SciencesHachiōjiJapan
  3. 3.Department of Environmental Health, School of PharmacyTokyo University of Pharmacy and Life SciencesHachiōjiJapan

Personalised recommendations