Characteristics and Functions of PePIF3, a Gene Related to Circadian Rhythm in “Nanlin 895” Poplar

Abstract

Plants coordinate metabolism and other physiological processes via circadian rhythms to cope with the diurnally changing environment. Light is the most important factor influencing circadian clock gene expression. Multi-level interactions occur between the plant circadian clock and the environment, and many circadian clock-related genes exhibit a positive effect in environmental changes on different time scales. Phytochrome-interacting factors (PIFs) are transcription factors with a basic helix-loop-helix (bHLH) domain; they interact with phytochromes (Phys) and play an important role in the early steps of light signal transduction. PIF3 is a member found using a yeast two-hybrid screen for phytochrome B-interacting proteins and functions as a positive regulator mediating tolerance to dehydration and salt stress. In this study, diurnal changes in the “Nanlin 895” poplar leaves transcriptome in natural light were analyzed using RNA sequencing. The Nanlin 895 poplar transcriptome was found to have > 92% similarity with that of Populus trichocarpa. A total of 11,266 differentially expressed genes were identified from 34,869 genes. Among these, we determined via the k-means clustering method that 1067 genes had at least one expression peak at some time during the day. Principal components and Kyoto Encyclopedia of Genes and Genomes pathway enrichment analyses indicated that light was the key factor altering the transcriptome. The full-length coding sequences of PePIF3a and PePIF3b, which encode PIF3 proteins in Nanlin 895 poplar, were cloned; sequence analysis indicated that PePIF3a and PePIF3b were unstable proteins with conserved bHLH, active phytochrome B, and active phytochrome A domains. PePIF3a functioned as positive regulator in drought and salt stress responses. These findings provide a basis for tree breeding to enhance their adaptability to adverse environments.

Introduction

The 24-h periodic rotation of the Earth results in a day–night alternation of light patterns. The metabolism, physiology, and behavior of most organisms, including plants, change significantly between day and night. These biological oscillations are collectively known as circadian rhythms. Plants have long played an important role in the study of circadian rhythms (Mcclung 2006). Plant circadian clock systems are often divided into three categories—input pathways, core oscillators, and output pathways (Dunlap 1999). Plants can sense external environmental information such as light, temperature, and nutrition and transfer these signals to core oscillators via red- and blue-light receptors, as well as other components. The core oscillator of the plant circadian clock is a complex multiple feedback regulation network comprising circadian clock-associated 1 (CCA1), late elongated hypocotyl (LHY), timing of chlorophyll A/B binding protein 1 (TOC1), and other components such as pseudo-response regulators (PRRs; e.g., PRR3, PRR5, PRR7, and PRR9), gigantea (GI), zeitlupe (ZTL), CCA1 hiking expedition (CHE), early flowering 3 (ELF3), early flowering 4 (ELF4), and LUX arrhythmo (LUX). Plants regulate their own physiological processes through this regulatory network to adapt to the external environment. The three categories of the plant circadian clock system are not independent but respond to each other as an organic whole (Harmer 2009; McClung 2008; Pruneda-Paz and Kay 2010).

The core oscillator is composed of multiple interconnected transcriptional-translational feedback loops (TTFLs) that stabilize the rhythm of the plant biological clock over nearly 24 h. This complex network can be divided into three parts—the central, morning, and evening loops. Accumulating evidence indicates that post-transcriptional and non-transcriptional regulation is associated with circadian rhythms (Hernando et al. 2017). Initially, the model of the plant circadian clock was a single negative feedback loop consisting of TOC1/PRR1, CCA1, and LHY (Alabadí et al. 2001; Strayer et al. 2000). PRR family members and GI were later identified using a combination of biological experiments and mathematical modeling (Locke et al. 2005). Based on these two components, a new TTFL that comprises a morning and evening cycle was developed, forming the current three-loop regulatory network (Hernando et al. 2017; McClung 2006).

The main function of the plant circadian clock is to enable plants to predict and respond to changes in the external environment and enhance their adaptability to the environment by regulating physiological and biochemical events. Interaction between the plant circadian clock and the environment occurs at multiple levels (Hotta et al. 2007). Light is the most common environmental input signal to plant circadian clocks.

Light is an essential element for carbohydrate production of green plants by photosynthesis and can also regulate plant growth and development, in a process called photomorphogenesis (Hong et al. 2009). In response to changing environments, a series of photoreceptors have evolved in higher plant cells—phytochromes (phys), which respond to red and far-red light; cryptochromes, which respond to blue light; phototropins; and UV-B receptors (Lin and Shalitin 2003; Chen et al. 2004; Fankhauser and Chen 2008). Phytochrome-interacting factors (PIFs) are transcription factors with a basic helix-loop-helix (bHLH) domain (Castillon et al. 2007; Leivar and Quail 2011; Toledo-Ortiz et al. 2003). There are 15 PIFs; nearly all of these have a conserved active phyB (APB) motif at the N-terminus, which binds specifically to phyB (Khanna et al. 2004; Toledo-Ortiz et al. 2003). PIF1 and PIF3 have an additional active phyA (APA) motif necessary for phyA binding (Al-Sady et al. 2006; Shen et al. 2008). The sequence-specific binding of PIF1, PIF3, PIF4, PIF5, and PIF7 to a core DNA G-box motif (CACGTG) has been examined in several studies (Leivar et al. 2008; Lucas et al. 2008; Toledo-Ortiz et al. 2003).

PIF3 is the first PIF member to be identified using a yeast two-hybrid screen for phyB-interacting proteins (Ni et al. 1999; Shimizu-Sato et al. 2002). PIF3 plays an important role in the early steps of light signal transduction by binding to the C-terminal of phyA and phyB in response to red and far-red light (Kim et al. 2003; Monte et al. 2004). PhyA or phyB phosphorylates PIF3 after it binds to APA or ABP, and then degrades it via the ubiquitination degradation pathway ((Al-Sady et al. 2008; Al-Sady et al. 2006; Park et al. 2004). However, PIF3 stabilizes and accumulates in the dark by combining with the COP1/SPA complex (Ling et al. 2017). PIF3 has been found to form a ternary complex with the G-box motif of LHY and TOC1 and the Pfr conformer of phys in vitro but does not play a significant role in controlling light input to and function of the circadian clockwork (András et al. 2005). Nevertheless, as the target gene of PRR5, PIF3 expression decreases with PRR5 expression (Toda et al. 2019). The PIF complex plays an important role in regulating seed germination, seedling de-etiolation, seedling skotomorphogenesis, shade avoidance, chloroplast development, and flowering time (Chen et al. 2013; Keller et al. 2011; Leivar and Quail 2011; Leivar et al. 2009; Lorrain et al. 2008; Lorrain et al. 2009; Oh et al. 2009). PIF3 negatively regulates chloroplast development and chlorophyll synthesis and positively regulates anthocyanin synthesis (Monte et al. 2004; Shin et al. 2009; Shin et al. 2007; Stephenson et al. 2009). It also plays an important role in abiotic stress signaling pathways to improve drought and salt stress tolerance (Gao et al. 2015).

Poplar is widely used in genetic studies as it grows rapidly, is relatively easy to manipulate experimentally, and has a modest genome size. It is thus frequently used as a model forest species for genomic sequencing (Tuskan et al. 2006). Abiotic stresses, such as salt and drought, seriously affect plant growth and development. Since PIF3 was thought playing an important role in abiotic stress signaling pathways to improve drought and salt stress tolerance (Gao et al. 2015), the study of PIF3 will provide a basis for tree breeding to enhance their adaptability to abiotic stresses. However, the study of PIF3 in forest species has been limited. In this study, we cloned and functionally characterized two PIF3 genes—PePIF3a and PePIF3b— from Populus deltoides × P. euramericana cv “Nanlin 895”. The expression patterns of PePIF3a and PePIF3b were analyzed via RNA sequencing (RNA-Seq) of diurnal changes in the poplar transcriptome in natural light. We performed quantitative reverse-transcription polymerase chain reaction (qRT-PCR) analysis of PePIF3a and PePIF3b in Nanlin 895 poplar grown in the dark to validate the circadian rhythm of PIF3 in poplar. We also applied qRT-PCR to investigate the expression patterns of PePIF3a and PePIF3b in different tissues and in response to various abiotic stresses.

Materials and Methods

Plant Materials and Growth Conditions

In this study, we used Nanlin 895 poplar, a new, fast-growing, high-yield variety bred by the Poplar Research and Development Center at Nanjing Forestry University, Nanjing, Jiangsu, China. Tissue culture seedlings from the same batch were cultured in 1/2 Murashige and Skoog (MS) medium for 30 days, and then transplanted into pots. All plants were cultured in a glasshouse at Nanjing Forestry University (32°07′64″N, 118°81′53″E; 26.5 m a.s.l.) at 25 °C under natural light for 60 days. The plants were sampled at 2-h intervals (13 time points) from 0:00 to 24:00 local time (LT; UTC/GMT + 08:00). At each time point, we randomly collected three mature leaves from each of three plants. Totally, 39 samples were collected, and each sample was as a library. Samples were wrapped in tinfoil paper, frozen in liquid nitrogen, and stored at − 80 °C for RNA-Seq.

After 60 days of growth, poplars were transferred in pots to a dark house at 0:00 LT, where they were grown under natural light; starting at 02:00, we randomly collected three mature leaves from each of three plants at 4-h intervals for 48 h to investigate the circadian rhythms of PePIF3a and PePIF3b in Nanlin 895 poplar. After 2 months of growth, we also exposed wild-type (WT) plants and transgenic lines to high salt and drought conditions for 2 weeks to evaluate the tolerance of transgenic poplars to salt and drought stress. The salt treatment consisted of 200 mM sodium chloride (NaCl) solution; plants in the drought treatment received no water irrigation (Movahedi et al. 2015; Zhang et al. 2017). Following these treatments, leaves were collected for follow-up analyses.

RNA-Seq of Nanlin 895 Poplar at Different Times of the Day

Total RNA was extracted using the polysaccharide- and polyphenolics-rich RNAprep Pure Kit for plants (Tiangen Biotech, Beijing, China) according to the manufacturer’s protocol. RNA purity was detected using a NanoDrop spectrophotometer (Thermo Scientific, Waltham, MA, USA), and RNA integrity was detected using a 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA); for subsequent analyses, the suggested optical density at 260 or 280 nm (OD260/OD280) was > 1.8, and the RNA integrity number (RIN) was ≥ 6.

Using mRNA capture beads, we enriched mRNA from qualified total RNA. The mRNA was then fragmented by heating. First-strand cDNA was synthesized from random hexamers using mRNA as a template, followed by second-strand cDNA synthesis. The fragments were then sorted using VAHTSTM DNA Clean Beads (Vazyme Biotech, Nanjing, China) based on their length. Finally, PCR products were amplified and purified using VAHTSTM DNA Clean Beads to obtain the final library. The library with effective concentration was used for subsequent sequencing on the Illumina HiSeq sequencing platform (San Diego, CA, USA) after pooling. We used the VAHTS Stranded mRNA-seq Library Prep Kit for Illumina (Vazyme Biotech) for sequencing.

The raw reads were generated from the sequencing, and the clean reads were obtained from raw reads after removing the reads with adapter, the reads containing more than 5% unrecognized bases and low-quality reads. Then, a sequence comparison between clean reads and the genome sequence of P. trichocarpa (ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF_000002775.3_Poptr2_0/) was performed by using Tophat2. If more than 60% clean reads were pair-end mapped to genome sequence of P. trichocarpa, it suggested that the Nanlin 895 poplar transcriptome is similar to that of P. trichocarpa, and that the annotation of the P. trichocarpa genome has a very important reference value for research in this field. Unigene expression was calculated using the FPKM (expected number of fragments per kilobase of transcript sequence per millions base pairs sequenced) method, and Cuffdiff analysis module Cufflinks was used for naming differentially expressed genes (DEGs). The DEGs expression patterns were performed by k-means clustering (KMC) method. Principal components analysis (PCA) was performed to elucidate the main factor affecting the Nanlin 895 poplar transcriptome. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses were performed to explain the biological functions of DEGs.

CDSs and PePIF3 Sequence Analysis

To obtain full-length PIF3 cloning of coding sequences (CDSs) found in Nanlin 895 poplar, two pairs of primers (F1: CTGCTTTGATGTCCTCGTTG, R1: AGCCTGAACTCGATGCTTGT; F2: GAGCAGAAGCGTTGCTAACC, R2: CATATGTGCCCCCAGTATCC) were designed based on the sequence of the UTR region of PtPIF3a and PtPIF3b in P. trichocarpa. Sequences obtained by PCR amplification were aligned using the Phytozome program with BLAST (https://phytozome.jgi.doe.gov/pz/portal.html). The CDSs of PIF3a and PIF3b were determined and named PePIF3a and PePIF3b.

Physicochemical properties of PePIF3a and PePIF3b were analyzed using the ExPasy tool (https://www.expasy.org/). The DTU Bioinformatics online software servers TMHMM (http://www.cbs.dtu.dk/services/TMHMM/), SignalP (http://www.cbs.dtu.dk/services/SignalP/), and NetPhos (http://www.cbs.dtu.dk/services/NetPhos/) were used to predict the transmembrane region, signal peptide, and phosphorylation sites of PtPIF3a and PtPIF3b, respectively. Multiple alignment analyses of the amino acid sequences and phylogenetic tree of PtPIF3a and PtPIF3b were constructed using MEGA software (ver. 5.0; https://www.megasoftware.net).

qRT-PCR Analysis

PePIF3a and PePIF3b expression in Nanlin 895 poplar and overexpressed lines was detected using qRT-PCR. Sample RNA was extracted and qualified as described in “qRT-PCR Analysis”. A total of 200 ng extracted RNA was reverse transcribed into cDNA using HiScript II Q RT SuperMix for qPCR (Vazyme Biotech) for each sample. The ChamQ SYBR qPCR Master Mix (Vazyme Biotech) was used for qRT-PCR. Two pairs of PePIF3a and PePIF3b primers were designed for this study—qF1: GAATTGGTGTGGGAAAATGG and qR1: TCTTGCGAAGATTTGTCACG; and qF2: CAAACAGGGAACCAAATGCT and qR2: GCAACTTCTGAGCCTTCACC. ACTIN was used as the reference gene, and its primers for qRT-PCR were AF: GCCATCTCTCATCGGAATGGAA and AR: AGGGCAGTGATTTCCTTGCTCA. For each sample, the final volume was 20 μL, which contained 10 μL 2× ChamQ SYBR qPCR Master Mix, 0.8 μL primers, 0.4 μL 50× ROX Reference Dye 1, 2 μL cDNA, and 6.8 μL ddH2O. The initial degeneration was 95 °C for 30 s for one cycle, followed by 40 cycles of 95 °C for 10 s and 60 °C for 30 s. The final melting curve was obtained at 95 °C for 15 s, 60 °C for 60 s, and 95 °C for 15 s for one cycle. The qRT-PCR results were analyzed using the 2−ΔΔCT comparative cycle threshold (Ct) method with sample means calculated from three replicates. All primers were synthesized by Tsingke (Nanjing) Biotechnology Co., Ltd., Nanjing, China.

Transformation of PePIF3a and PePIF3b in Nanlin 895 Poplar

The CDSs of PePIF3a and PePIF3b were amplified from Nanlin 895 poplar with the primers F3: ATGGATGATCGCGGGCATATG and R3: TCATTTGCGAGCTGATGTATT, and F4: ATGCCTTTGTCTGAGCTCCTA and R4: TCAGTCACAACCAGTTGCTCT. The products were ligated into the pEASY-T3 vector and sequenced. The PePIF3a and PePIF3b fragments from pEASY-T3 were then inserted into the plant expression vector pBI121. The constructed plasmids pBI121-PePIF3a and pBI121-PePIF3b were transformed into Agrobacterium tumefaciens strain EHA105, which has been used for genetic transformation of Nanlin 895 poplar (Movahedi et al. 2014). Leaves and petioles of the Nanlin 895 poplar were pre-cultured for 3 days in 1/2 MS medium. The infection concentration indicating successful infection of pre-cultured Nanlin 895 poplar leaves and petioles by pBI121-PePIF3a and pBI121-PePIF3b was set at OD600 ≈ 0.6. After 3 days of co-cultivation in the dark, leaves and petioles were washed with sterilized MS solution (without sucrose) containing 200 mg/L cefotaxime, and then transferred to 1/2 MS medium with 200 mg/L cefotaxime, 30 mg/L kanamycin, 0.5 mg/L N-6-benzyladenine, 0.004 mg/L thidiazuron, 8 g/L agar, and 30 g/L sucrose at pH 5.8.

Results

PePIF3a and PePIF3b Expression Patterns for Diurnal Changes Indicated by Transcriptome Analysis

In this study, diurnal changes in the transcriptome of Nanlin 895 poplar under natural light were revealed by our RNA-Seq results (SRA accession: PRJNA594172, data will be released on June 30, 2020). In total, 2,651,332,682 raw reads were generated from the Nanlin 895 poplar transcriptome, including 2,530,267,012 clean reads. The number of clean bases was 379.5 Gb. Among all samples, more than 95.51% of clean reads attained the Q30 quality score. GC content was 44.03–45.08% in 39 samples (Supplementary Table S2). A sequence comparison between clean reads and the genome sequence of P. trichocarpa resulted in a total of 2,232,399,845 mapped reads, or 88.2% of clean reads, and 2,070,382,524 paired-end mapped reads, or 81.8% of clean reads (Supplementary Table S3). More than 92.57% of mapped reads were in the exon region, and less than 4.71% and 3% of mapped reads were in the intronic and intergenic regions, respectively (Supplementary Table S4). These results suggest that the Nanlin 895 poplar transcriptome is similar to that of P. trichocarpa, and that the annotation of the P. trichocarpa genome has a very important reference value for research in this field. We also identified 34,869 genes in this comparison and predicted 852 new genes (Supplementary Fig. S1). Unigene expression was calculated using the FPKM method. Differentially expressed genes (DEGs) were identified from all sequenced genes using |log2Ratio| ≥ 1 and q-value false discovery rate (FDR) ≤ 0.05 as criteria, in which “Ratio” represented the ratio of genes FPKM in different time points. Eventually, 11,266 DEGs were screened from 34,869 genes (Supplementary Table S5).

To explain the biological functions of DEGs, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses were performed. The “Circadian rhythm—plant” pathway was significantly enriched almost throughout the entire day. A total of 25 DEGs were enriched in this pathway (Fig. 1), including PRR5, PRR7, CHS, CK2β, ELF3, FKF1, GI, LHY, PHYB, PIF3, and ZTL. PIF3, LHY, and PHYB had expression peaks in the morning, whereas PRR5 had an expression peak in the afternoon.

Fig. 1
figure1

Heatmap of differentially expressed gene (DEG) expression enriched in the “Circadian rhythm—plant” pathway. Sample names are labeled on the x-axis and gene names on the y-axis. P0–P12 represent samples collected from 0:00 to 24:00. Each number in the heatmap was calculated from log10FPKM of the gene expression level of each sample. Darker colors indicate higher expression levels for each gene

PePIF3 CDS Cloning and Sequence Analysis

The CDSs of PePIF3a (GenBank accession: MN308429) and PePIF3b (GenBank accession: MN308430) were obtained from PCR analysis of Nanlin 895 poplar cDNA. The full lengths of PePIF3a and PePIF3b CDS were 1686 and 2142 bp, respectively, which encode 561 and 713 amino acids, respectively (Supplementary Fig. S2). The CDSs of PePIF3–1 and PePIF3–2 showed 98.34% and 98.24% similarity with PIF3 in P. trichocarpa (Potri.014G111400 and Potri.013G001300, respectively), and the proteins were 96.61% and 97.50% similar, respectively. The theoretical molecular weights (MWs) were 61.49 and 76.78 kDa, and the theoretical isoelectric point (pI) was 6.48 and 5.72, respectively. Both PePIF3–1 and PePIF3–2 are unstable proteins, with instability indices of 54.26 and 59.23 (> 40), respectively. The amino acid sequence of PePIF3–1 had 58 positive-charge residues and 62 negative-charge residues, whereas PePIF3–2 had 70 positive-charge residues and 84 negative-charge residues (Supplementary Fig. S3). The results of transmembrane region and signal peptide prediction showed that PePIF3a and PePIF3b are not transmembrane proteins and have no signal peptides. Phosphorylation site prediction indicated that serine is the most important phosphorylation site, followed by threonine and tyrosine (Supplementary Fig. S4).

Multiple sequence alignment of PIF3 amino acid sequences was performed to identify the structural characteristics of the PePIF3a and PePIF3b proteins. Both were found to have a conserved bHLH domain at the C-terminus and ABP and APA domains at another terminus (Fig. 2). A phylogenetic tree was constructed to investigate the evolutionary relationship of PePIF3a and PePIF3b (Fig. 3). PePIF3a and PePIF3b were found in different branches. The closest homolog for both proteins was found in P. trichocarpa and the next-closest homolog was found in P. euphratica. PePIF3a was more closely related to Arabidopsis thaliana and maize PIF3.

Fig. 2
figure2

Sequence alignment of a PePIF3a and b PePIF3b with PIF3 family members from other species. Active phytochrome B (APB) domains are boxed in red and underlined purple; active phytochrome A (APA) domains are boxed in blue and underlined black; and basic helix-loop-helix (bHLH) domains are boxed in green and underlined yellow

Fig. 3
figure3

Phylogenetic tree analyses of PePIF3a and PePIF3b with PIF3 family members from other species. Sequences were obtained from the National Center for Biotechnology Information database using BLAST. The phylogenetic tree was constructed using the neighbor-joining method. GenBank accession numbers are provided in parentheses

Expression Profiles of PePIF3a and PePIF3b in Various Tissues and Under Abiotic Stress

Expression levels of PePIF3a and PePIF3b in various Nanlin 895 poplar tissues were detected using qRT-PCR. Young leaves had the highest expression levels, followed by mature leaves, whereas stems, petioles, and roots had lower expression levels, especially for PePIF3a, which was barely expressed in stems, petioles, and roots (Fig. 4).

Fig. 4
figure4

Expression analyses of a PePIF3a and b PePIF3b in various tissues including young leaves, mature leaves, stems, petioles, and roots. Actin was used as an internal reference to calculate relative expression. Vertical bars represent means ± standard deviation (SD; n = 3). Three independent experiments were performed for each sample. The significant levels compared to young leaves were labeled with asterisk. *p value < 0.05; **p value <0.01

To confirm that PIF3 is involved in the circadian clock, Nanlin 895 poplars were grown in continuous darkness for 48 h, and the expression patterns of PePIF3a and PePIF3b were evaluated. Both PePIF3a and PePIF3b had a disorderly expression pattern in the dark compared to natural light conditions (Fig. 5b), indicating that PePIF3a and PePIF3b expression was highly correlated with light conditions. We then verified the RNA-Seq results for PePIF3a and PePIF3b by comparing with qRT-PCR results for expression under dark conditions (Fig. 5a).

Fig. 5
figure5

Expression analyses of PePIF3a and PePIF3b under a natural light conditions and b continuous darkness. The x-axis indicates sample collection time and the y-axis indicates relative expression. The shaded background indicates night (dark) and the unshaded background indicates day (light). Actin was used as an internal reference to calculate relative expression. Vertical bars represent means ± SD (n = 3). Three independent experiments were performed for each sample

To investigate the expression levels of PePIF3a and PePIF3b in Nanlin 895 poplars under abiotic stress, plants were treated with 200 mM NaCl and denied water irrigation for 2 weeks after 3 months of growth in a glasshouse. We then performed qRT-PCR to detect PePIF3a and PePIF3b expression in various Nanlin 895 poplar tissues. The results showed that PePIF3a expression increased in all tissues (Fig. 6a), suggesting that PePIF3a is involved in the positive regulation of abiotic stress responses. However, PePIF3b expression decreased in all tissues, especially in leaves and stems (Fig. 6b).

Fig. 6
figure6

Expression analyses of a PePIF3a and b PePIF3b in various tissues under salty and drought conditions, including leaves, stems, and roots. Actin was used as an internal reference to calculate relative expression. Vertical bars represent means ± SD (n = 3). Three independent experiments were performed for each sample. The significant levels compared to WT plants were labeled with asterisk. *p value < 0.05; **p value < 0.01

Overexpression of PePIF3a And PePIF3b in Nanlin 895 Poplar

The overexpression vectors pBI121-PePIF3a and pBI121-PePIF3b were constructed using homologous recombination technology (Trelief SoSoo Cloning Kit; Tsingke Biotechnology Co., Beijing, China). The constructed plasmids were then transformed into Agrobacterium tumefaciens strain EHA105 for subsequent introduction into leaves and petioles of Nanlin 895 poplar. Putative buds were transferred to MS medium for shoot elongation after differentiation on selective medium, and putative shoots were transferred to 1/2 MS medium for rooting (Fig. 7). Putative transgenic poplars were detected using PCR with 35S primers and PePIF3a and PePIF3b reverse primers. The positive poplar lines were further validated using qRT-PCR. The results showed that the transgenic poplar lines a2–3, a4–1, a5–5, a6–3, a9–4, and a10–6 and b3–7, b5–2, b6–2, b9–4, b9–7, and b11–5 overexpressed PePIF3a and PePIF3b, respectively. Among these, a5–5 and a6–3 and b3–7 and b9–7 had the highest expression levels for each gene, respectively (Fig. 8).

Fig. 7
figure7

Screening and cultivation of transgenic poplars. a Leaves and petioles infected with agrobacteria containing recombinant plasmids grown on screening medium. b Bud differentiated from petiole. c Buds differentiated from leaves. d Putative positive buds grown on bud-elongation medium. e Putative seedlings grown on shoot-elongation medium. f Positive seedling grown on 1/2 Murashige and Skoog medium. g A positive transgenic poplar transferred to a pot

Fig. 8
figure8

a Detection of putative transgenic lines via polymerase chain reaction (PCR) with 35S primers and PePIF3a and PePIF3b reverse primers using agarose gel electrophoresis. M, Maker; CK+, actin; CK–, wild-type (WT). The putative overexpressed PePIF3a lines were labeled a2–3, a4–1, a5–5, a6–3, a9–4, and a10–6, and the putative overexpressed PePIF3b lines were labeled b3–7, b5–2, b6–2, b9–4, b9–7, and b11–5. b Relative expression of putative overexpressed PePIF3b lines. c Relative expression of putative overexpressed PePIF3a lines. Actin was used as an internal reference to calculate relative expression. Vertical bars represent means ± SD (n = 3). Three independent experiments were performed for each sample

Evaluation of Salt and Drought Tolerance in Poplar

To evaluate the transgenic poplar tolerance to salt and drought stress, WT plants and transgenic lines were grown in a glasshouse for 3 months, and then phenotypic and related physiological indices were compared between plant types. To investigate the salt tolerance of poplars overexpressing PePIF3a and PePIF3b, transgenic lines and WT plants were irrigated with 200 mM NaCl for 2 weeks. Leaf shriveling was observed in WT poplars after 2 weeks of salt treatment, whereas normal growth was observed in PePIF3a-overexpressed poplars (Fig. 9). However, PePIF3b-overexpressed and WT poplars did not exhibit differences under salt treatment. We then detected chlorophyll, proline, and malondialdehyde (MDA) content and peroxidase (POD), superoxide dismutase (SOD), and catalase (CAT) activity in both normal and salty conditions. All concentrations were similar between WT and transgenic lines a5–5 and a6–3 in normal conditions (Fig. 10). Chlorophyll concentration decreased in all plants exposed to high salt content, but the decrease was slightly greater in WT than in transgenic lines. Proline and MDA content and POD, SOD, and CAT activities were higher under salty than normal conditions, but these increases were greater in transgenic lines than in WT plants, except for MDA content. By contrast, MDA content did not increase as much in transgenic lines as in WT plants. Relative expression was examined for APX, CAT, GST, SOD, Robh A, and Robh B to investigate the tolerance of abiotic stress at the mRNA level. There were no significant differences between WT plants and transgenic lines before salt treatment, whereas after salt treatment, APX, CAT, GST, and SOD expression was significantly higher in transgenic lines than in WT plants. In contrast, Robh A and Robh B expression increased by smaller amounts in transgenic lines than in WT plants (Fig. 11). To evaluate drought stress tolerance in transgenic poplars, we again performed an analysis of physiological indices and relative expression and observed significantly similar trends to those observed under salty conditions (Figs. 12 and 13).

Fig. 9
figure9

Phenotypic analysis of WT plants and poplars that overexpressed PePIF3a. a Growth rates did not differ between WT and transgenic poplars under normal conditions. Leaf shriveling was observed for WT poplars exposed to b high salt content and c drought, whereas transgenic poplars grew normally

Fig. 10
figure10

Physiological analyses of PePIF3a transgenic plants before and after salt treatment. WT plants were used as the control. a Relative chlorophyll and b free proline contents. c Malondialdehyde (MDA), d peroxidase (POD), e superoxide dismutase (SOD), and f catalase (CAT) activities. Vertical bars represent means ± SD (n = 3). Three independent experiments were performed for each sample. The significant levels compared to WT plants were labeled with asterisk. *p value < 0.05; **p value < 0.01

Fig. 11
figure11

Relative expression levels of genes related to reactive oxygen species (ROS) scavenging and generation in PePIF3a transgenic plants before and after salt treatment. a Ascorbate peroxidase (APX), b CAT, c glutathione S-transferase (GST), d SOD, e Robh A, and f Robh B. Vertical bars represent means ± SD (n = 3). Three independent experiments were performed for each sample. The significant levels compared to WT plants were labeled with asterisk. *p value < 0.05; **p value < 0.01

Fig. 12
figure12

Physiological analyses of PePIF3a transgenic plants before and after drought treatment. WT plants were used as the control. a Relative chlorophyll and b free proline contents. c MDA, d POD, e SOD, and f CAT activities. Vertical bars represent means ± SD (n = 3). Three independent experiments were performed for each sample. The significant levels compared to WT plants were labeled with asterisk. *p value < 0.05; **p value < 0.01

Fig. 13
figure13

Relative expression of genes related to ROS scavenging and generation in PePIF3a transgenic plants before and after drought treatment. a APX, b CAT, c GST, d SOD, e Robh A, and f Robh B. Vertical bars represent means ± SD (n = 3). Three independent experiments were performed for each sample. The significant levels compared to WT plants were labeled with asterisk. *p value < 0.05; **p value < 0.01

Discussion

Unlike most animals, terrestrial plants are sessile organisms, and their adaptation to the environment is passive. Therefore, plants develop mechanisms over long periods to cope with environmental changes. Under natural conditions, the plant transcriptome is mainly affected by three factors—the circadian clock, environmental stimuli, and plant age (Nagano et al. 2012). The circadian clock is among the most important factors affecting the transcriptome. In this study, diurnal changes to the Nanlin 895 poplar transcriptome under natural light were detected using RNA-Seq. A total of 11,266 DEGs were identified, of which 1067 genes were found by the k-means clustering (KMC) method to have at least one expression peak during the day (Supplementary Fig. S5). The expression peaks of these genes covered nearly all periods of the day; most peaks occurred after dawn and before evening. This finding is consistent with the results of a previous transcriptome sequencing study, which suggested that circadian rhythm is highly conserved in monocotyledonous and dicotyledonous plants including Arabidopsis thaliana, rice, and poplar (Filichkin et al. 2011).

Principal components analysis (PCA) was performed to elucidate the main factor affecting the Nanlin 895 poplar transcriptome (Supplementary Fig. S6). Samples were roughly divided into two parts on the PC2 axis, which represented light levels. When PC2 > 0, samples were collected during the day (P6–P16), whereas when PC2 < 0, samples were collected during the night (P0–P4 and P18–P24). GO and KEGG pathway enrichment analyses revealed significant differences in the transcriptome between day and night. Together, these results indicate that light plays an important role in transcriptome changes.

PIF3 plays an important role in the early steps of light signal transduction (Kim et al. 2003; Monte et al. 2004). PIF3 binds to phyA with the APA domain, to phyB with the APB domain, and to the G-Box motif of LHY and TOC1. In this study, PIF3 was found to participate in the “Circadian rhythm—plant” pathway. PIF3, PHYB, and LHY expression peaks were detected in the morning; however, as the target-like gene of PRR5, PIF3 was negatively regulated by PRR5 (Toda et al. 2019), with an expression peak in the afternoon (Fig. 1). A previous study found that PIF3 does not play a significant role in controlling the light input and function of circadian clockwork (András et al. 2005), although it is involved in the circadian rhythm pathway. Our results showed that PePIF3a and PePIF3b exhibited disorderly expression patterns in the dark, compared to expression patterns under natural light (Fig. 5b), indicating that PePIF3a and PePIF3b expression was highly correlated with light conditions. In addition, overexpression of PePIF3a would not disturb its expression patterns during the day. The qRT-PCR result showed that PePIF3a expression pattern in transgenic line a5–5 was similar to that in WT plants (Supplementary Fig. S7).

Plants have developed highly organized signaling networks to respond to and cope with abiotic stress. PIF3 promotes crosstalk between different signal pathways in these networks. In this study, the CDSs of PePIF3a and PePIF3b were cloned and sequenced from Nanlin 895 poplar; these 1686- and 2142-bp sequences were found to encode 561 and 713 amino acids, respectively (Supplementary Fig. S2). PIF3 genes in Nanlin 895 poplar were highly homologous to those in P. trichocarpa, with 98.34% and 98.24% similarity. PePIF3a and PePIF3b proteins were unstable and had a conserved bHLH domain at the C-terminus and ABP and APA domains at the N-terminus (Fig. 2).

PIF3 plays an important role in abiotic stress signaling pathways to improve drought and salt stress tolerance (Gao et al. 2015). ZmPIF3 from maize has been shown to enhance drought and salt tolerance in rice, indicating that PIF3 regulates plant response to drought and salt stresses (Gao et al. 2015). In the present study, the relative expression of PePIF3a and PePIF3b was detected under normal and abiotic stress conditions in WT plants (Fig. 6). PePIF3a was found to be upregulated in different tissues under salty conditions, and in stems and roots under drought conditions (Fig. 6a). However, PePIF3b was downregulated in all tissues under both salty and drought conditions compared with normal conditions (Fig. 6b). PePIF3a and PePIF3b were overexpressed in Nanlin 895 poplar; therefore, we analyzed phenotypic and related physiological indices between WT plants and transgenic lines. The Nanlin 895 poplar lines a5–5 and a6–3, which overexpressed PePIF3a, exhibited better growth adaptability under salty conditions (Fig. 9). Our analysis of related physiological indices further supported this finding. Photosynthetic proteins and pigments can be damaged by abiotic stress, and chlorophyll content has been used as a physiological senescence marker (Krause and Weis 1991; Gao et al. 2015). In the current study, the chlorophyll content of transgenic lines a5–5 and a6–3 decreased to a lesser extent than that of WT plants under salty and drought conditions (Figs. 10a and 12a). Proline is involved in osmotic adjustment, which can reduce water loss and maintain the stability of proteins, membranes, and subcellular structure in cells under stressful conditions (Ashraf and Foolad 2007; Movahedi et al. 2015). Proline content increased to a greater extent in transgenic lines a5–5 and a6–3 than in WT plants under salty and drought conditions; thus, a5–5 and a6–3 showed higher tolerance to abiotic stress (Figs. 10b and 12b). MDA is the final product of lipid peroxidation (Xu et al. 2018); transgenic lines a5–5 and a6–3 had lower MDA content than WT plants under salty and drought conditions, indicating that they suffered slightly more membrane damage (Figs. 10c and 12c). SOD, POD, and CAT are three prominent antioxidant enzymes involved in antioxidant systems regulating intracellular reactive oxygen species (ROS) homeostasis (Choudhury et al. 2017; Mittler et al. 2004). POD (Figs. 10d and 12d), SOD (Figs. 10e and 12e), and CAT (Figs. 10f and 12f) activities were higher in transgenic lines a5–5 and a6–3 than in WT plants under salty and drought conditions. Together, these results indicate that PePIF3a is involved in poplar abiotic stress responses. However, we found no evidence for the involvement of PePIF3b in abiotic stress tolerance (Supplementary Figs. S8 and S9). We also detected chlorophyll, proline, and MDA content and POD, SOD, and CAT activity in the transgenic line a5–5 under 24 h without drought and salt treatments (Supplementary Fig. S10). The results showed they performed different content or activity levels during the day. However, we found no evidence for the corresponding changes between them and PePIF3a expression. Our results in Figs. 10, 11 and 12 show that these physiological indices had no significant difference between transgenics and WT plants. To evaluate the involvement of PePIF3a in abiotic stress tolerance at the mRNA level, we used qRT-PCR to evaluate the relative expression of four genes encoding ROS-scavenging enzymes—SOD, ascorbate peroxidases (APX), CAT, and glutathione S-transferase (GST)—as well as two ROS-generating–related genes—Robh A and Robh B. All six genes exhibited significantly higher relative expression following salt and drought treatments, and SOD, APX, CAT, and GST activities increased to a greater extent in a5–5 and a6–3 lines than in WT plants, whereas Robh A and Robh B showed the opposite trend (Figs. 11 and 13).

In conclusion, diurnal changes in the Nanlin 895 poplar transcriptome in natural light were evaluated using RNA-Seq in this study. The results showed that the Nanlin 895 poplar transcriptome had > 92% similarity with that of P. trichocarpa. A total of 11,266 DEGs were identified from 34,869 genes; of these, 1067 genes were shown by the KMC method to have at least one expression peak at some time during the day. PCA and GO and KEGG pathway enrichment results indicated that light was the key factor influencing changes in the transcriptome. PIF3 is a key factor in Circadian rhythm—plant pathway by the way of KEGG pathway enrichment analysis. The expression of PePIF3a and PePIF3b under different light patterns indicated that their expression was highly correlated with light conditions. The full-length CDSs of PePIF3a and PePIF3b, which encode PIF3 proteins in Nanlin 895 poplar, were cloned. Sequence analysis indicated that both PePIF3a and PePIF3b were unstable proteins with conserved bHLH, APB, and APA domains. PePIF3a functioned as a positive regulator involved in abiotic stress responses. The findings of the present study provide a basis for further studies of PIF3 function in plants and will facilitate breeding to enhance tree adaptability to adverse environments.

References

  1. Al-Sady B, Kikis EA, Monte E, Quail PH (2008) Mechanistic duality of transcription factor function in phytochrome signaling. Proc Natl Acad Sci U S A 105:2232–2237

    CAS  PubMed  PubMed Central  Google Scholar 

  2. Al-Sady B, Ni W, Kircher S, Schäfer E, Quail PH (2006) Photoactivated phytochrome induces rapid PIF3 phosphorylation prior to proteasome-mediated degradation. Mol Cell 23:439–446

    CAS  PubMed  Google Scholar 

  3. Alabadí D, Oyama T, Yanovsky M, Harmon FG, Más P, Kay SA (2001) Reciprocal regulation between TOC1 and LHY/CCA1 within the Arabidopsis circadian clock. Science 293:880–883

    PubMed  Google Scholar 

  4. András V, Stefan K, Erzsébet F, Millar AJ, Eberhard SF, László KB, Ferenc N (2005) Functional characterization of phytochrome interacting factor 3 for the Arabidopsis thaliana circadian clockwork. Plant Cell Physiol 46:1591–1602

    Google Scholar 

  5. Ashraf M, Foolad MR (2007) Roles of glycine betaine and proline in improving plant abiotic stress resistance. Environ Exp Bot 59:206–216

    CAS  Google Scholar 

  6. Castillon A, Shen H, Enamul H (2007) Phytochrome interacting factors: central players in phytochrome-mediated light signaling networks. Trends Plant Sci 12:514–521

    CAS  PubMed  Google Scholar 

  7. Chen D, Xu G, Tang W, Jing Y, Ji Q, Fei Z, Lin R (2013) Antagonistic basic helix-loop-helix/bZIP transcription factors form transcriptional modules that integrate light and reactive oxygen species signaling in Arabidopsis. Plant Cell 25:1657–1673

    CAS  PubMed  PubMed Central  Google Scholar 

  8. Chen M, Chory J, Fankhauser C (2004) Light signal transduction in higher plants. Annu Rev Genet 38:87–117. https://doi.org/10.1146/annurev.genet.38.072902.092259

    CAS  Article  PubMed  Google Scholar 

  9. Choudhury FK, Rivero RM, Blumwald E, Mittler R (2017) Reactive oxygen species, abiotic stress and stress combination. Plant J 90:856–867. https://doi.org/10.1111/tpj.13299

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  10. Dunlap JC (1999) Molecular bases for circadian clocks. Cell 96:271–290

    CAS  PubMed  Google Scholar 

  11. Fankhauser C, Chen M (2008) Transposing phytochrome into the nucleus. Trends Plant Sci 13:596–601

    CAS  PubMed  Google Scholar 

  12. Filichkin SA, Breton G, Priest HD, Dharmawardhana P, Jaiswal P, Fox SE, Michael TP, Chory J, Kay SA, Mockler TC (2011) Global profiling of rice and poplar transcriptomes highlights key conserved circadian-controlled pathways and cis-regulatory modules. PLoS One 6:e16907

    CAS  PubMed  PubMed Central  Google Scholar 

  13. Gao Y, Jiang W, Dai Y, Xiao N, Zhang C, Li H, Lu Y, Wu M, Tao X, Deng D (2015) A maize phytochrome-interacting factor 3 improves drought and salt stress tolerance in rice. Plant Mol Biol 87:413–428

    CAS  PubMed  Google Scholar 

  14. Harmer SL (2009) The circadian system in higher plants. Annu Rev Plant Biol 60:357–377. https://doi.org/10.1146/annurev.arplant.043008.092054

    CAS  Article  PubMed  Google Scholar 

  15. Hernando CE, Romanowski A, Yanovsky MJ (2017) Transcriptional and post-transcriptional control of the plant circadian gene regulatory network. Biochim Biophys Acta Gene Regul Mech 1860:84–94

    CAS  PubMed  Google Scholar 

  16. Hong G-J, Hu W-L, Li J-X, Chen X-Y, Wang L-J (2009) Increased accumulation of artemisinin and anthocyanins in Artemisia annua expressing the Arabidopsis blue light receptor CRY1. Plant Mol Biol Report 27:334–341

    CAS  Google Scholar 

  17. Hotta CT, Gardner MJ, Hubbard KE, Baek SJ, Dalchau N, Suhita D, Dodd AN, Webb AA (2007) Modulation of environmental responses of plants by circadian clocks. Plant Cell Environ 30:333–349

    CAS  PubMed  Google Scholar 

  18. Keller MM, Jaillais Y, Pedmale UV, Moreno JE, Chory J, Ballaré CL (2011) Cryptochrome 1 and phytochrome B control shade-avoidance responses in Arabidopsis via partially independent hormonal cascades. Plant J 67:195–207

    CAS  PubMed  PubMed Central  Google Scholar 

  19. Khanna R, Huq E, Kikis EA, Sady BA, Lanzatella C, Quail PH (2004) A novel molecular recognition motif necessary for targeting photoactivated phytochrome signaling to specific basic helix-loop-helix transcription factors. Plant Cell 16:3033–3044

    CAS  PubMed  PubMed Central  Google Scholar 

  20. Kim J, Yi H, Choi G, Shin B, Song P-S, Choi G (2003) Functional characterization of phytochrome interacting factor 3 in phytochrome-mediated light signal transduction. Plant Cell 15:2399–2407

    CAS  PubMed  PubMed Central  Google Scholar 

  21. Krause GH, Weis E (1991) Chlorophyll fluorescence and photosynthesis: the basics. Annu Rev Plant Physiol Plant Mol Biol 42:313–349. https://doi.org/10.1146/annurev.pp.42.060191.001525

    CAS  Article  Google Scholar 

  22. Leivar P, Monte E, Al-Sady B, Carle C, Storer A, Alonso JM, Ecker JR, Quail PH (2008) The Arabidopsis phytochrome-interacting factor PIF7, together with PIF3 and PIF4, regulates responses to prolonged red light by modulating phyB levels. Plant Cell 20:337–352

    CAS  PubMed  PubMed Central  Google Scholar 

  23. Leivar P, Quail PH (2011) PIFs: pivotal components in a cellular signaling hub. Trends Plant Sci 16:19–28

    CAS  PubMed  Google Scholar 

  24. Leivar P, Tepperman JM, Monte E, Calderon RH, Liu TL, Quail PH (2009) Definition of early transcriptional circuitry involved in light-induced reversal of PIF-imposed repression of photomorphogenesis in young Arabidopsis seedlings. Plant Cell 11:3535–3553

    Google Scholar 

  25. Lin C, Shalitin D (2003) Cryptochrome structure and signal transduction. Ann Biol 54:469–496

    CAS  Google Scholar 

  26. Ling JJ, Li J, Zhu D, Deng XW (2017) Noncanonical role of Arabidopsis COP1/SPA complex in repressing BIN2-mediated PIF3 phosphorylation and degradation in darkness. Proc Natl Acad Sci U S A 114:3539–3544

    CAS  PubMed  PubMed Central  Google Scholar 

  27. Locke JC, Southern MM, Kozma-Bognár L, Hibberd V, Brown PE, Turner MS, Millar AJ (2005) Extension of a genetic network model by iterative experimentation and mathematical analysis. Mol Syst Biol 1:E1–E9

    Google Scholar 

  28. Lorrain S, Allen T, Duek P, Whitelam G, Fankhauser C (2008) Phytochrome-mediated inhibition of shade avoidance involves degradation of growth-promoting bHLH transcription factors. Plant J 53:312–323

    CAS  PubMed  Google Scholar 

  29. Lorrain S, Trevisan M, Pradervand S, Fankhauser C (2009) Phytochrome interacting factors 4 and 5 redundantly limit seedling de-etiolation in continuous far-red light. Plant J 60:449–461

    CAS  PubMed  Google Scholar 

  30. Lucas MD, Davière J-M, Rodríguez-Falcón M, Pontin M, Iglesias-Pedraz JM, Lorrain S, Fankhauser C, Blázquez MA, Titarenko E, Prat S (2008) A molecular framework for light and gibberellin control of cell elongation. Nature 451:480–484

    PubMed  Google Scholar 

  31. Mcclung CR (2006) Plant circadian rhythms. Plant Cell 18:792–803

    CAS  PubMed  PubMed Central  Google Scholar 

  32. Mcclung CR (2008) Comes a time. Curr Opin Plant Biol 11:514–520

    CAS  PubMed  Google Scholar 

  33. Mittler R, Vanderauwera S, Gollery M, Van Breusegem F (2004) Reactive oxygen gene network of plants. Trends Plant Sci 9:490–498

    CAS  PubMed  Google Scholar 

  34. Monte E, Tepperman JM, Al-Sady B, Kaczorowski KA, Alonso JM, Ecker JR, Li X, Zhang Y, Quail PH (2004) The phytochrome-interacting transcription factor, PIF3, acts early, selectively, and positively in light-induced chloroplast development. Proc Natl Acad Sci U S A 101:16091–16098

    CAS  PubMed  PubMed Central  Google Scholar 

  35. Movahedi A, Zhang J, Amirian R, Zhuge Q (2014) An efficient agrobacterium-mediated transformation system for poplar. Int J Mol Sci 15:10780–10793

    CAS  PubMed  PubMed Central  Google Scholar 

  36. Movahedi A, Zhang J, Yin T, Zhuge Q (2015) Functional analysis of two orthologous NAC genes, CarNAC3, and CarNAC6 from Cicer arietinum, involved in abiotic stresses in poplar. Plant Mol Biol Report 33:1539–1551

    CAS  Google Scholar 

  37. Nagano AJ, Sato Y, Mihara M, Antonio BA, Motoyama R, Itoh H, Nagamura Y, Izawa T (2012) Deciphering and prediction of transcriptome dynamics under fluctuating field conditions. Cell 151:1358–1369

    CAS  PubMed  Google Scholar 

  38. Ni M, Tepperman JM, Quail PH (1999) Binding of phytochrome B to its nuclear signalling partner PIF3 is reversibly induced by light. Nature 400:781–784

    CAS  PubMed  Google Scholar 

  39. Oh E, Kang H, Yamaguchi S, Park J, Lee D, Kamiya Y, Choi G (2009) Genome-wide analysis of genes targeted by phytochrome interacting factor 3-like5 during seed germination in Arabidopsis. Plant Cell 21:403–419

    CAS  PubMed  PubMed Central  Google Scholar 

  40. Park E, Kim J, Lee Y, Shin J, Oh E, Chung W-I, Liu JR, Choi G (2004) Degradation of phytochrome interacting factor 3 in phytochrome-mediated light signaling. Plant Cell Physiol 45:968–975

    CAS  PubMed  Google Scholar 

  41. Pruneda-Paz JL, Kay SA (2010) An expanding universe of circadian networks in higher plants. Trends Plant Sci 15:259–265

    CAS  PubMed  PubMed Central  Google Scholar 

  42. Shen H, Zhu L, Castillon A, Majee M, Downie B, Huq E (2008) Light-induced phosphorylation and degradation of the negative regulator phytochrome-interacting factor1 from Arabidopsis depend upon its direct physical interactions with photoactivated phytochromes. Plant Cell 20:1586–1602

    CAS  PubMed  PubMed Central  Google Scholar 

  43. Shimizu-Sato S, Huq E, Tepperman JM, Quail PH (2002) A light-switchable gene promoter system. Nat Biotechnol 20:1041–1044

    CAS  PubMed  Google Scholar 

  44. Shin J, Kim K, Kang H, Zulfugarov IS, Bae G, Lee C-H, Lee D, Choi G (2009) Phytochromes promote seedling light responses by inhibiting four negatively-acting phytochrome-interacting factors. Proc Natl Acad Sci U S A 106:7660–7665

    CAS  PubMed  PubMed Central  Google Scholar 

  45. Shin J, Park E, Choi G (2007) PIF3 regulates anthocyanin biosynthesis in an HY5-dependent manner with both factors directly binding anthocyanin biosynthetic gene promoters in Arabidopsis. Plant J 49:981–994

    CAS  PubMed  Google Scholar 

  46. Stephenson PG, Fankhauser C, Terry MJ (2009) PIF3 is a repressor of chloroplast development. Proc Natl Acad Sci U S A 106:7654–7659

    CAS  PubMed  PubMed Central  Google Scholar 

  47. Strayer C, Oyama T, Schultz TF, Raman R, Somers DE, Más P, Panda S, Kreps JA, Kay SA (2000) Cloning of the Arabidopsis clock gene TOC1, an autoregulatory response regulator homolog. Science 289:768–771

    CAS  PubMed  PubMed Central  Google Scholar 

  48. Toda Y, Kudo T, Kinoshita T, Nakamichi N (2019) Evolutionary insight into the clock-associated PRR5 transcriptional network of flowering plants. Sci Rep 9:2983–2996. https://doi.org/10.1038/s41598-019-39720-2

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  49. Toledo-Ortiz G, Huq E, Quail PH (2003) The Arabidopsis basic/helix-loop-helix transcription factor family. Plant Cell 15:1749–1770

    CAS  PubMed  PubMed Central  Google Scholar 

  50. Tuskan GA, DiFazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapman J, Chen GL, Cooper D, Coutinho PM, Couturier J, Covert S, Cronk Q, Cunningham R, Davis J, Degroeve S, Dejardin A, Depamphilis C, Detter J, Dirks B, Dubchak I, Duplessis S, Ehlting J, Ellis B, Gendler K, Goodstein D, Gribskov M, Grimwood J, Groover A, Gunter L, Hamberger B, Heinze B, Helariutta Y, Henrissat B, Holligan D, Holt R, Huang W, Islam-Faridi N, Jones S, Jones-Rhoades M, Jorgensen R, Joshi C, Kangasjarvi J, Karlsson J, Kelleher C, Kirkpatrick R, Kirst M, Kohler A, Kalluri U, Larimer F, Leebens-Mack J, Leple JC, Locascio P, Lou Y, Lucas S, Martin F, Montanini B, Napoli C, Nelson DR, Nelson C, Nieminen K, Nilsson O, Pereda V, Peter G, Philippe R, Pilate G, Poliakov A, Razumovskaya J, Richardson P, Rinaldi C, Ritland K, Rouze P, Ryaboy D, Schmutz J, Schrader J, Segerman B, Shin H, Siddiqui A, Sterky F, Terry A, Tsai CJ, Uberbacher E, Unneberg P, Vahala J, Wall K, Wessler S, Yang G, Yin T, Douglas C, Marra M, Sandberg G, Van de Peer Y, Rokhsar D (2006) The genome of black cottonwood, Populus trichocarpa (Torr. & Gray). Science 313:1596–1604. https://doi.org/10.1126/science.1128691

    CAS  Article  PubMed  Google Scholar 

  51. Xu Y, Zheng X, Song Y, Zhu L, Yu Z, Gan L, Zhou S, Liu H, Wen F, Zhu C (2018) NtLTP4, a lipid transfer protein that enhances salt and drought stresses tolerance in Nicotiana tabacum. Sci Rep 8:8873–8886. https://doi.org/10.1038/s41598-018-27274-8

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  52. Zhang J, Movahedi A, Sang M, Wei Z, Xu J, Wang X, Wu X, Wang M, Yin T, Zhuge Q (2017) Functional analyses of NDPK2 in Populus trichocarpa and overexpression of PtNDPK2 enhances growth and tolerance to abiotic stresses in transgenic poplar. Plant Physiol Biochem 117:61–74

    CAS  PubMed  Google Scholar 

Download references

Funding

This study was supported by the National Science Foundation of China (No. 31570650), the International Science & Technology Cooperation Program of China (2014DFG32440), and the Priority Academic Program Development of Jiangsu Higher Education Institutions.

Author information

Affiliations

Authors

Corresponding author

Correspondence to Qiang Zhuge.

Ethics declarations

Conflict of Interest

The authors declare that they have no conflict of interest.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Key Message

Circadian rhythm gene PePIF3a from Populus was cloned and characterized, which functioned as a positive regulator mediating tolerance to dehydration and salt stress. Diurnal changes in the “Nanlin 895” poplar transcriptome in natural light were analyzed using RNA sequencing. Light was the key factor altering the transcriptome.

Electronic Supplementary Material

Figure S1
figure14

Sequences of genes analyzed in this study. (PNG 163 kb)

Figure S2
figure15

Amino acid and nucleotide sequences of (a) PePIF3a and (b) PePIF3b. The initiation codon is boxed, and the termination codon is indicated with an asterisk. (PNG 2220 kb)

Figure S3
figure16

Amino acid composition of PePIF3a and PePIF3b proteins. (PNG 79 kb)

Figure S4
figure17

Prediction of phosphorylation locations in PePIF3a and PePIF3b proteins. (PNG 41 kb)

Figure S5
figure18

K-means clustering analysis of DEGs. DEGs were divided into a total of 30 clusters. Clusters 3, 11, 15, 19, 20, and 27 exhibited at least one expression peak during the day. (PNG 515 kb)

Figure S6
figure19

Principal component analysis plot. (PNG 99 kb)

Figure S7
figure20

Expression analyses of PePIF3a in transgenic line a5–5 during the day under normal growth condition. Actin was used as an internal reference to calculate relative expression. Vertical bars represent means ± SD (n = 3). Three independent experiments were performed for each sample. (PNG 57 kb)

Figure S8
figure21

Physiological analyses of PePIF3b transgenic plants before and after salt treatment. WT plants were used as the control. (a) Relative chlorophyll and (b) free proline contents. (c) MDA, (d) POD, (e) SOD, and (f) CAT activities. (PNG 94 kb)

Figure S9
figure22

Physiological analyses of PePIF3a transgenic plants before and after drought treatment. WT plants were used as the control. (a) Relative chlorophyll and (b) free proline contents. (c) MDA, (d) POD, (e) SOD, and (f) CAT activities. (PNG 86 kb)

Figure S10
figure23

Physiological analyses of PePIF3a in transgenic line a5–5 during the day under normal growth condition. (a) Relative chlorophyll and (b) free proline contents. (c) Malondialdehyde (MDA), (d) peroxidase (POD), (e) superoxide dismutase (SOD), and (f) catalase (CAT) activities. Vertical bars represent means ± SD (n = 3). Three independent experiments were performed for each sample. (PNG 428 kb)

High Resolution Image (TIF 561 kb)

High Resolution Image (TIF 6919 kb)

High Resolution Image (TIF 402 kb)

High Resolution Image (TIF 200 kb)

High Resolution Image (TIF 2204 kb)

High Resolution Image (TIF 357 kb)

High Resolution Image (TIF 6829 kb)

High Resolution Image (TIF 416 kb)

High Resolution Image (TIF 402 kb)

High Resolution Image (TIF 1876 kb)

Table S1

Primers used in this study. (XLSX 9 kb)

Table S2

Statistical results for sequence analyses. (XLSX 13 kb)

Table S3

Statistical results for sequence comparisons. (XLSX 13 kb)

Table S4

Distribution of sequences within the poplar genome. (XLSX 11 kb)

Table S5

DEGs in each time point. P0 was used to compare with each time point. “Up” represents gene’s expression which was up-regulated, while “down” represents down-regulated. (XLSX 10 kb)

Rights and permissions

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Wu, X., Liu, L., Xu, Q. et al. Characteristics and Functions of PePIF3, a Gene Related to Circadian Rhythm in “Nanlin 895” Poplar. Plant Mol Biol Rep 38, 586–600 (2020). https://doi.org/10.1007/s11105-020-01215-0

Download citation

Keywords

  • Abiotic stresses
  • Circadian clock
  • PIF3
  • Poplar
  • Transcriptome sequencing