Advertisement

Plant Molecular Biology Reporter

, Volume 30, Issue 2, pp 339–348 | Cite as

Arabidopsis AtNek2 Kinase is Essential and Associates with Microtubules

  • Francesco Agueci
  • Twan Rutten
  • Dmitri Demidov
  • Andreas Houben
Article

Abstract

NIMA-related kinases (Neks) are a large family of serine/threonine kinases that have been linked to cell-cycle regulation in fungi and mammals. Large families of NIMA-related kinases are also conserved in plants. We demonstrate that AtNek2, a member of the NIMA-related kinase family in Arabidopsis, is a gene fundamental for plant survival and its down-regulation has a pleiotropic effect on leaf cell morphogenesis and plant development. Intracellular localization of YFP::AtNek2 showed that AtNek2 proteins co-distribute with the microtubular cytoskeleton. As a microtubular-associated protein AtNek2 might influence the dynamics of microtubules and consequently cell morphogenesis. This is supported by the observation that misexpression of AtNek2 in RNAi mutants leads to a distorted organization of cells.

Keywords

NIMA kinase Microtubules Histone H3 Cell morphogenesis 

Notes

Acknowledgements

We are grateful to O. Weiß und K. Kumke for technical assistance. This work was supported by the Land Sachsen-Anhalt and the Deutsche Forschungsgemeinschaft (DFG, SFB 648).

Supplementary material

11105_2011_342_MOESM1_ESM.tif (1 mb)
Fig. S1 Semiquantitative expression analysis of AtNek2 RNAi plants. RT-PCR performed on cDNA transcribed from wild type (WT) and AtNek2 RNAi down-regulated plants (1–4). Reactions were performed using a AtNek2 specific primers (forward 5′-ACCTTGGTCAACTTCCTGTTTC-3′; reverse 5′- ACCAAATAAGCACCAAAATAGAAT-3′), b AtNek 3 primers (forward 5′- GTCCGAGAGACGAAAGTATGTGG -3′; reverse 5′- CAAAGTCACCTAACCGAACCTCG -3′) and c and elongation factor 1B alpha-subunit primers (forward 5′-AAACCTACATCTCCGGGATCAATT-3′; reverse 5′-ACAGAAGACTTTCCACTCTCTTTAG-3′). Expression of AtNek 2 amplicons is much lower in RNAi plants (1–4) in comparison with wild type. In contrast, a comparable amount of amplicons was obtained in all samples using AtNek 3 and elongation factor primers. (TIFF 1027 kb)
11105_2011_342_Fig8_ESM.jpg (24 kb)

High resolution image (JPEG 24 kb)

11105_2011_342_MOESM2_ESM.doc (64 kb)
Fig. S2 Comparison of leaf development between AtNek2 and wild type plants. Data plots based on the counting of a stomata and b trichomes per square millimeter in epidermal cells of wild type and AtNek2 RNAi plants (1–4). Statistical analysis of c stomata and d trichome counting in wild type and AtNek2 RNAi seedlings. The t-test for both data set is higher than the value at P = 0.01%, rejecting the null hypothesis. (DOC 64.5 kb)

References

  1. Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, Stevenson DK, Zimmerman J, Barajas P, Cheuk R, Gadrinab C, Heller C, Jeske A, Koesema E, Meyers CC, Parker H, Prednis L, Ansari Y, Choy N, Deen H, Geralt M, Hazari N, Hom E, Karnes M, Mulholland C, Ndubaku R, Schmidt I, Guzman P, Aguilar-Henonin L, Schmid M, Weigel D, Carter DE, Marchand T, Risseeuw E, Brogden D, Zeko A, Crosby WL, Berry CC, Ecker JR (2003) Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301:653–657PubMedCrossRefGoogle Scholar
  2. Ayscough K (1998) Use of latrunculin-A, an actin monomer-binding drug. Methods Enzymol 298:18–25PubMedCrossRefGoogle Scholar
  3. Bajer AS, Mole-Bajer J (1986) Drugs with colchicine-like effects that specifically disassemble plant but not animal microtubules. Ann N Y Acad Sci 466:767–784PubMedCrossRefGoogle Scholar
  4. Bannigan A, Wiedemeier AM, Williamson RE, Overall RL, Baskin TI (2006) Cortical microtubule arrays lose uniform alignment between cells and are oryzalin resistant in the Arabidopsis mutant, radially swollen 6. Plant Cell Physiol 47:949–958PubMedCrossRefGoogle Scholar
  5. Boisnard-Lorig C, Colon-Carmona A, Bauch W, Hodge S, Doerner P, Bancharel E, Dumas C, Haseloff J, Berger F (2001) Dynamic analyses of the expression of the HISTONE: YFP fusion protein in arabidopsis show that syncytial endosperm is divided in mitotic domains. Plant Cell 13:495–509PubMedCrossRefGoogle Scholar
  6. Chan MM, Triemer RE, Fong D (1991) Effect of the anti-microtubule drug oryzalin on growth and differentiation of the parasitic protozoan Leishmania mexicana. Differ Res Biol Divers 46:15–21Google Scholar
  7. Cloutier M, Vigneault F, Lachance D, Seguin A (2005) Characterization of a poplar NIMA-related kinase PNek1 and its potential role in meristematic activity. FEBS Lett 579:4659–4665PubMedCrossRefGoogle Scholar
  8. Coue M, Brenner SL, Spector I, Korn ED (1987) Inhibition of actin polymerization by latrunculin A. FEBS Lett 213:316–318PubMedCrossRefGoogle Scholar
  9. De Souza CP, Osmani AH, Wu LP, Spotts JL, Osmani SA (2000) Mitotic histone H3 phosphorylation by the NIMA kinase in Aspergillus nidulans. Cell 102:293–302PubMedCrossRefGoogle Scholar
  10. Demidov D, Van Damme D, Geelen D, Blattner FR, Houben A (2005) Identification and dynamics of two classes of Aurora-like kinases in arabidopsis and other plants. Plant Cell 17:836–848PubMedCrossRefGoogle Scholar
  11. Earley KW, Haag JR, Pontes O, Opper K, Juehne T, Song K, Pikaard CS (2006) Gateway-compatible vectors for plant functional genomics and proteomics. Plant J 45:616–629PubMedCrossRefGoogle Scholar
  12. Francis D (2007) The plant cell cycle—15 years on. New Phytol 174:261–278PubMedCrossRefGoogle Scholar
  13. Fry AM (2002) The Nek2 protein kinase: a novel regulator of centrosome structure. Oncogene 21:6184–6194PubMedCrossRefGoogle Scholar
  14. Hilson PAJ, Altmann T, Aubourg S, Avon A, Beynon J, Bhalerao RP, Bitton F, Caboche M, Cannoot B, Chardakov V, Cognet-Holliger C, Colot V, Crowe M, Darimont C, Durinck S, Eickhoff H, Falcon de Longevialle A, Farmer EE, Grant M, Kuiper MTR, Lehrach H, Léon C, Leyva A, Lundeberg J, Lurin C, Moreau Y, Nietfeld W, Paz-Ares J, Reymond P, Rouzé P, Sandberg G, Dolores Segura M, Serizet C, Tabrett A, Taconnat L, Thareau V, Van Hummelen P, Vercruysse S, Vuylsteke M, Weingartner M, Weisbeek PJ, Wirta V, Wittink FRA, Zabeau M, Small I (2004) Versatile gene-specific sequence tags for Arabidopsis functional genomics: transcript profiling and reverse genetics applications. Genome Res 14:2176–2189PubMedCrossRefGoogle Scholar
  15. Horiguchi G, Kim GT, Tsukaya H (2005) The transcription factor AtGRF5 and the transcription coactivator AN3 regulate cell proliferation in leaf primordia of Arabidopsis thaliana. Plant J 43:68–78PubMedCrossRefGoogle Scholar
  16. Horiguchi G, Ferjani A, Fujikura U, Tsukaya, H (2006) Coordination of cell proliferation and cell expansion in the control of leaf size in Arabidopsis thaliana. J Plant Res 119:37–42.PubMedCrossRefGoogle Scholar
  17. Kawabe A, Matsunaga S, Nakagawa K, Kurihara D, Yoneda A, Hasezawa S, Uchiyama S, Fukui K (2005) Characterization of plant Aurora kinases during mitosis. Plant Mol Biol 58:1–13PubMedCrossRefGoogle Scholar
  18. Kim JH, Kende H (2004) A transcriptional coactivator, AtGIF1, is involved in regulating leaf growth and morphology in Arabidopsis. Proc Natl Acad Sci USA 101:13374–13379PubMedCrossRefGoogle Scholar
  19. Margulis L (1973) Colchicine-sensitive microtubules. Int Rev Cytol 34:333–361PubMedCrossRefGoogle Scholar
  20. Mathur J, Hulskamp M (2002) Microtubules and microfilaments in cell morphogenesis in higher plants. Curr Biol 12:R669–R676PubMedCrossRefGoogle Scholar
  21. Motose H, Tominaga R, Wada T, Sugiyama M, Watanabe Y (2008) A NIMA-related protein kinase suppresses ectopic outgrowth of epidermal cells through its kinase activity and the association with microtubules. Plant J 54:829–844PubMedCrossRefGoogle Scholar
  22. O'Connell MJ, Krien MJ, Hunter T (2003) Never say never. The NIMA-related protein kinases in mitotic control. Trends Cell Biol 13:221–228PubMedCrossRefGoogle Scholar
  23. O'Regan L, Fry AM (2009) The Nek6 and Nek7 protein kinases are required for robust mitotic spindle formation and cytokinesis. Mol Cell Biol 29:3975–3990PubMedCrossRefGoogle Scholar
  24. O'Regan L, Blot J, Fry AM (2007) Mitotic regulation by NIMA-related kinases. Cell Division 2:25PubMedCrossRefGoogle Scholar
  25. Osmani AH, McGuire SL, O'Donnell KL, Pu RT, Osmani SA (1991) Role of the cell-cycle-regulated NIMA protein kinase during G2 and mitosis: evidence for two pathways of mitotic regulation. Cold Spring Harb Symp Quant Biol 56:549–555PubMedCrossRefGoogle Scholar
  26. Pnueli L, Gutfinger T, Hareven D, Ben-Naim O, Ron N, Adir N, Lifschitz E (2001) Tomato SP-interacting proteins define a conserved signaling system that regulates shoot architecture and flowering. Plant Cell 13:2687–2702PubMedCrossRefGoogle Scholar
  27. Sakai T, Honing H, Nishioka M, Uehara Y, Takahashi M, Fujisawa N, Saji K, Seki M, Shinozaki K, Jones MA, Smirnoff N, Okada K, Wasteneys GO (2007) Armadillo repeat-containing kinesins and a NIMA-related kinase are required for epidermal-cell morphogenesis in Arabidopsis. Plant J 53:157–171PubMedCrossRefGoogle Scholar
  28. Shimmen T, Yokota E (2004) Cytoplasmic streaming in plants. Curr Opin Cell Biol 16:68–72PubMedCrossRefGoogle Scholar
  29. Staiger CJ, Sheahan MB, Khurana P, Wang X, McCurdy DW, Blanchoin L (2009) Actin filament dynamics are dominated by rapid growth and severing activity in the Arabidopsis cortical array. J Cell Biol 184:269–280PubMedCrossRefGoogle Scholar
  30. Tsukaya H (2003) Organ shape and size: a lesson from studies of leaf morphogenesis. Curr Opin Plant Biol 6:57–62PubMedCrossRefGoogle Scholar
  31. Vigneault F, Lachance D, Cloutier M, Pelletier G, Levasseur C, Seguin A (2007) Members of the plant NIMA-related kinases are involved in organ development and vascularization in poplar, Arabidopsis and rice. Plant J 51:575–588PubMedCrossRefGoogle Scholar
  32. Wu L, Osmani SA, Mirabito PM (1998) A role for NIMA in the nuclear localization of cyclin B in Aspergillus nidulans. J Cell Biol 141:1575–1587PubMedCrossRefGoogle Scholar
  33. Zhang H, Scofield G, Fobert P, Doonan JH (1996) A nimA-like protein kinase transcript is highly expressed in meristems of Antirrhinum majus. J Microsc 181:186–194PubMedCrossRefGoogle Scholar

Copyright information

© Springer-Verlag 2011

Authors and Affiliations

  • Francesco Agueci
    • 1
  • Twan Rutten
    • 1
  • Dmitri Demidov
    • 1
  • Andreas Houben
    • 1
  1. 1.Leibniz Institute of Plant Genetics and Crop Plant Research (IPK)GaterslebenGermany

Personalised recommendations