Skip to main content
SpringerLink
Log in

Arabidopsis AtNek2 Kinase is Essential and Associates with Microtubules

  • Published:
Plant Molecular Biology Reporter Aims and scope Submit manuscript

Abstract

NIMA-related kinases (Neks) are a large family of serine/threonine kinases that have been linked to cell-cycle regulation in fungi and mammals. Large families of NIMA-related kinases are also conserved in plants. We demonstrate that AtNek2, a member of the NIMA-related kinase family in Arabidopsis, is a gene fundamental for plant survival and its down-regulation has a pleiotropic effect on leaf cell morphogenesis and plant development. Intracellular localization of YFP::AtNek2 showed that AtNek2 proteins co-distribute with the microtubular cytoskeleton. As a microtubular-associated protein AtNek2 might influence the dynamics of microtubules and consequently cell morphogenesis. This is supported by the observation that misexpression of AtNek2 in RNAi mutants leads to a distorted organization of cells.

This is a preview of subscription content, log in via an institution to check access.

Access this article

Log in via an institution

Price excludes VAT (USA)
Tax calculation will be finalised during checkout.

Instant access to the full article PDF.

Institutional subscriptions

Fig. 1
Fig. 2
Fig. 3
Fig. 4
Fig. 5
Fig. 6
Fig. 7

Similar content being viewed by others

References

  • Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, Stevenson DK, Zimmerman J, Barajas P, Cheuk R, Gadrinab C, Heller C, Jeske A, Koesema E, Meyers CC, Parker H, Prednis L, Ansari Y, Choy N, Deen H, Geralt M, Hazari N, Hom E, Karnes M, Mulholland C, Ndubaku R, Schmidt I, Guzman P, Aguilar-Henonin L, Schmid M, Weigel D, Carter DE, Marchand T, Risseeuw E, Brogden D, Zeko A, Crosby WL, Berry CC, Ecker JR (2003) Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301:653–657

    Article  PubMed  Google Scholar 

  • Ayscough K (1998) Use of latrunculin-A, an actin monomer-binding drug. Methods Enzymol 298:18–25

    Article  PubMed  CAS  Google Scholar 

  • Bajer AS, Mole-Bajer J (1986) Drugs with colchicine-like effects that specifically disassemble plant but not animal microtubules. Ann N Y Acad Sci 466:767–784

    Article  PubMed  CAS  Google Scholar 

  • Bannigan A, Wiedemeier AM, Williamson RE, Overall RL, Baskin TI (2006) Cortical microtubule arrays lose uniform alignment between cells and are oryzalin resistant in the Arabidopsis mutant, radially swollen 6. Plant Cell Physiol 47:949–958

    Article  PubMed  CAS  Google Scholar 

  • Boisnard-Lorig C, Colon-Carmona A, Bauch W, Hodge S, Doerner P, Bancharel E, Dumas C, Haseloff J, Berger F (2001) Dynamic analyses of the expression of the HISTONE: YFP fusion protein in arabidopsis show that syncytial endosperm is divided in mitotic domains. Plant Cell 13:495–509

    Article  PubMed  CAS  Google Scholar 

  • Chan MM, Triemer RE, Fong D (1991) Effect of the anti-microtubule drug oryzalin on growth and differentiation of the parasitic protozoan Leishmania mexicana. Differ Res Biol Divers 46:15–21

    CAS  Google Scholar 

  • Cloutier M, Vigneault F, Lachance D, Seguin A (2005) Characterization of a poplar NIMA-related kinase PNek1 and its potential role in meristematic activity. FEBS Lett 579:4659–4665

    Article  PubMed  CAS  Google Scholar 

  • Coue M, Brenner SL, Spector I, Korn ED (1987) Inhibition of actin polymerization by latrunculin A. FEBS Lett 213:316–318

    Article  PubMed  CAS  Google Scholar 

  • De Souza CP, Osmani AH, Wu LP, Spotts JL, Osmani SA (2000) Mitotic histone H3 phosphorylation by the NIMA kinase in Aspergillus nidulans. Cell 102:293–302

    Article  PubMed  Google Scholar 

  • Demidov D, Van Damme D, Geelen D, Blattner FR, Houben A (2005) Identification and dynamics of two classes of Aurora-like kinases in arabidopsis and other plants. Plant Cell 17:836–848

    Article  PubMed  CAS  Google Scholar 

  • Earley KW, Haag JR, Pontes O, Opper K, Juehne T, Song K, Pikaard CS (2006) Gateway-compatible vectors for plant functional genomics and proteomics. Plant J 45:616–629

    Article  PubMed  CAS  Google Scholar 

  • Francis D (2007) The plant cell cycle—15 years on. New Phytol 174:261–278

    Article  PubMed  CAS  Google Scholar 

  • Fry AM (2002) The Nek2 protein kinase: a novel regulator of centrosome structure. Oncogene 21:6184–6194

    Article  PubMed  CAS  Google Scholar 

  • Hilson PAJ, Altmann T, Aubourg S, Avon A, Beynon J, Bhalerao RP, Bitton F, Caboche M, Cannoot B, Chardakov V, Cognet-Holliger C, Colot V, Crowe M, Darimont C, Durinck S, Eickhoff H, Falcon de Longevialle A, Farmer EE, Grant M, Kuiper MTR, Lehrach H, Léon C, Leyva A, Lundeberg J, Lurin C, Moreau Y, Nietfeld W, Paz-Ares J, Reymond P, Rouzé P, Sandberg G, Dolores Segura M, Serizet C, Tabrett A, Taconnat L, Thareau V, Van Hummelen P, Vercruysse S, Vuylsteke M, Weingartner M, Weisbeek PJ, Wirta V, Wittink FRA, Zabeau M, Small I (2004) Versatile gene-specific sequence tags for Arabidopsis functional genomics: transcript profiling and reverse genetics applications. Genome Res 14:2176–2189

    Article  PubMed  CAS  Google Scholar 

  • Horiguchi G, Kim GT, Tsukaya H (2005) The transcription factor AtGRF5 and the transcription coactivator AN3 regulate cell proliferation in leaf primordia of Arabidopsis thaliana. Plant J 43:68–78

    Article  PubMed  CAS  Google Scholar 

  • Horiguchi G, Ferjani A, Fujikura U, Tsukaya, H (2006) Coordination of cell proliferation and cell expansion in the control of leaf size in Arabidopsis thaliana. J Plant Res 119:37–42.

    Article  PubMed  Google Scholar 

  • Kawabe A, Matsunaga S, Nakagawa K, Kurihara D, Yoneda A, Hasezawa S, Uchiyama S, Fukui K (2005) Characterization of plant Aurora kinases during mitosis. Plant Mol Biol 58:1–13

    Article  PubMed  CAS  Google Scholar 

  • Kim JH, Kende H (2004) A transcriptional coactivator, AtGIF1, is involved in regulating leaf growth and morphology in Arabidopsis. Proc Natl Acad Sci USA 101:13374–13379

    Article  PubMed  CAS  Google Scholar 

  • Margulis L (1973) Colchicine-sensitive microtubules. Int Rev Cytol 34:333–361

    Article  PubMed  CAS  Google Scholar 

  • Mathur J, Hulskamp M (2002) Microtubules and microfilaments in cell morphogenesis in higher plants. Curr Biol 12:R669–R676

    Article  PubMed  CAS  Google Scholar 

  • Motose H, Tominaga R, Wada T, Sugiyama M, Watanabe Y (2008) A NIMA-related protein kinase suppresses ectopic outgrowth of epidermal cells through its kinase activity and the association with microtubules. Plant J 54:829–844

    Article  PubMed  CAS  Google Scholar 

  • O'Connell MJ, Krien MJ, Hunter T (2003) Never say never. The NIMA-related protein kinases in mitotic control. Trends Cell Biol 13:221–228

    Article  PubMed  Google Scholar 

  • O'Regan L, Fry AM (2009) The Nek6 and Nek7 protein kinases are required for robust mitotic spindle formation and cytokinesis. Mol Cell Biol 29:3975–3990

    Article  PubMed  Google Scholar 

  • O'Regan L, Blot J, Fry AM (2007) Mitotic regulation by NIMA-related kinases. Cell Division 2:25

    Article  PubMed  Google Scholar 

  • Osmani AH, McGuire SL, O'Donnell KL, Pu RT, Osmani SA (1991) Role of the cell-cycle-regulated NIMA protein kinase during G2 and mitosis: evidence for two pathways of mitotic regulation. Cold Spring Harb Symp Quant Biol 56:549–555

    Article  PubMed  CAS  Google Scholar 

  • Pnueli L, Gutfinger T, Hareven D, Ben-Naim O, Ron N, Adir N, Lifschitz E (2001) Tomato SP-interacting proteins define a conserved signaling system that regulates shoot architecture and flowering. Plant Cell 13:2687–2702

    Article  PubMed  CAS  Google Scholar 

  • Sakai T, Honing H, Nishioka M, Uehara Y, Takahashi M, Fujisawa N, Saji K, Seki M, Shinozaki K, Jones MA, Smirnoff N, Okada K, Wasteneys GO (2007) Armadillo repeat-containing kinesins and a NIMA-related kinase are required for epidermal-cell morphogenesis in Arabidopsis. Plant J 53:157–171

    Article  PubMed  Google Scholar 

  • Shimmen T, Yokota E (2004) Cytoplasmic streaming in plants. Curr Opin Cell Biol 16:68–72

    Article  PubMed  CAS  Google Scholar 

  • Staiger CJ, Sheahan MB, Khurana P, Wang X, McCurdy DW, Blanchoin L (2009) Actin filament dynamics are dominated by rapid growth and severing activity in the Arabidopsis cortical array. J Cell Biol 184:269–280

    Article  PubMed  CAS  Google Scholar 

  • Tsukaya H (2003) Organ shape and size: a lesson from studies of leaf morphogenesis. Curr Opin Plant Biol 6:57–62

    Article  PubMed  Google Scholar 

  • Vigneault F, Lachance D, Cloutier M, Pelletier G, Levasseur C, Seguin A (2007) Members of the plant NIMA-related kinases are involved in organ development and vascularization in poplar, Arabidopsis and rice. Plant J 51:575–588

    Article  PubMed  CAS  Google Scholar 

  • Wu L, Osmani SA, Mirabito PM (1998) A role for NIMA in the nuclear localization of cyclin B in Aspergillus nidulans. J Cell Biol 141:1575–1587

    Article  PubMed  CAS  Google Scholar 

  • Zhang H, Scofield G, Fobert P, Doonan JH (1996) A nimA-like protein kinase transcript is highly expressed in meristems of Antirrhinum majus. J Microsc 181:186–194

    Article  PubMed  CAS  Google Scholar 

Download references

Acknowledgements

We are grateful to O. Weiß und K. Kumke for technical assistance. This work was supported by the Land Sachsen-Anhalt and the Deutsche Forschungsgemeinschaft (DFG, SFB 648).

Author information

Authors and Affiliations

  1. Leibniz Institute of Plant Genetics and Crop Plant Research (IPK), Corrensstrasse 3, 06466, Gatersleben, Germany

    Francesco Agueci, Twan Rutten, Dmitri Demidov & Andreas Houben

Authors
  1. Francesco Agueci
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Twan Rutten
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Dmitri Demidov
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Andreas Houben
    View author publications

    You can also search for this author in PubMed Google Scholar

Corresponding author

Correspondence to Andreas Houben.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Fig. S1

Semiquantitative expression analysis of AtNek2 RNAi plants. RT-PCR performed on cDNA transcribed from wild type (WT) and AtNek2 RNAi down-regulated plants (1–4). Reactions were performed using a AtNek2 specific primers (forward 5′-ACCTTGGTCAACTTCCTGTTTC-3′; reverse 5′- ACCAAATAAGCACCAAAATAGAAT-3′), b AtNek 3 primers (forward 5′- GTCCGAGAGACGAAAGTATGTGG -3′; reverse 5′- CAAAGTCACCTAACCGAACCTCG -3′) and c and elongation factor 1B alpha-subunit primers (forward 5′-AAACCTACATCTCCGGGATCAATT-3′; reverse 5′-ACAGAAGACTTTCCACTCTCTTTAG-3′). Expression of AtNek 2 amplicons is much lower in RNAi plants (1–4) in comparison with wild type. In contrast, a comparable amount of amplicons was obtained in all samples using AtNek 3 and elongation factor primers. (TIFF 1027 kb)

High resolution image (JPEG 24 kb)

Fig. S2

Comparison of leaf development between AtNek2 and wild type plants. Data plots based on the counting of a stomata and b trichomes per square millimeter in epidermal cells of wild type and AtNek2 RNAi plants (1–4). Statistical analysis of c stomata and d trichome counting in wild type and AtNek2 RNAi seedlings. The t-test for both data set is higher than the value at P = 0.01%, rejecting the null hypothesis. (DOC 64.5 kb)

Rights and permissions

Reprints and permissions

About this article

Cite this article

Agueci, F., Rutten, T., Demidov, D. et al. Arabidopsis AtNek2 Kinase is Essential and Associates with Microtubules. Plant Mol Biol Rep 30, 339–348 (2012). https://doi.org/10.1007/s11105-011-0342-1

Download citation

  • Published:

  • Issue Date:

  • DOI: https://doi.org/10.1007/s11105-011-0342-1

Keywords

Search

Navigation