Molecular Biology Reports

, Volume 42, Issue 3, pp 665–672 | Cite as

Genetic polymorphisms of the organic cation transporter 1 gene (SLC22A1) within the Cape Admixed population of South Africa

  • Morne Du Plessis
  • Brendon Pearce
  • Clifford Jacobs
  • Nisreen Hoosain
  • Mongi Benjeddou


Human organic cation transporter 1 (hOCT1) is expressed primarily in hepatocytes and mediate the electrogenic transport of various endogenous and exogenous compounds, including clinically important drugs. Genetic polymorphisms in the gene coding for hOCT1, SLC22A1, are increasingly being recognized as a possible mechanism explaining the variable response of individual patients to clinical drugs which are substrates for this transporter. The aim of this study was to investigate the allele and genotype frequencies of single-nucleotide polymorphisms (SNPs) of SLC22A1 in the Cape Admixed population of South Africa. The genotypic and allelic distributions of nineteen nonsynonomous and one intronic SLC22A1 SNPs were determined in 100 healthy Cape Admixed participants, using a SNaPshot® multiplex assay. In addition, haplotype structure for SLC22A1 was inferred from the genotypic data. The minor allele frequencies for S14F, P341L, S189L, G220V, V519F, M440I, G465R and the rs622342 intronic variant were 1.0, 0.5, 1.0, 1.0, 1.5, 0.5, 0.5 and 18.0 %, respectively. None of the participants carried the variant allele for R61C, C88R, P283L, R287G and G401S. In addition, no variant alleles were observed for A306T, A413V, M420V, I421F, C436F, V501E, and I542V in the population. Twelve haplotypes were inferred from the genotypic data. The frequencies for most common haplotypes CCTCGGCGCGCTAGAGCTGA, CCTCGGCGCGCTAGCGCTGA and CCTCGGCGCGCGAGCGCTGA were 80, 9.9, and 3.5 %, respectively.


SLC22A1 OCT1 Genetic polymorphism Pharmacogenetic Genotype Haplotype 



This study was funded by the Medical Research Council of South Africa (MRC), the National Research Foundation of South Africa (NRF), and the University of the Western Cape. We would also like to extend a special thanks to the sample donors.


  1. 1.
    Kang HJ, Song IS, Shin HJ, Kim WY, Lee CH, Shim JC, Zhou HH, Lee SS, Shin JG (2007) Identification and functional characterization of genetic variants of human organic cation transporters in a Korean population. Drug Metab Dispos 35(4):667–675CrossRefPubMedGoogle Scholar
  2. 2.
    Tzvetkov MV, Vormfelde SV, Balen D, Meineke I, Schmidt T, Sehrt D, Sabolic I, Koepsell H, Brockmoller J (2009) The effects of genetic polymorphisms in the organic cation transporters OCT1 OCT2 and OCT3 on the renal clearance of metformin. Clin Pharmacol Ther 86:299–306CrossRefPubMedGoogle Scholar
  3. 3.
    Avery P, Mousa SS (2009) Pharmacogenomics in type II diabetes mellitus management: steps toward personalized medicine. Pharmacogenomics Personalized Med 2:79–91Google Scholar
  4. 4.
    Zhang L, Dresser MJ, Gray AT, Yost SC, Terashita S, Giacomini KM (1997) Cloning and functional expression of a human liver organic cation transporter. Mol Pharmacol 51(6):913–921PubMedGoogle Scholar
  5. 5.
    Gorboulev V, Ulzheimer JC, Akhoundova A, Ulzheimer- Teuber I, Karbach U, Quester S, Baumann C, Lang F, Busch AE, Koepsell H (1997) Cloning and characterization of two human polyspecific organic cation transporters. DNA Cell Biol 16(7):871–881CrossRefPubMedGoogle Scholar
  6. 6.
    Kerb R, Brinkmann U, Chatskaia N, Gorbunov D, Gorboulev V, Mornhinweg E, Keil A, Eichelbaum M, Koepsell H (2002) Identification of genetic variations of the human organic cation transporter hOCT1 and their functional consequences. Pharmacogenetics 12(8):591–595CrossRefPubMedGoogle Scholar
  7. 7.
    Shu Y, Leabman MK, Feng B, Mangravite LM, Huang CC, Stryke D, Kawamoto M, Johns SJ, DeYoung J, Carlson E, Ferrin TE, Herskowitz I, Giacomini KM (2003) Evolutionary conservation predicts function of variants of the human organic cation transporter OCT1. Proc Natl Acad Sci USA 100(10):5902–5907CrossRefPubMedCentralPubMedGoogle Scholar
  8. 8.
    Sakata T, Anzai N, Shin HJ, Noshiro R, Hirata T, Yokoyama H, Kanai Y, Endou H (2004) Novel single nucleotide polymorphisms of organic cation transporter 1 (SLC22A1) affecting transport functions. Biochem Biophys Res Commun 313(3):789–793CrossRefPubMedGoogle Scholar
  9. 9.
    Takeuchi A, Motohashi H, Okuda M, Inui K (2003) Decreased function of genetic variants Pro283Leu and Arg287Gly in human organic cation transporter hOCT1. Drug Metab Pharmacokinet 18(6):409–412CrossRefPubMedGoogle Scholar
  10. 10.
    Hardy BJ, Seguin B, Goodsaid F, Jimenez-Sanchez G, Singer PA, Daar AS (2008) The next steps for genomic medicine: challenges and opportunities for the developing world. Nat Rev Genet 9(1):23–27CrossRefGoogle Scholar
  11. 11.
    Via M, Ziv E, Burchard EG (2009) Recent advances of genetic ancestry testing in biomedical research and direct to consumer testing. Clin Genet 76:225–235CrossRefPubMedCentralPubMedGoogle Scholar
  12. 12.
    Abrahams Z, D’Amato ME, Davison S, Benjeddou M (2010) Allele frequencies of six non-CODIS miniSTR loci (D1S1627 D3S4529 D5S2500 D6S1017 D8S1115 and D9S2157) in three South African populations. Forensic Sci Int Genet. doi: 10.1016/j.fsigen.2010.1001.1019 PubMedGoogle Scholar
  13. 13.
    Flicek P, Amode MR, Barrell D, Beal K, Brent S, Carvalho-Silva D et al (2012) Ensembl 2012. Nucleic Acids Res 40(D1):D84–D90CrossRefPubMedCentralPubMedGoogle Scholar
  14. 14.
    Flanagan SE, Patch A-M, Ellard S (2010) Using SIFT and PolyPhen to predict loss-of-function and gain-of-function mutations. Genet Test Mol Biomark 14(4):533–537CrossRefGoogle Scholar
  15. 15.
    Rozen S, Skaletsky HJ (2000) Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S (eds) Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa, pp 365–386Google Scholar
  16. 16.
    Peakall R, Smouse P (2006) Genalex 6: genetic analysis in Excel. Population genetic software for teaching and research. Mol Ecol Notes 6(1):288–295CrossRefGoogle Scholar
  17. 17.
    Yong Y, Lin H (2005) SHEsis, a powerful software platform for analyses of linkage disequilibrium, haplotype construction, and genetic association at polymorphism loci. Cell Res 15(2):97–98CrossRefGoogle Scholar
  18. 18.
    Li Z, Zhang Z, He Z, Tang W, Li T, Zeng Z et al (2009) A partition–ligation–combination–subdivision EM algorithm for haplotype inference with multiallelic markers: update of the SHEsis. Cell Res 19((4):519–523.
  19. 19.
    Leabman MK, Huang CC, DeYoung J, Carlson EJ, Taylor TR, De la Cruz M, Johns SJ, Stryke D, Kawamoto M, Urban TJ, Kroetz DL, Ferrin TE, Clark AG, Risch N, Herskowitz I, Giocomini KM (2003) Natural variation in human membrane transporter genes reveals evolutionary and functional constraints. Proc Natl Acad Sci USA 100:5896–5901CrossRefPubMedCentralPubMedGoogle Scholar
  20. 20.
    Leabman MK, Huang CC, Kawamoto M, Johns SJ, Stryke D, Ferrin TE, DeYoung J, Taylor T, Clark AG, Herskowitz I, Giacomini KM (2002) Polymorphisms in a human kidney xenobiotic transporter OCT2 exhibit altered function. Pharmacogenetics 12(5):395–405CrossRefPubMedGoogle Scholar
  21. 21.
    Shu Y, Brown C, Castro RA, Shi RJ, Lin ET, Owen RP, Sheardown SA, Yue L, Burchard EG, Brett CM, Giacomini KM (2008) Effect of genetic variation in the organic cation transporter 1 OCT1 on metformin pharmacokinetics. Clin Pharmacol Ther 83(2):273–280CrossRefPubMedCentralPubMedGoogle Scholar
  22. 22.
    Becker ML, Visser LE, van Schaik RHN, Hofman A, Uitterlinden AG, Stricker BHC (2009) Genetic variation in the organic cation transporter 1 is associated with metformin response in patients with diabetes mellitus: genetic variation in OCT1 and metformin. Pharmacogenomics J 9:242–247CrossRefPubMedGoogle Scholar
  23. 23.
    Fujita T, Urban TJ, Leabman MK, Fujita K, Giacomini KM (2006) Transport of drugs in the kidney by the human organic cation transporter OCT2 and its genetic variants. J Pharm Sci 95(1):25–36CrossRefPubMedGoogle Scholar
  24. 24.
    Crawford DC, Nickerson DA (2005) Definition and clinical importance of haplotypes. Annu Rev Med 56:303–320CrossRefPubMedGoogle Scholar

Copyright information

© Springer Science+Business Media Dordrecht 2014

Authors and Affiliations

  • Morne Du Plessis
    • 1
  • Brendon Pearce
    • 1
  • Clifford Jacobs
    • 1
  • Nisreen Hoosain
    • 1
  • Mongi Benjeddou
    • 1
  1. 1.Department of BiotechnologyUniversity of the Western CapeCape TownSouth Africa

Personalised recommendations