Advertisement

Conservation Genetics

, Volume 10, Issue 4, pp 1171–1173 | Cite as

Isolation and characterization of 12 microsatellite loci from cutlassfish (Trichiurus haumela)

  • Jin-Zhen Bi
  • Chang-Wei Shao
  • Gui-Dong Miao
  • Hong-Yu Ma
  • Song-Lin Chen
Technical Note
  • 100 Downloads

Abstract

The cutlassfish (Trichiurus haumela) is an important commercial fish species. In the present study, we report 12 polymorphic microsatellite DNA markers for cutlassfish. The number of alleles per locus ranged from 2 to 9 in a sample of 26 individuals. Observed and expected heterozygosities per locus varied from 0.2727 to 0.9583 and from 0.4059 to 0.7926, respectively. Two loci (Trha25 and Trha27) showed significant departure from Hardy–Weinberg equilibrium after sequential Bonferroni correction (P < 0.0042). No significant linkage disequilibrium between pairs of loci was found. These microsatellite markers provide powerful tools for investigating genetic population structure, population history and conservation management of cutlassfish.

Keywords

Cutlassfish Trichiurus haumela Microsatellites Genetic diversity 

Introduction

The family Trichiuridae (cutlassfishes), which comprises nine genera and 32 species, are generally benthopelagic on continental shelves and slopes and distribute in tropical to warm temperate waters (Nakamura and Parin 1993). The cutlassfish is one of the most important commercial marine fish species in China and they are found in all Chinese waters (Luo 1991) including East China Sea, Yellow Sea, Bohai Sea, South China Sea, and the northern Bay. World-wide harvests of the cutlassfish are estimated to be 750,000 tons annually and China accounts for 80% (600,000 tons) of the catch (Claus 1995).

However, due to overfishing, pollution and deterioration of marine ecosystem, the genetic diversity of cutlassfish is declined sharply. So far, isozyme technique has been used to study the genetic structure of the cutlassfish (Yang and Gao 2007). A rapid PCR–RFLP analysis was designed to identify three closely related species of cutlassfishes (Chakraborty et al. 2005). The mtDNA cytochrome (cyt) b gene sequences were studied to investigate the patterns of genetic variability of this fish species (Hsu et al. 2007). Microsatellite markers are an important tool to assess genetic diversity and to develop molecular breeding technique in fish because of their high level of polymorphism and co-dominant Mendelian inheritance (Chen et al. 2005). Microsatellite markers have been isolated for many important marine fish species such as Atka mackerel (Pleurogrammus monopterygius) (Spies et al. 2005), obscure puffer (Takifugu obscurus) (Ma et al. 2008a). Nevertheless, only 10 polymorphic microsatellites were developed for cutlassfish species to date (Yang et al. 2007). It is very urgent to isolate more polymorphic microsatellite markers for this fish species. In the present study, we developed 12 polymorphic microsatellite loci isolated from a dinucleotide-enriched genomic library of Trichiurus haumela.

A sample of 26 individuals of Trichiurus haumela were randomly collected from Yellow Sea, China. Genomic DNA was extracted from the fin tissue as described by Ma et al. (2008b). A dinucleotide-enriched genomic library was constructed using the fast isolation by amplified fragment length polymorphism (AFLP) of sequences containing repeats (FIASCO) protocol (Zane et al. 2002), and the detailed procedure was described by Liao et al. (2007). In brief, the whole genomic DNA was digested with Mse I enzyme (New England Biolabs) and ligated to the adapters (Oligo A: 5′ HO-TACTCAGGACTCAT-OH 3′ and Oligo B: 5′ HO-GACGATGAGTCCTGAG-OH 3′). Bio-labelled probes (GT)13 were used to hybridize with the recovered products of pre-amplification (the size ranged from 300 to 900 bp). Subsequently, the hybrids were captured by streptavidin-coated magnetic beads (Promega Corporation), and the final DNA fragments eluted from the magnetic beads were amplified using the corresponding primers. The amplification products were directly cloned into pMD-18T vector as described by Chen et al. (2004). After sequencing using ABI Prism 3730 automated DNA sequencer (PE Corporation), 68 clones were found containing microsatellite repeat sequences. Finally, PCR primers were designed for 36 loci using the software Primer Premier 5.0, of which 12 loci showed polymorphic. These microsatellite sequences have been deposited in GenBank (EU747538-EU747605).

Polymerase chain reaction (PCR) was conducted in 25 μl volume consisting of: 1× PCR buffer, 1.5 mM MgCl2, 0.2 mM each dNTP, 0.4 μM each primer, 0.75 unit Taq polymerase, and ~100 ng template DNA. Amplification was carried out on a PTC-200 thermocycler (MJ Research) under the following conditions: one cycle of denaturation at 94°C for 4 min; 30 cycles of 30 s at 94°C, 50 s at a primer-specific annealing temperature (Table 1), and 50 s at 72°C. As a final step, products were extended for seven min at 72°C. The PCR products were separated on 6% denaturing polyacrylamide gel, and visualized by silver-staining. The size of alleles were estimated according to the pBR322/Msp I marker (TianGen Biotech Co., Ltd). Genetic diversity indexes were calculated using POPGENE version 1.31 (Yeh et al. 1999) software. Significance values for all multiple tests were corrected by sequential Bonferroni procedure (Rice 1989).
Table 1

Characterization of 12 polymorphic microsatellite loci in cutlassfish (Trichiurus haumela)

Locus

Repeat sequence

Primer sequences (5′–3′)

T a (°C)

N a (size range, bp)

H O

H E

P

Accession No.

Trha02

(GA)36

ACAGGGATTTTGACATTTTCATACTTGCCGTCTTGC

49

3 (240–254)

0.5652

0.4454

0.0786

EU747539

Trha03

(GT)26

GATTATCACCATCCTCCCCATTCCCCACATACAAACGA

52

7 (204–228)

0.7917

0.7926

0.7374

EU747540

Trha12

(AC)36

AATGTCCTGGTGACTGTTCGTCCATAGACTCTCGCTTT

50

2 (200–204)

0.4545

0.4059

0.5477

EU747549

Trha21

(GT)40

AGGAGACGGAGAAACGAGAGCAGCTACATAGGCAGAA

51

3 (242–250)

0.3478

0.4802

0.0247

EU747558

Trha25

(AC)16

TACTAAAACCGCAAGGAGGACTTTTCAAGGCTTACAG

50

5 (220–240)

0.4348

0.7198

0.0027*

EU747562

Trha27

(TG)12

GCTCCCCTTCTCGTATCAGTATCAGCGACAACACCTCACAC

42

4 (242–254)

0.9545

0.6152

0.0009*

EU747564

Trha30

(CA)12

TGACCTCAACCTTTAGATATCCATTTAGCCACCTG

49

9 (201–226)

0.7143

0.7619

0.9612

EU747567

Trha32

(TG)19, (TG)10

TTCTCCATTTTCCTGCTACAC GAACTGACAGACGACCTTGC

42

3 (212–228)

0.2727

0.4746

0.0809

EU747569

Trha34

(TG)20

ACGCAGCCTCCTATTGAAAGTGGTGGGTTGCAGAT

51

4 (224–230)

0.8077

0.6146

0.0065

EU747571

Trha36

(CA)11

CTGCGAGTGAATGAGTGGAACTGCGAGTGAATGAGTGGAA

55

7 (208–242)

0.7083

0.7801

0.4136

EU747573

Trha43

(AC)12

GGATAGTTTGATGCTGAATGGTACTCCCTCGTCTACGGTTT

52

7 (162–178)

0.9231

0.7278

0.2764

EU747580

Trha44

(AC)17

ACGCAGCATCGGTTTATTCGCGGGGTGGTATTAGTTCT

46

5 (154–166)

0.9583

0.7332

0.0065

EU747581

T a, annealing temperature; N a, observed number of alleles; H O, observed heterozygosity; H E, expected heterozygosity

*Significant deviation from HWE after Bonferroni correction (adjusted P value = 0.0042)

In total, 12 of 36 loci were polymorphic in 26 individuals of Trichiurus haumela with the number of alleles, the observed and expected heterozygosities per locus ranging from two to nine, from 0.2727 to 0.9583 and from 0.4059 to 0.7926, respectively (Table 1). The remaining 24 loci were monomorphic or could not amplify any scorable products. Two loci (Trha25 and Trha27) showed significant departure from Hardy–Weinberg equilibrium after sequential Bonferroni correction (P < 0.0042). Such deviations might be caused by the limited sample size used in our test or the presence of null alleles confirmed by MICRO–CHECKER version 2.2.3 software (Van Oosterhout et al. 2004). No significant linkage disequilibrium between pairs of loci was found.

The 12 polymorphic microsatellite markers should be useful for the studies of the population structure and genetic diversity of cutlassfish in the future.

Notes

Acknowledgments

This study was supported by Taishan Scholar Project of Shandong Province, National Public Platform of Science & Technology Information Resources (2005DKA30470-06) and scientific foundation of YSFRI, CAFS (2007-qn-13).

References

  1. Chakraborty A, Aranishi F, Iwatsuki Y (2005) Molecular identification of hairtail species (Pisces:Trichiuridae) based on PCR-RFLP analysis of the mitochondrial 16S rRNA gene. J Appl Genet 46(4):381–385PubMedGoogle Scholar
  2. Chen SL, Xu MY, Ji XS, Yu GC (2004) Cloning and characterization of natural resistance associated macrophage protein (Nramp) cDNA from red sea bream (Pagrus major). Fish Shellfish Immunol 17:305–313. doi: 10.1016/j.fsi.2004.04.003 PubMedCrossRefGoogle Scholar
  3. Chen SL, Liu YG, Xu MY, Li J (2005) Isolation and characterization of polymorphic microsatellite loci from an EST-library of red sea bream (Chrysophrys major) and cross-species amplification. Mol Ecol Notes 5:215–217. doi: 10.1111/j.1471-8286.2005.00880.x CrossRefGoogle Scholar
  4. Claus F (1995) Multilingual illustrated guide to the world’s commercial warm water fish. Fishing News Book, Cambridge, 215 ppGoogle Scholar
  5. Hsu KC, Shih NT, Ni IH, Shao KT (2007) Genetic variation in trichiurus lepturus (perciformes: trichiuridae) in waters off taiwan: several species or cohort contribution. Raffles Bull Zool 14:215–220Google Scholar
  6. Liao X, Shao CW, Tian YS, Chen SL (2007) Polymorphic dinucleotide microsatellites in tongue sole (Cynoglossus semilaevis Günther). Mol Ecol Notes 7(6):1147–1149. doi: 10.1111/j.1471-8286.2007.01812.x CrossRefGoogle Scholar
  7. Luo B (1991) Cutlassfish. In: Fan CQ (ed) Marine fishery biology (in Chinese). Agriculture Press, Beijing, pp 111–160Google Scholar
  8. Ma HY, Chen SL, Liao XL, Xu TJ, Ge JC (2008a) Isolation and characterization of polymorphic microsatellite loci from a dinucleotide-enriched genomic library of obscure puffer (Takifugu obscurus) and cross-species amplification. Conserv Genet. doi: 10.1007/s10592-008-9540-2
  9. Ma HY, Chen SL, Li J, Bi JZ, Xu TJ (2008b) Cloning characterization of three female-specific AFLP markers and development of a reliable PCR-based sex identification method for tongue sole (Cynoglossus semilaevis). Prog Nat Sci (submitted)Google Scholar
  10. Nakamura I, Parin NV (1993) FAO species catalogue, vol 15. Snake mackerels and cutlassfishes of the world (families Gempylidae and Trichiuridae). An annotated and illustrated catalogue of the snake mackerels, snoeks, escolars, gemfishes, sackfishes, domine, oilfish, cutlassfishes, scabbardfishes, hairtails and frostfishes known to date. FAO, RomeGoogle Scholar
  11. Rice WR (1989) Analyzing tables of statistical tests. Evol Int J Org Evol 43:223–225. doi: 10.2307/2409177 Google Scholar
  12. Spies IB, Lowe S, Hong Y, Canino MF (2005) Development and characterization of seven novel di-, tri-, and tetranucleotide microsatellite markers in Atka mackerel (Pleurogrammus monopterygius). Mol Ecol Notes 5:469–471. doi: 10.1111/j.1471-8286.2005.00947.x CrossRefGoogle Scholar
  13. Van Oosterhout C, Hutchinson WF, Wills DPM, Shipley P (2004) MICRO-CHECKER: software for identifying and correcting genotyping errors in mirosatellite data. Mol Ecol Notes 4:535–538. doi: 10.1111/j.1471-8286.2004.00684.x CrossRefGoogle Scholar
  14. Yang TY, Gao TX (2007) Isozyme analyses of Trichiurus haumela in the Yellow Sea and East China Sea. Mar Fish Res 28(3):44–49Google Scholar
  15. Yang WT, Feng F, Yue GH (2007) Isolation and characterization of microsatellites from a marine foodfish species ribbonfish (Trichiurus haumela). Mol Ecol Notes 7:781–783. doi: 10.1111/j.1471-8286.2007.01700.x CrossRefGoogle Scholar
  16. Yeh FC, Yang RC, Boyle T (1999) POPGENE version 1.31. Microsoft window-bases freeware for population genetic analysis. Available: (www.ualberta.ca/~fyeh/). University of Alberta and the Centre for International Forestry Research
  17. Zane L, Bargelloni L, Patarnello T (2002) Strategies for microsatellite isolation: a review. Mol Ecol 11:1–16. doi: 10.1046/j.0962-1083.2001.01418.x PubMedCrossRefGoogle Scholar

Copyright information

© Springer Science+Business Media B.V. 2008

Authors and Affiliations

  • Jin-Zhen Bi
    • 1
    • 2
  • Chang-Wei Shao
    • 1
  • Gui-Dong Miao
    • 1
  • Hong-Yu Ma
    • 1
  • Song-Lin Chen
    • 1
  1. 1.Key Lab for Sustainable Utilization of Marine Fisheries Resources, Ministry of Agriculture, Yellow Sea Fisheries Research InstituteChinese Academy of Fisheries SciencesQingdaoChina
  2. 2.College of Marine Life SciencesOcean University of ChinaQingdaoChina

Personalised recommendations