Cellular and Molecular Neurobiology

, Volume 28, Issue 4, pp 529–543 | Cite as

The Therapeutic Effects of Tyrosine Hydroxylase Gene Transfected Hematopoetic Stem Cells in a Rat Model of Parkinson’s Disease

  • Shizhong Zhang
  • Zhihao Zou
  • Xiaodan Jiang
  • Ruxiang Xu
  • Wangming Zhang
  • Yuan Zhou
  • Yiquan Ke
Original Paper



To investigate the therapeutic effects of tyrosine hydroxylase (TH)-transfected neuronal stem cells derived from bone marrow stem cells (NdSCs-D-BMSCs) on Parkinson’s disease (PD) through different transplantation protocols, including microinjection into the cerebral ventricles (CV) and the striatum (ST).


After identification by enzyme digestion, the constructed plasmid pEGFP-C2-TH was transfected into 8-day-cultured NdSCs-D-BMSCs by electroporation resulting in the coexpression of green fluorescent protein (GFP) and TH. The TH-transfected cells were injected into either the right ST or CV of PD rats. The changes in locomotor activity of PD rats and the migration of transplanted cells in cerebral tissue were monitored and cerebral DA levels were assayed by high performance liquid chromatography (HPLC).


Five days after plasmid pEGFP-C2-TH transfection into NdSCs-D-BMSCs GFP was expressed in 62.1% of the cells and the rate of co-expression with TH was 83.5%. Ten weeks following transplantation, the symptoms of PD rats in both groups were significantly improved and DA levels were restored to 46.6% and 33% of control. The transferred cells showed excellent survival rates in PD rat brains and distant migration was observed.


Both CV and ST transplantation of TH-transfected NDSCs-D-BMSCs has obvious therapeutic effects on PD rats. This study could provide evidence for future transplantation route selection, possibly leading to stem cell transplantation through lumbar puncture.


Gene therapy Neuronal stem cells derived from bone marrow stem cells Parkinson’s disease Rats Transplantation route 


Stem cell transplantation and gene therapy have shed a light on the treatment of Parkinson’s disease (PD) (Kitada et al. 1998; Paola and Uittti 1997). However, the acquisition of neural stem cells (NSCs) and selection of an appropriate transplantation route are still one of bottlenecks in current research. In this study, rat tyrosine hydroxylase (TH) gene-transfected neuronal stem cells derived from bone marrow stem cells (NdSCs-D-BMSCs) were injected into the cerebral ventricle (CV) or striatum (ST) of PD rats according to stereotaxic coordinates. The survival and migration of NdSCs-D-BMSCs in rat brain, together with the therapeutic effects, were monitored. The purpose of the present study is to explore various transplantation routes and provide related laboratory evidence for further research and clinical practice.

Materials and Methods

Materials, Reagents, and Equipment

A total 145 Wistar in-bred rats (90 females and 55 males) weighing between 200–220 g and 10–12 weeks of age were used in the following experiments (supplied by local animal laboratory center, 2002-009 2004A060). The reagents included 6-hydroxydopamine (6-OHDA), apomorphine (APO), dopamine (DA) (Sigma, US), mouse anti-rat TH antibody (1:3,000), goat anti-mouse IgG, and DAB (Takara, Japan). The equipment used included a multiple-functional stereotaxic apparatus (Stoelting, US), LC-10A HPLC, RF-10A fluorescent diagnostic machine, C-R7A automatic analyzer (TECHNO-RESEARCH, Japan), SUPELCO Discovery C18 5 μm chromographical column (Sigma, US), and NuclefectorTM nuclear transfection machine (Amaxa, Germany).

Establishment of Animal Model and Evaluation

PD Model Induced by Three-dimension Orientated Injection

Selection of animals for PD model was performed as previously described (Yuan et al. 2005; Zou et al. 2006). Briefly, 90 female mice which showed no spontaneous rotational behavior over repetitive tests were used. Experimental groups consisted of 80 rats which were injected with 8 μg 6-OHDA into both the right substantia nigra pars compacta (SNc) and the medial ventral tegmental area (VTA). The control group consisted of 10 rats in which 4 μl saline was injected into the right VTA and SNc.

Behavioral Testing

Rats were monitored every week after surgery for such abnormal behaviors as head twisting and tail stiffening. Meanwhile, the rotation number was counted within 10–40 min after intra-peritoneal injection of APO (0.5 mg/kg body weight) for 16 weeks. A number of left-handed rotations greater than 140 in 20 min was classified as a successful PD model. Otherwise, it was determined to have failed (Zhang et al. 2002).

High Performance Liquid Fluorescent Assay (HPLF)

Three PD and 3 Control rats were taken at each time point of 1, 6, 10 or 16 week(s) after 6-OHDA injection and sacrificed by cervical dislocation under anesthesia with 10% chloral hydrate. The SNc and ST were removed bilaterally from brains on an ice-cold plate and its mass calculated according to previously published methods (Zou et al. 2006). Briefly, the DA level was expressed as μg/g wet tissue weight.

pEGFP-C2-TH Plasmid Transfected NdSCs-D-BMSCs

Isolation and Culture of BMSCs and their Differentiation into NdSCs-D-BMSCs

BMSCs were isolated by density gradient centrifugation according to previously described procedures (Colter et al. 2001). The cells were then seeded into 96-well microtiter plates at a density of 2 × 104/ml (200 μl/well) or into a 50-ml flask at a density of 1 × 105/ml. The culture medium was made in our laboratory (Patent No ZL02134314.4) specifically for NSCs and contained 10% FBS. The cells were cultivated in a 37°C, 5% CO2, humidified incubator. Cell growth was examined daily under a phase-contrast microscope and recorded by photographic means with. Cell growth viability was determined by the CK-8 method, in which cells within selected well were incubated with 10 μl of CK-8 reagent under the above culture conditions for 4 h. A total of 5 wells were taken each day from the 4th to 15th day of culture and examined. The absorbance at 570 nm of each well then was measured using an plate reader. The culture medium was assayed as blank. The antigen expression of BMSCs was examined by immunocytochemistry and flow cytometry. For immunocytochemistry, the adhered cells were fixed with 4% polyformaldehyde and the cellular surface antigen was assayed by the SABC method. The primary antibodies were mouse anti-Nestin (1:100; Sigma, USA) and rabbit anti-NSE (1:100; Sigma, USA). The secondary antibodies were goat anti-mouse IgG-Cy3 and goat anti-rabbit IgG-FITC. For flow cytometry, adhered cells were detached each every day from day 4 to 15, transferred to a single cell suspension and adjusted to a concentration of 1 × 106/ml. The cell suspension was then incubated with the primary antibodies for Nestin (mouse anti-rat 1:100) and NSE (rabbit anti-rat 1:100) at 4°C overnight. The secondary antibodies (goat anti-mouse IgG-Cy3 and goat anti-rabbit IgG-FITC) were subsequently added. After incubation at room temperature for 2 h in the dark, the cell suspension was fixed with 300 μl of 1% polyformaldehyde and sorted by flow cytometry and the sorting rate was recorded. In negative control samples, the steps proceeded identically except that the primary antibody was not added to the blocking solution.

Construction of Plasmid pEGFP-C2-TH

pEGFP-C2 was kept at our laboratory, while the pGEM-TH-3 (rat TH gene, 1,770 bp, containing a single BamH I digestion site) was a gift from Prof. Kent E. Vrana. The primers for rat TH gene amplification were: 5′- TACTGAGCTATGCCCACCCC -3′ and 5′- GTGTCGACTTA GCTAATGGCACTCA -3′ (Saibaisheng, Beijing). The plasmid was confirmed by insertion of XhoI and SalI digestion sites, enzyme digestion and electrophoresis.

Plasmid pEGFP-C2-TH Transfected NdSCs-D-BMSCs

Primary rat NdSCs-D-BMSCs in suspension were collected at Day 8 of culture. Transfection was performed according to the Nucleofector™ manual. Briefly, plasmids were mixed with the cells which were then transfected under Amaxa electro-transfect program “A = 31”. The cells were then seeded into the medium with 10% FBS and cultured in a 37°C incubator containing 5% CO2. The adhered cells were collected at Day 3 and 5 of culture, respectively. The cell suspension was then sorted by flow cytometry and the GFP expression rate was measured. At Day 5, the cells were labeled immunocytochemically as described above, except that the primary antibody was mouse anti-TH (1:3,000) and the secondary antibody was goat anti-mouse IgG-Cy3 (1:100). The images were examined under a confocal microscope and five high-magnification fields were randomly selected to calculate the co-expression rate. The expression rate of the infused protein was calculated as the ratio of the number of cells expressing a Cy3 fluorescent signal to those expressing GFP.

Three Dimensional Orientated Transplantation of TH-transfected NdSCs-D-BMSCs

Single cell suspension was made from adhered cells and cell concentration was adjusted with 0.01 M PBS (4°C) to a concentration of 1 × 106/ml in a volume of 10 μl. Ten PD rats were randomly assigned to be treated with the above cell suspension. Following the guidelines from the stereotaxic atlas (Paxinos and Watson 1998), the coordinates for the right CV were: AP −1.5 mm, ML 1.0 mm, DV −4.5 mm. Those for the right VTA were: AP −0.8 mm, ML 2.0 m, DV −4.5 mm. The methods used were as the same as previously described.

Observation After Transplantation

Behavioral Observation

Behavior changes and abnormal performance of PD rats were continuously monitored after transplantation for one week. At various time intervals of 2, 4, 6, 10 weeks after transplantation, rotational behavior was induced by 0.5 mg/kg APO i.p. and the results were recorded.

HPLF Analyses

At time points of 4 and 10 weeks after transplantation, 2 PD rats were sacrificed by cervical dislocation under 10% chloral hydrate anesthesia. The bilateral SNc-ST was separated on an ice-cold plate as previously described. The SNc-ST DA level was expressed as the μg/g wet tissue weight.


Data were expressed as mean ± SD. The difference between mean values was compared by t-test (one or two factors) or Dunnett test (multiple factors) using SPSS 10.0. A significant difference was defined as P value <0.05. (Origin 6.0 figure instruction)


Plasmid pEGFP-C2-TH Transfected NdSCs-D-BMSCs

Identification and Differentiation of Induced NdSCs-D-BMSCs

Within 24 h after seeding, the majority of the large round suspended cells began to adhere to the wall and some were observed to bud. After 48–72 h, most of the cells had firmly adhered to the wall and began to extend processes. After 2–3 medium changes, the purity of the adhered cells was increased. The cells showed a round nucleus in the center with some large granules and a rich cytoplasm. The cells were cultured with NSC culture medium for 8–10 days, and the cells proliferated actively, along with morphological alterations such that neurites were found to extend and mitosis was observed in some cells. The cells showed the characteristics of neural cells, confirmed by the morphological connection of their neurites (Fig. 1) and the results of NSE and Nestin immunocytochemical staining (Fig. 2). The culture time and OA value are listed in Table 1. The OA value increased over time with the peak occurring at day 8–11, indicating the most rapid cell proliferation rate. The results of flow cytometry were shown in Table 2. The percentage of Nestin-positive cells decreased over time, from 22% at day 4 to 3.7% at at day 15. The curve decreased slowly after Day 10. Conversely, the percentage of NSE positive cells increased over time, from 0.7% at day 4 to 13.3% at day 15. However, the rate of increase of the curve decreased after at day 10. These results suggested that cultured NdSCs-D-BMSCs were suitable for transfection at day 8–10 due to their active growth and the abundancy of stem cells.
Fig. 1

Photomicrographs of primary cultures of BMSCs (A) Day 4 of primary culture. Cells are round, with some mitosis observed (×200); (B) Day 7 of primary culture. Cells are round or spindle-like (×100); (C) Day 2 after first change of media. Some cells grow within a whirl-like pattern, while others are clustered (×100); (D) Day 9 of primary culture. Cells arranged in parallel lines (×50); (E) Day 6 of primary culture. Cells are round, roundish or spindle-like. Some cells are undergoing mitosis and possess long neurites (×400); (F) Day 9 of primary culture. Two spindle cells have formed long neurites and are connecting with each other (×400)

Fig. 2

The surface antigen expression of NSCs-D-BMSCs (A) 5 days after culture, red round cells are immunopositive for Nestin (Cy3, ×100); (B) The field of A under a confocal microscope using light field (×100); (C) 17 days after culture, NSE (FITC) immunopositive cells show long spindle-like morphology (×100); (D) A higher magnified image of C (×400)

Table 1

CK-8 (570 nm) absorption of primary cultures of NdSCs-D-BMSCs

Culture time













OA value

0.00 ± 0.01

0.27 ± 0.19

0.28 ± 0.11

0.29 ± 0.19

0.68 ± 0.31

0.75 ± 0.25

0.92 ± 0.27

1.05 ± 0.51

1.05 ± 0.77

1.08 ± 0.25

1.18 ± 0.52

1.24 ± 0.31

Table 2

Flow cytometry results of surface antigens on primary cultures of NdSCs-D-BMSCs

Culture time














0.67 ± 0.06

0.83 ± 0.06

3.50 ± 0.26

4.27 ± 0.31

4.97 ± 0.15

8.00 ± 0.10

9.77 ± 0.15

11.60 ± 0.70

11.57 ± 0.06

12.37 ± 0.67

12.53 ± 0.06

13.20 ± 0.10


22.0 ± 0.06

13.23 ± 0.70

12.13 ± 0.12

9.17 ± 0.15

8.63 ± 0.06

7.87 ± 0.06

5.17 ± 0.21

4.87 ± 0.25

4.50 ± 0.10

4.40 ± 0.20

4.20 ± 0.10

3.70 ± 0.10

Table 3

Number of rotations/minute of PD rats over time (mean ± SD)

Post-surgery time (w)









Number of PD rats









Number of PD rats with rotations









Number of rotations(r/min)

7.2 ± 0.4

9.6 ± 1.6

10.7 ± 1.9

11.4 ± 1.8

11.6 ± 1.8

11.3 ± 2.0

11.0 ± 1.5

10.8 ± 1.2

Identification of Enzyme Digestion of Plasmid pEGFP-C2-TH

As shown in Fig. 3, after PCR amplification of plasmid pGEMTH-3, a band at 1,700bp was obtained (Lane 3), which was similar to the size of the TH gene fragment after BamH I cleavage (1,770 bp; approximate 1.8 kb) (Lane 2). After digestion of the plasmid pEGFP-C2-TH with XhoI and SalI, a 1.7 kb and 4.7 kb fragment were obtained as expected.
Fig. 3

Identification electrophoretic gel of pEGFP-c2-TH restriction enzyme digestion Lane 1: 4.7 kb and 1.7 kb fragments of pEGFP-TH after XhoI and SalI digestion; Lane 2: 1.8 kb and 2.8 kb fragments of pGEMTH-3 after BamH Ι digestion; Lane 3: 1.7 kb PCR product of pGEMTH-3; Lane 4: DNA Marker

Identification of pEGFP-C2-TH Expression in Transfected NdSCs-D-BMSCs

After 2 h of culture, some transfected cells began to adhere to the wall and expression of GFP was observed under a fluorescent microscope. After 24 h of culture, more cells adhered firmly, which was accompanied by more GFP expression. After culture for 3 days, the adhered cells proliferated actively. After 5 days, cells reached 60% of cell confluence and the estimated fluorescent expression was 50% (Fig. 4). Flow cytometry analyses revealed the expression level of GFP peaked after transfection at day 3 and day 5 in which the expression rates were 54.2 ± 3.4% and 62.1 ± 2.6% respectively. These results coincidentally, were similar to the gross estimation calculated under the fluorescent microscope. At day 5 after tranfection (Fig. 5), examination under a confocal microscope revealed that some cells expressed GFP within the cytoplasm. Furthermore, most of the cells expressing GFP also expressed TH as the mean co-expression rate of five randomly-selected high-magnification fields was 83.5%.
Fig. 4

Confocal microscope images of BMSCs-D-NCSs transfected with pEGFP-C2-TH for 3 days. (A) GFP expression after transfection, shown together with BMSCs-D-NCSs of the same field under lucent light (×200); (B) The magnified images of part of A. Upper: Cell morphology under lucent light; Lower: GFP expression in the same field (200×)

Fig. 5

Confocal microscope images of coexpression of TH-Cy3 and EGFP in BMSCs-D-NCSs transfected with pEGFP-C2-TH for 5 days. (A) Green = EGFP expression; (B) Red = TH positive expression (Cy3, ×50); (C) The same field under light field

Changes of PD Rats Before and After Transplantation of TH-transfected NdSCs-D-BMSCs

Behavioral Changes of PD Rats

Among the total of 80 rats used in these experiments, 11 died (13.8%). Five of them died of post-surgical infection and the rest of 6 PD rats died of infection (1 rat), feeding rejection (2 rats) and other unknown causes (3 rats). One week after surgery, the rats showed decreased activity, with less movement, fur rising and body bowing. Several of them (6/80, 7.5%), exhibited behavioral abnormalities such as head twisting, tail stiffening, smelling, and other abnormal performances. At 4 ± 0.8 min following 0.5 mg/kg APO injection, the rats began to constantly rotate to the left side, with their head touching their tail. Seven of them also showed rolling behaviors (10.6% of the successful PD rats; 7/80, 8.8% of total). After 1 w, 8 rats were successfully categorized as a PD model (10% of total). Subsequently, the number of PD rats increased until 4 w, when the increase in numbers plateaud (Table  3). At 6 weeks, 66 PD rats (82.5%) were induced at which time the numbers remained stable. Furthermore, the number of rotations revealed no significant difference during 4–16 w. Six weeks after transplantation, rats receiving cell injections in both areas had more movement over a larger area and showed more self-feeding (Table 4). The number of rotations for these two groups were notably diminished compared to the positive control group (also known as the PD group) (Table 4). There was no statistical difference between the results of injection within the CV or ST. Moreover, 6 rats (60%) from each treatment group had APO-induced rotational rates of less than 7 per minute.
Table 4

Number of rotations of PD rats in each groups following transplantation (r/min) (mean ± SD)


Before transplantation

After transplantation






11.4 ± 1.8

11.6 ± 1.8/12

11.3 ± 2.0/12

11.0 ± 1.5/7

10.8 ± 1.2/7


11.2 ± 0.8

8.6 ± 1.5/10

6.6 ± 1.0/10

6.2 ± 1.1/6

5.7 ± 1.3/6


11.8 ± 1.1

6.9 ± 0.8/10

5.8 ± 1.2/10

5.1 ± 1.2/6

5.0 ± 1.2/6

DA Level in the Rat SNc-ST

At different post-surgery time points, the DA level of the right SN-ST of PD rats was significantly lower than the opposite side as well as negative controls (also known as Control) (Table 5). DA levels decreased by 55% after 1 w and remained stable from weeks 6–16 with a decrease of 90%. There was no significant difference between the DA level of Control and the left SN-ST within the PD group (P > 0.05). The DA level was however, notably elevated at both 4 and 6 w after transplantation (Table 6). At 10 w, the DA level of the ST group was restored to 46.6% of Control; while that of the VB group was restored to 33.0% of Control. Both shared significant differences compared to PD group (P < 0.01 for both). Furthermore, no significant difference existed between the transplantation groups.
Table 5

SN-striatum DA levels (μg/g brain wet weigh)











Right SN

1.87 ± 0.12

0.80 ± 0.12

0.17 ± 0.06†Δ

0.18 ± 0.05†Δ

0.20 ± 0.06†Δ

0.64 ± 0.67



Left SN

1.90 ± 0.13

1.89 ± 0.16

1.91 ± 0.14

1.91 ± 0.20

1.91 ± 0.17

1.91 ± 0.15




1.89 ± 0.12

1.35 ± 0.58

1.04 ± 0.90

1.04 ± 0.90

1.06 ± 0.90

1.27 ± 0.80




P value













(F = 147.186

P = 0.000)b


aPrimary effect; b Cross effect; †P value < 0.01 compared to control; ΔP value < 0.01 compared to PD 1 week group

Table 6

The DA level of rats in SN-striatum after transplantation (μg/g brain wet weigh)


4w post-

10w post-





0.18 ± 0.05

0.20 ± 0.06

0.19 ± 0.06




0.59 ± 0.13

0.63 ± 0.14

0.61 ± 0.13




0.76 ± 0.10

0.89 ± 0.17

0.82 ± 0.15




0.50 ± 0.21

0.56 ± 0.25

0.53 ± 0.23



P value

F value







(F = 0.637

P = 0.639)b


aPrimary effect; b Cross effect; †P value < 0.01 compared to control; P value < 0.01 compared to PD group

Expression of Transplanted Cells in Brain Tissues

A total of 95 slide samples were collected. The cells were identified as transplanted cells if obvious GFP signal was observed under a fluorescent microscope. The migration length was calculated starting from the outside edge of the injection site or the internal edge of CV (Table 7). The transplanted cells were distributed in bands along the basal neural fibers in CV group. Those in ST group were distributed in bundles, showing non-linear migration within the base of brain (Fig. 6).
Table 7

The migration length of transplanted cells (mm/X)








Range (A/P)






2.3 ± 0.2

2.6 ± 0.3

4.3 ± 2.3

4.6 ± 1.2

A: anterior; P: posterior

Fig. 6

Fluorescence expression in transplanted NSCs-D-BMSCs following transplantation. (A) In CV group (10 weeks), EGFP is expressed along the neural fiber in the wall and the inferior corner of VB. Left: Fluorescent microscopic image; Right: Confocal microscope image under light field, ×50; (B) In ST group (4 weeks), EGFP is observed around needle tract (upper figure, ×50). It distributes along with the neural fiber and migrates distantly (lower figure, ×50)


PD is widely accepted as one of the best candidates for cell transplantation and gene therapy (Segovia 2002). One major concern about transplantation however, is the selection of stem cells. Although NSCs derived from embryos and embryonic brains have been proven to partly differentiate into TH+ neurons in vivo, they could not be widely applied in clinical practice because of poor safety, limited donor sources, immunological rejection and ethical issues. With the development of research on BMSCs, they have been found to be able to differentiate into NSCs. Therefore, BMSCs could be a new donor resource.

Although BMSCs are early cells developed from the mesenchyma, they could differentiate into neuronal cells. (Lu et al. 2005) studied the simulation of BMSCs with platelet-derived growth factor, alkaline fibroblast growth factor, fibroblast growth factor-8, and brain-derived neurotrophic factor in vitro. They found that BMSCs could develop into adult neurons, of which 30% were TH positive. In another study (Yamada et al. 2003), 3.9% of BMSCs expressed TH after induction by alkaline fibroblast growth factor and ciliary nerve growth factor, while 41% expressed TH after further induction by glia-derived neurotrophic factors. These findings demonstrate the potential ability of BMSCs to differentiate into adult DA neurons. Moreover, BMSCs can be easily obtained in large quantities and proliferate readily in vitro. BMSCs can also be used for autografting to avoid immunological rejection (Jiang and Zhang 2003). Therefore, BMSCs are considered as attractive stem cells for transplantation (Shih et al. 2002). However, similar levels of differentiation have not been observed in vivo. According to the short-term survival of transplanted adult neurons in host brains, dopaminergic NSCs could play a more active role in PD therapy. However, it is still a challenge to find an appropriate methodology for effectively inducing BMSCs to differentiate into dopaminergic NSCs. Meanwhile, a problematic point in PD gene therapy is to demonstrate the therapeutic benefits of stem cell transplantation, including NdSCs-D-BMSCs, in an animal model of PD.

In this study, rat BMSCs changed morphologically from large round stem cells to neuronal spindle cells with increasing culture time. The expression of NSE simultaneously increased to 13.2% positive cells after 15 days. Conversely, the expression of the NSC specific antigen Nestin decreased over time. However, 3.7% cells were still Nestin+ after 15 days of induction. Compared to a previous study (Woodbury et al. 2000) which reported that Nestin+ cells could not be observed after 6 days, our results showed longer Nestin expression time, providing a longer time window for stem cell proliferation. Nevertheless, the Nestin+ and NSE+ BMSCs could be considered NdSCs-D-BMSCs because they had both NSC characteristics and the potential to differentiate into adult neurons. In this study, NdSCs-D-BMSCs were used as stem cells and selected for transplantation at day 8 according to the cell activity and proliferation peak.

Plasmid pEGFP-C2-TH transfected NdSCs-D-BMSCs co-expressed TH and GFP. TH is the rate-limiting enzyme of DA synthesis (Kang et al. 2001). In this study, the brain DA level was significantly elevated after NdSCs-D-BMSCs were transplanted into the lesioned striatum. Therefore, TH expression partly characterized NdSCs-D-BMSCs as dopaminergic NSCs. In addition, coexpression of GFP was used as a marker of TH gene expression and transplanted cell migration. In our study, the coexpression rate of TH and GFP was 83.5%. Thus, it was easy to monitor NdSCs-D-BMSCs and TH expression.

The Rat PD model induced by 6-OHDA injection into SNc is a model of complete damage, which mimics the middle-to-late stages of PD. However, the success rate is not high (Berretta et al. 2005; Debeir et al. 2005) due to the difficulty in obtaining an accurate injection and individual differences. In this study, 6-OHDA was injected into both SNc and VTA laterally. In-bred rats, which share an identical genome and similar body weight were used in these experiments, hence the results were repeatable. Moreover, good immunological tolerance was observed, resulting from transplantation between rats. Injection was also repeated in unsuccessful PD rats. In total, establishment of a successful PD model was induced in 82.5% of the rats who consequently suffered from PD for 16 w. In the future, additional experiments could be carried out based on the success of this animal model.

Transplantation route is another important issue in PD therapy by NSCs. The original lesion site, SNc, is unsuited for transplantation since the transplanted cells are unable to survive there. Therefore, the target area of SNc DA neurons, the striatum, is believed to be a preferable transplantation site, especially within the shell and caudate nuclei. Developing a suitable route selection could provide appropriate transplantation therapy for different PD patients.

In this study, the caudate nucleus of the right striatum and the anterior corner of the right CV were selected as targets. We found that both treatments improved the locomotor ability of PD rats. Moreover, 60% of the rats in each therapy group (10 w) had rotations of less than the standard for a middle-to-late stage PD rat model. The measurement of DA levels in SN and ST confirmed the improvement as a result of both treatments. Ten weeks after transplantation, the DA levels of the ST and CV groups were restored to 46.6% and 33.0% of control, respectively. Both had significant difference compared to PD group. However, no significant difference existed between the transplantation groups.

GFP, when observed under a fluorescent microscope, indicated the survival and migration of NdSCs-D-BMSCs in PD rat brains. In the ST group, the transplanted cells were distributed around the needle track. However, after 10 weeks, GFP+ cells were observed to distribute like non-linear bundles in the coronal sections, 4.6 mm deep. Such results indicated that the level of cell migration was not associated with the injection pressure. In the CV group, the transplanted cells reached the anterior and posterior corners of the CV. Moreover, GFP+ cells were observed to distribute in bands along the inferior corner of the CV, 2.6 mm below the ventricular membrane. These findings suggested that: (1) NdSCs-D-BMSCs could pass the blood-brain barrier and migrate distantly; (2) NdSCs-D-BMSCs could migrate with the flow of cerebrospinal fluid within the CV. Furthermore, they could also migrate distantly through gray matter. However, the direction of migration and the amount of cells involved depended on the direction of neural fibers. Thus, the direction of neural fibers connected to the target area should be a major concern in PD transplantation therapy.

In summary, TH transfected NdSCs-D-BMSCs could have therapeutic benefits in PD rats through CV route with similar effects found using the ST route. It is possible that this study could provide evidence for the potential application of cell transplantation through lumbar puncture in both laboratory research and clinical practice.


  1. Berretta N, Freestone PS, Guatteo E, de Castro D, Geracitano R, Bernardi G, Mercuri NB, Lipski J (2005) Acute effects of 6-hydroxydopamine on dopaminergic neurons of the rat substantia nigra pars compacta in vitro. Neurotoxicology 26(5):869–881CrossRefPubMedGoogle Scholar
  2. Colter DC, Sekiya I, Prockop DJ (2001) Identification of a subpopulation of rapidly self-renewing and multipotential adult stem cells in colonies of human marrow stromal cells, Proc Nat Acad Sci USA 98(14):7841–7845CrossRefPubMedGoogle Scholar
  3. Debeir T, Ginestet L, Francois C, Laurens S, Martel JC, Chopin P, Marien M, Colpaert F, Raisman-Vozari R (2005) Effect of intrastriatal 6-OHDA lesion on dopaminergic innervation of the rat cortex and globus pallidus. Exp Neurol 193(2):444–454CrossRefPubMedGoogle Scholar
  4. Jiang X, Xu R, Zhang W (2003) In Vitro experimental study on marking neural stem cells derived from human bone marrow with green fluorescence protein. Chin J Clin Rehab 25(7):3439–3441Google Scholar
  5. Kang UJ, Lee WY, Chang JW (2001) Gene therapy for Parkinson’s disease: determining the genes necessary for optimal dopamine replacement in rat models. Hum Cell 14(1):39–48PubMedGoogle Scholar
  6. Kitada T, Asakawa S, Hattori N, Matsumine H, Yamamura Y, Minoshima S, Yokochi M, Mizuno Y, Shimizu N (1998) Mutations in the parkin gene cause autosomal recessive juvenile parkinsonism. Nature 392(6676):605–608CrossRefPubMedGoogle Scholar
  7. Lu L, Zhao C, Liu Y, Sun X, Duan C, Ji M, Zhao H, Xu Q, Yang H (2005) Therapeutic benefit of TH-engineered mesenchymal stem cells for Parkinson’s disease. Brain Res Prot 15(1):46–51CrossRefGoogle Scholar
  8. Paola RD, Uitti RJ (1997) Treatment implications in the early detection of Parkinson’s disease. Med Pro SEA 24(1):8–11Google Scholar
  9. Paxinos G, Watson C (1998) The rat brain in stereotatic coordinates, 2nd edn. Academic Press, Burlington, MAGoogle Scholar
  10. Segovia J (2002) Gene therapy for Parkinson’s disease: current status and future potential. Am J Pharmacogenom 2(2):135–146CrossRefGoogle Scholar
  11. Shih CC, DiGiusto D, Mamelak A, Lebon T, Forman SJ (2002) Hematopoietic potential of neural stem cells: plasticity versus heterogeneity. Leuk Lymphoma 43(12):2263–2268CrossRefPubMedGoogle Scholar
  12. Woodbury D, Schwarz EJ, Prockop DJ, Black IB (2000) Adult rat and human bone marrow stromal cells differentiate into neurons. J Neurosci Res 61(4):364–370CrossRefPubMedGoogle Scholar
  13. Yamada H, Dezawa M, Shimazu S, Baba M, Sawada H, Kuroiwa Y, Yamamoto I, Kanno H (2003) Transfer of the von Hippel-Lindau gene to neuronal progenitor cells in treatment for Parkinson’s disease. Ann Neurol 54(3):352–359CrossRefPubMedGoogle Scholar
  14. Yuan H, Sarre S, Ebinger G, Michotte Y (2005) Histological, behavioural and neurochemical evaluation of medial forebrain bundle and striatal 6-OHDA lesions as rat models of Parkinson’s disease. J Neurosci Methods 144(1):35–45CrossRefPubMedGoogle Scholar
  15. Zhang W, Xu R, Cai Y (2002) The activity change of dopamine D2 receptors in caudal-putamen of Parkinson’s disease model rats. Chi J Neurosurgical Dis Res 1(3):266–268Google Scholar
  16. Zou Z, Zhang S, Jiang X (2006) Experimental study on establishment of PD’s rats model by 6-OHDA directional injection. Chi J Neuromed 5(3):244–247Google Scholar

Copyright information

© Springer Science+Business Media, LLC 2007

Authors and Affiliations

  • Shizhong Zhang
    • 1
  • Zhihao Zou
    • 1
  • Xiaodan Jiang
    • 1
  • Ruxiang Xu
    • 1
  • Wangming Zhang
    • 1
  • Yuan Zhou
    • 1
  • Yiquan Ke
    • 1
  1. 1.Neuromedical Institute, Zhujiang HospitalSouth Medical UniversityGuangzhou CityP.R. China

Personalised recommendations