Correction to: Molecular characterization of Globodera pallida found in Japan using ribosomal DNA and mitochondrial cytochrome b gene sequences

The Original Article was published on 21 March 2018

Correction to: Journal of General Plant Pathology (2018) 84:230–236 https://doi.org/10.1007/s10327-018-0776-5

The authors would like to correct the errors in the publication of the original article.

The first eight sentences under the subheading “PCR, cloning, and sequencing” in the “Materials and methods” section contained errors in the primer sequences and in the one of the reference citations.


The sentences should read as:


“The ribosomal DNA sequences (rDNA) including two ITS and 5.8S ribosomal RNA were amplified using the primers of Ferris et al. (1993): forward (CGTAACAAGGTAGCTGTAG) and reverse (TCCTCCGCTAAATGATATG). Partial sequences of the mitochondrial cytochrome b gene (cytb) were amplified using primers INRAcytbL (GGGTGTGGCCTTGTTATTTC) and INRAcytbR (ACCAGCTAAAACCCCATCCT) (Picard et al. 2007).”


The below reference should be included in the reference list.

Reference

  1. Ferris VR, Ferris JM, Faghihi J (1993) Variation in spacer ribosomal DNA in some cyst-forming species of plant parasitic nematodes. Fundam Appl Nematol 16:177–184

    Google Scholar 

Download references

Author information

Affiliations

Authors

Corresponding author

Correspondence to T. Ohki.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

About this article

Verify currency and authenticity via CrossMark

Cite this article

Ohki, T., Narabu, T., Kushida, A. et al. Correction to: Molecular characterization of Globodera pallida found in Japan using ribosomal DNA and mitochondrial cytochrome b gene sequences. J Gen Plant Pathol 86, 333 (2020). https://doi.org/10.1007/s10327-019-00890-6

Download citation