Advertisement

Microchimica Acta

, 185:254 | Cite as

Fluorometric aptamer based assay for ochratoxin A based on the use of exonuclease III

  • Renjie Liu
  • Hua Wu
  • Lei Lv
  • Xiaojiao Kang
  • Chengbi Cui
  • Jin Feng
  • Zhijun Guo
Original Paper

Abstract

This study describes an aptamer based assay for the mycotoxin ochratoxin A (OTA). The method is based on the use of an OTA-specific aptamer, exonuclease (Exo) III, SYBR Gold as a fluorescent probe, and a complementary strand that specifically combines with the aptamer. In the presence of OTA, the aptamer and OTA hybridize, thereby resulting in the formation of ssDNA, which is not digested by Exo III. Intense fluorescence is observed after addition of SYBR Gold (best measured at excitation/emission wavelengths of 495/540 nm). Fluorescence increases linearly with the log of the OTA concentration in the range from 8 to 1000 ng·mL−1. The detection limit is 4.7 ng·mL−1. The assay was applied to the determination of OTA in diluted [2%(v/v)] red wine, and recoveries and RSDs ranged between 93.5% and 113.8%, and between 3.2% and 5.7%, respectively.

Graphical abstract

In the presence of ochratoxin A (OTA), specific combinations of aptamer and OTA may occur and result in DNA double strands being untied, which avoids being digested by Exo III. Intense fluorescence is observed after SYBR Gold addition.

Keywords

Mycotoxin Fluorescent probe Exo III Complementary strand 

Introduction

Ochratoxin A (OTA) is a mycotoxin produced by several Aspergillus and Penicillium species on different agricultural commodities [1]. OTA is mainly found in cereals, wheat, maize, beans and derived products, dried fruits, coffee, grapes and wine, spices, oil crops, beer, tea, and so on [2]. Toxicological studies have shown that OTA is the most nephrotoxic among the ochratoxins. Moreover, it is toxic to the liver, nervous system, and immune system. It is carcinogenic and mutagenic and causes fetal malformations [3]. Considering its potential harm, the International Agency for Research on Cancer regards OTA as a potential carcinogen for humans (group 2B) [4]. The European Commission established restrictive criteria for the consumption of raw cereal grains and all cereal-derived products (5 μg·kg−1) [2]. Currently, various analytical methods for OTA determination have been established, including conventional chromatographic methods, such as thin layer chromatography, high-performance liquid chromatography, gas chromatography, and fluorescence or mass spectrometry [5, 6, 7, 8]. A series of immunological methods has been employed in OTA. The most common method is the enzyme-linked immunosorbent assay (ELISA), which offers the advantages of simple operation, rapidity, sensitivity, simplicity, low technical requirement, and suitability for large-scale screening. However, ELISA requires the use of antibodies, the pretreatment of which is highly costly and complicated [7]. Environmental conditions, such as temperature and pH, greatly affect antibodies and antigens. Therefore, antibodies are not easy to store and exhibit poor stability.

Aptamers are short segments of RNA or DNA single-stranded oligonucleotide sequences screened in vitro through the systematic evolution of ligands by exponential enrichment [9, 10]. They can form unique three-dimensional structures by folding, such as hairpin, pseudoknot, and G-quadruplex, to combine with their target with high affinity and high specificity [11, 12]. Their recognition function is similar to that of antibodies but is superior due to the following properties. First, aptamers exhibit high chemical stability and are not easy to inactivate. Second, they possess small molecular weight and are prone to chemical modifications. Finally, their in vitro screening does not depend on animals and cells, and they can be synthesized by PCR technology [13, 14]. Thus, aptamers are widely applied for protein research, drug analysis, virus detection, food safety, and other fields due to these advantages.

OTA is a small molecule biological toxin with weak immunogenicity, limiting the application of immunosensors. Aptamer based biosensor has overcome this defect and has been successfully applied to OTA detection. Compared with other detection methods, fluorescent aptasensor offers more advantages, such as low cost, high sensibility, simplicity, rapidity, and capability for on-site detection [15, 16, 17]. However, many fluorescence experiments currently require labeling or modifying fluorophores on aptamers, thereby increasing the complexity of these assays. Moreover, they considerably affect specific binding between aptamers and targets, compromising the sensitivity of experiments [18, 19]. Considering these points, we designed a label-free aptamer assay to specifically detect OTA.

Luminescent probes with good biocompatibility have been utilized in multiple areas, such as cell imaging [20, 21, 22, 23], sensing and analytical applications [24, 25, 26, 27, 28]. Among these luminescence probes, SYBR Gold is one of the best cyanine dyes and can bind specifically to nucleic acids, thereby increasing fluorescence intensity [13]. Based on this characteristic, SYBR Gold was used as the fluorescent dye in our experiment. We took advantage of the double-stand specificity and nonprocessive 3′–5′ exodeoxyribonuclease activity of exonuclease (Exo) III to establish a “turn on” aptamer for OTA detection. The aptamer first combines with a complementary strand to form dsDNA. In the presence of OTA, the binding capacity between the aptamer and OTA is greater than that with the complementary strand. Therefore, the aptamer can be liberated from dsDNA to specifically combine with OTA, thereby protecting DNA from Exo III digestion. When SYBR Gold is added, strong fluorescence is obtained. By contrast, in the absence of OTA, Exo III can digest dsDNA into nucleotides, and weak fluorescence is obtained with the addition of SYBR Gold. Typically, OTA concentration is proportional to the amount of aptamer and complementary strand after nuclease reaction, which is also proportional to the fluorescence intensity generated by SYBR Gold. Therefore, OTA can be quantitatively detected based on fluorescence signal changes.

Experimental

Materials and reagents

OTA aptamer and its complementary strands (CS10, CS11, CS12, CS13, CS18, and CS36) were synthesized by Shanghai Sangon Biotechnology Co., Ltd. (Shanghai China, http://www.sangon.com). CS10, CS11, CS12, CS13, and CS18 were partially complementary to the OTA aptamer with 10, 11, 12, 13, and 18 nucleotides (nt), respectively. CS36 with 36-nt was perfectly complementary to the OTA aptamer. The DNA sequences are listed in Table 1. Tris buffer (10 mM, pH 8.0) containing 120, 5, 10, and 20 mM of NaCl, KCl, MgCl2, and CaCl2, respectively, was used for dissolving oligonucleotides to obtain a DNA stock solution, which was stored at −20 °C before use. Exo III was purchased from Takara Biotechnology Co., Ltd. (Dalian, China, http://www.takarabiomed.com). OTA was purchased from Aladdin reagent Co., Ltd. (Shanghai, China, http://www.aladdin-e.com). OTA stock solution (40 μg·mL−1) was prepared by dissolving OTA in absolute ethanol; this stock solution was stored at −20 °C. n-Acetyl-L-phenylalanine (NAP), warfarin (WF), aflatoxin B1 (AFB1), zearalenone (ZEN), and OTB were obtained from Sigma-Aldrich (St. Louis, MO, USA, http://www.sigmaaldrich.com). Ethylene diamine tetraacetic acid (EDTA), Tris(hydroxymethyl) aminomethane (Tris), acetic acid and agarose were bought from Sigma-Aldrich (Shanghai, China, http://www.sigmaaldrich.com). Wine was produced by ChangYu Pioneer Wine Co., Ltd. (Yantai, China, http://www.changyu.com.cn). All other chemicals used in the study were of analytical grade.
Table 1

Synthesized oligonucleotides (5′-3′) used in the experiment

Name

Sequence (5′-3′)

Aptamer

GATCGGGTGTGGGTGGCGTAAAGGGAGCATCGGACA

CS10

TGTCCGATGC

CS11

TGTCCGATGCT

CS12

TGTCCGATGCTC

CS13

TGTCCGATGCTCC

CS18

TGTCCGATGCTCCCTTTA

CS36

TGTCCGATGCTCCCTTTACGCCACCCACACCCGATC

Apparatus

A Cary 500 scan UV/Vis spectrophotometer (Varian, USA, http://www.varian.atobo.com) was employed to quantify the oligonucleotides. Electropherograms were photographed by using a WD-9413B gel imaging system (Beijing, China, http://www.ly.com). A Shimadzu RF-5301 fluorescence spectrometer (Tokyo, Japan, http://www.shimadzu.com) was used to record fluorescence intensities. Emission spectra were recorded at a wavelength range of 480–640 nm, whereas excitation wavelength was set to 495 nm. Both excitation and emission slits were set to 3 nm.

OTA fluorescence detection

Mixtures containing 100 μL of 500 nM aptamer and 100 μL of 500 nM complementary strand were denatured at 95 °C for 5 min and incubated in a 37 °C water bath for 1 h. Then, 100 μL of different concentrations OTA solution were added to the mixture and incubated at 37 °C for 1 h. Afterward, 100 μL buffer containing of 30 U Exo III was added in the solution; digestion reaction was allowed to proceed at 37 °C for 2 h. Finally, 100 μL of 20× SYBR Gold was added until a final volume of 500 μL was reached. The solution was kept in the dark for 30 min, and fluorescence intensity was measured at excitation/emission wavelengths of 495/540 nm. Analyses were always performed in triplicate.

Application

To confirm the feasibility of this aptamer assay for analysis of actual samples, five different concentrations of OTA (8, 20, 80, 400 and 1000 ng·mL−1) were spiked into red wine, and fluorescent intensity was used to determine OTA concentrations.

Results and discussion

Design method for OTA detection

The designed aptamer assay was based on target-induced untying of dsDNA structures, digestion of dsDNA by Exo III, and the capabilities of SYBR Gold as fluorescent probe. As described in Scheme 1, the aptamer was first mixed with complementary strand to form DNA double strands. In the presence of OTA, dsDNA was untied and resisted Exo III digestion, because the aptamer was bound stronger to OTA compared with the complementary strand. When SYBR Gold was added, intensive fluorescence was emitted. In the absence of OTA, dsDNA was not untied, and intact double strands were digested into nucleotides by Exo III. When SYBR Gold was added, SYBR Gold failed to bind with the digested products, and thus weak fluorescence signals were detected. Therefore, OTA concentration was proportional to fluorescence intensity, and OTA was quantitatively detected based on fluorescence signal changes.
Scheme 1

Schematic representation based on Exo III and SYBR Gold for OTA detection

Figure 1 shows the feasibility of the method. Evidently, fluorescence intensity was reduced by more than twice in the presence of Exo III compared with its absence. The dsDNAs were digested by Exo III, thereby resulting in decreased fluorescence intensity. However, when OTA was added, fluorescence intensity remarkably increased. The presence of OTA untied dsDNA, and the untied DNA is not be digested by Exo III. Thus, fluorescence intensity increased.
Fig. 1

Feasibility of Exo III digestion assay

Direct evidence showing the feasibility of the strategy was provided via agarose gel electrophoresis analysis. As shown in Fig. S 1 , lane 1 exhibited a weak band because of the Exo III-induced degradation of aptamer/complementary strand dsDNA to nucleotides, which then migrated out of the gel. Without Exo III, lane 3 exhibited a bright band. Lane 2 also showed a bright band, because the aptamer combined with OTA and untied the dsDNA. The untied dsDNA resisted Exo III digestion. OTA addition prevented enzymatic digestion, thereby further demonstrating the feasibility of our designed experiment.

Optimization of assay conditions

After demonstrating the feasibility of this method, several important aspects were investigated systematically to obtain excellent analytical performance for OTA detection. The final concentration of the aptamer was fixed at 100 nM, and the following parameters were optimized: (a) complementary strand length; (b) concentration of Exo III; and (c) concentration of SYBR Gold. The pertinent figures (Figs. S2, S3, and S4) are presented in the Electronic Supporting Material. The following experimental conditions provided the optimum results: (a) complementary strand length of 11 nt; (b) Exo III addition of 30 U; and (c) SYBR Gold concentration of 4 × .

Sensitivity analysis of OTA detection

The sensitivity of the assay based on Exo III and SYBR gold was investigated by employing different OTA concentrations. As depicted in Fig. 2a, fluorescence was intensified as OTA concentration increased, thereby indicating a preferable signal-on sensing mechanism. Figure 2b shows the calibration curve for the quantitative analysis of target OTA. A linear relationship between the fluorescent intensity ratio and the natural logarithm concentration of OTA was plotted in the range of 8–1000 ng·mL−1. The linear regression equation was y = 0.07451×-0.122 (R 2  = 0.991). The detection limit (LOD) was defined as the concentration corresponding to the fluorescence signal at three fold standard deviation of the blank without OTA. The calculated limit of detection of this assay was 4.7 ng·mL−1.
Fig. 2

a Fluorescence results of the detection strategy corresponding to various OTA concentrations (a to i: 0, 8, 20, 80, 400, 1000, 2000, 5000, and 10,000 ng·mL−1). The excitation wavelength was at 495 nm, and the emission was monitored at 540 nm. b Calibration plot of fluorescence intensity ratios at 540 nm against the corresponding OTA natural logarithm concentrations. Error bars were obtained from three experiments

Selectivity of OTA detection

To verify whether OTA and aptamer specifically bind to each other, we utilized the sensing platform to detect various structural analogs and mycotoxins such as OTB, NAP, WF, AFB1, and ZEN. In the selectivity experiment, the concentrations were all 1000 ng·mL−1. The detection result is presented in Fig. 3. Addition of the analogs and mycotoxins did not change the fluorescence intensity ratio compared with the blank group. Nevertheless, in the presence of OTA, fluorescence intensity significantly increased, as shown in the column diagram (Fig. 3). On the basis of the data, we concluded that aptamer and OTA were specifically recognized, thereby indicating that the aptamer assay exhibited good selectivity to OTA.
Fig. 3

Detection selectivity of assay. The concentrations of NAP, WF, AFB1, ZEN, OTB, and OTA were all at 1000 ng·mL−1. Error bars were obtained from three experiments

Application of OTA in real samples

Applying our designed experiments to OTA detection in real samples was the key factor that indicated the success of the experiment. We challenged our system with red wine, which can be contaminated with OTA. The absence of OTA in the red wine sample purchased from a local supermarket was first confirmed via HPLC. Buffers containing 2% (v/v) red wine were spiked with various, known OTA concentrations. The spiked samples were further quantified using the fluorescent aptamer assay. The analysis results are listed in Table 2. Evidently, the concentration of the detected OTA was very close to the spiked values. Through three independent experiments, we determined that the range of recoveries and RSD were 93.5%–113.8% and 3.2%–5.7%, respectively. According to the data, our designed experiment can be successfully applied to the detection of OTA in real samples.
Table 2

Application of aptamer assay for OTA determination in red wine samples

Sample number

Added (ng·mL−1)

Found(ng·mL−1)

RSD(%)

Recovery(%)

1

8

9.1

5.2

113.8

2

20

18.7

4.9

93.5

3

80

88.1

3.2

110.1

4

400

412.3

4.8

103.1

5

1000

979.2

5.7

97.9

The data reported in the table represented the average of three measurements

Conclusion

On the basis of the properties of Exo III and SYBR Gold, we designed an aptamer based fluorescent assay to monitor OTA with a detection limit of 4.7 ng·mL−1. The assay was successfully applied to red wine samples. A comparison of other methods, including this method for OTA detection, is shown in Table 3. HPLC methods had a very low detection limit, but the synthesis and immobilization are complicated, and the entire experiment was time consuming. The immunoassay also showed a very low detection limit. However, the antibodies used in the process displayed a high conservation requirement and were easy to denature. These conditions may have affected the experimental results. Luminescence resonance energy-transfer (LRET) method utilized upconversion nanoparticles (UCNPs) as the carriers for detection. Nevertheless, UCNPs showed high sensitivity to temperatures requiring complex instrumentation but produced too low quantum yields for practical application. The fluorescent assay utilized SWCNHs and gold nanoparticles for detection. However, the SWCNHs and nanoparticles are prone to form a disordered aggregation, which can influence the interaction between the aptamer and OTA. The fluorescent assay utilizing PicoGreen is a simple and easy operation. However, the sensing systems are in a turn-off mode. Such turn-off assays might compromise specificity, because other quenchers or environmental stimuli might lead to fluorescence quenching, thereby leading to “false positive” results. This fluorescent assay utilized SYBR Gold, because the fluorescent probe eliminated the laborious and expensive process of DNA modification, thereby reducing the cost and complexity of experiments. This assay showed high selectivity, high practicability, and acceptable detection limited. The major limitation is the enzyme needed. The enzyme is susceptible under ambient conditions, and activity can be lost easily.
Table 3

Comparison of specific features of the designed methods with other methods for OTA detection

Materials used

Method applied

LOD

Reference

PEMEMs

HPLC

0.11 ng·mL−1

[29]

AuPtNPs

Electrochemical immunoassay

0.075 pg·mL−1

[1]

Cd/Te QDs

FRET-based immunoassay

0.8 pg·mL−1

[30]

UCNPs

LRET assay

27 pg·mL−1

[31]

SWCNHs

Fluorescence assay

1.6 ng·mL−1

[32]

Gold nanoparticles

Fluorescent assay

9.1 ng·mL−1

[33]

PicoGreen

Fluorescence assay

1 ng·mL−1

[34]

SYBR Gold

Fluorescence assay

4.7 ng·mL−1

This work

Notes

Acknowledgements

This work was supported by the National Natural Science Foundation of China (Nos. 31460423 and 31360384), the department of Sciences & Technology of Jilin Province (20160520047JH) and the department of education of Jilin Province (2016252).

Compliance with ethical standards

The author(s) declare that they have no competing interests.

Supplementary material

604_2018_2786_MOESM1_ESM.doc (180 kb)
ESM 1 (DOC 179 kb)

References

  1. 1.
    Zhang C, Tang J, Huang L, Li Y, Tang D (2017) In-situ amplified voltammetric immunoassay for ochratoxin a by coupling a platinum nanocatalyst based enhancement to a redox cycling process promoted by an enzyme mimic. Microchim Acta 184(7):2445–2453CrossRefGoogle Scholar
  2. 2.
    Jodra A, Hervas M, Angel Lopez M, Escarpa A (2015) Disposable electrochemical magneto immunosensor for simultaneous simplified calibration and determination of Ochratoxin a in coffee samples. Sensor Actuators B Chem 221:777–783CrossRefGoogle Scholar
  3. 3.
    Wang B, Wu Y, Chen Y, Weng B, Xu L, Li C (2016) A highly sensitive aptasensor for OTA detection based on hybridization chain reaction and fluorescent perylene probe. Biosens Bioelectron 81:125–130CrossRefPubMedGoogle Scholar
  4. 4.
    Guo ZJ, Ren JT, Wang JH, Wang EK (2011) Single-walled carbon nanotubes based quenching of free FAM-aptamer for selective determination of ochratoxin a. Talanta 85(5):2517–2521CrossRefPubMedGoogle Scholar
  5. 5.
    Monaci L, Palmisano F (2004) Determination of ochratoxin a in foods: state-of-the-art and analytical challenges. Anal Bioanal Chem 378(1):96–103CrossRefPubMedGoogle Scholar
  6. 6.
    Pittet A, Royer D (2002) Rapid, low cost thin-layer chromatographic screening method for the detection of ochratoxin a in green coffee at a control level of 10 mu g/kg. J Agric Food Chem 50(2):243–247CrossRefPubMedGoogle Scholar
  7. 7.
    Flajs D, Domijan AM, Ivic D, Cvjetkovic B, Peraica M (2009) ELISA and HPLC analysis of ochratoxin a in red wines of Croatia. Food Control 20(6):590–592CrossRefGoogle Scholar
  8. 8.
    Zhu WY, Ren C, Nie Y, Xu Y (2016) Quantification of ochratoxin a in Chinese liquors by a new solid-phase extraction clean-up combined with HPLC-FLD method. Food Control 64:37–44CrossRefGoogle Scholar
  9. 9.
    Dai S, Wu S, Duan N, Chen J, Zheng Z, Wang Z (2017) An ultrasensitive aptasensor for Ochratoxin a using hexagonal core/shell upconversion nanoparticles as luminophores. Biosens Bioelectron 91(Supplement C):538–544CrossRefPubMedGoogle Scholar
  10. 10.
    Wu J, Zhu Y, Xue F, Mei Z, Yao L, Wang X, Zheng L, Liu J, Liu G, Peng C, Chen W (2014) Recent trends in SELEX technique and its application to food safety monitoring. Microchim Acta 181(5–6):479–491CrossRefGoogle Scholar
  11. 11.
    Abnous K, Danesh NM, Alibolandi M, Ramezani M, Taghdisi SM (2017) Amperometric aptasensor for ochratoxin a based on the use of a gold electrode modified with aptamer, complementary DNA, SWCNTs and the redox marker methylene blue. Microchim Acta 184(4):1151–1159CrossRefGoogle Scholar
  12. 12.
    Cetin AE, Coskun AF, Galarreta BC, Huang M, Herman D, Ozcan A, Altug H (2014) Handheld high-throughput plasmonic biosensor using computational on-chip imaging. Light-Sci Appl 3:e122CrossRefGoogle Scholar
  13. 13.
    Taghdisi SM, Danesh NM, Nameghi MA, Ramezani M, Abnous K (2016) A label-free fluorescent aptasensor for selective and sensitive detection of streptomycin in milk and blood serum. Food Chem 203:145–149CrossRefPubMedGoogle Scholar
  14. 14.
    Roushani M, Shahdost-fard F (2015) A novel ultrasensitive aptasensor based on silver nanoparticles measured via enhanced voltammetric response of electrochemical reduction of riboflavin as redox probe for cocaine detection. Sensors Actuators B Chem 207:764–771CrossRefGoogle Scholar
  15. 15.
    Zhang D, Ma F, Zhang Q, C-y Z (2017) Highly sensitive detection of epidermal growth factor receptor in lung cancer cells by aptamer-based target−/probe-mediated cyclic signal amplification. Chem Commun 53(83):11496–11499CrossRefGoogle Scholar
  16. 16.
    Li N, Tittl A, Yue S, Giessen H, Song C, Ding B, Liu N (2014) DNA-assembled bimetallic plasmonic nanosensors. Light-Sci Appl 3:e226CrossRefGoogle Scholar
  17. 17.
    Liu K-C, Zhang Z-Y, Shan C-X, Feng Z-Q, Li J-S, Song C-L, Bao Y-N, Qi X-H, Dong B (2016) A flexible and superhydrophobic upconversion-luminescence membrane as an ultrasensitive fluorescence sensor for single droplet detection. Light-Sci Appl 5:e16136CrossRefPubMedPubMedCentralGoogle Scholar
  18. 18.
    Lv L, Li D, Liu R, Cui C, Guo Z (2017) Label-free aptasensor for ochratoxin a detection using SYBR gold as a probe. Sensors Actuators B Chem 246:647–652CrossRefGoogle Scholar
  19. 19.
    Zheng DM, Zou RX, Lou XH (2012) Label-free fluorescent detection of ions, proteins, and small molecules using structure-switching aptamers, SYBR gold, and exonuclease I. Anal Chem 84(8):3554–3560CrossRefPubMedGoogle Scholar
  20. 20.
    Vellaisamy K, Li G, Ko C-N, Zhong H-J, Fatima S, Kwan H-Y, Wong C-Y, Kwong W-J, Tan W, Leung C-H, Ma D-L (2018) Cell imaging of dopamine receptor using agonist labeling iridium(III) complex. Chem Sci 9(5):1119–1125CrossRefPubMedGoogle Scholar
  21. 21.
    Pino NW, Davis J III, Yu Z, Chan J (2017) NitroxylFluor: a thiol-based fluorescent probe for live-cell imaging of Nitroxyl. J Am Chem Soc 139(51):18476–18479CrossRefPubMedGoogle Scholar
  22. 22.
    Liu C, Yang C, Lu L, Wang W, Tan W, Leung C-H, Ma D-L (2017) Luminescent iridium(III) complexes as COX-2-specific imaging agents in cancer cells. Chem Commun 53(19):2822–2825CrossRefGoogle Scholar
  23. 23.
    Lincoln R, Greene LE, Zhang W, Louisia S, Cosa G (2017) Mitochondria alkylation and cellular trafficking mapped with a lipophilic BODIPY-Acrolein Fluorogenic probe. J Am Chem Soc 139(45):16273–16281CrossRefPubMedGoogle Scholar
  24. 24.
    Lu L, Wang M, Liu L-J, Leung C-H, Ma D-L (2015) Label-free luminescent switch-on probe for Ochratoxin a detection using a G-Quadruplex-selective iridium(III) complex. ACS Appl Mater Interfaces 7(15):8313–8318CrossRefPubMedGoogle Scholar
  25. 25.
    Lin S, Gao W, Tian Z, Yang C, Lu L, Mergny J-L, Leung C-H, Ma D-L (2015) Luminescence switch-on detection of protein tyrosine kinase-7 using a G-quadruplex-selective probe. Chem Sci 6(7):4284–4290CrossRefPubMedPubMedCentralGoogle Scholar
  26. 26.
    Yu Q, Gao PL, Zhang KY, Tong X, Yang HR, Liu SJ, Du J, Zhao Q, Huang W (2017) Luminescent gold nanocluster-based sensing platform for accurate H2S detection in vitro and in vivo with improved anti-interference. Light-Sci Appl 6:e17107CrossRefPubMedPubMedCentralGoogle Scholar
  27. 27.
    Ahmed R, Yetisen AK, Yun SH, Butt H (2017) Color-selective holographic retroreflector array for sensing applications. Light-Sci Appl 6:e16214CrossRefPubMedPubMedCentralGoogle Scholar
  28. 28.
    Lutsyk P, Arif R, Hruby J, Bukivskyi A, Vinijchuk O, Shandura M, Yakubovskyi V, Kovtun Y, Rance GA, Fay M, Piryatinski Y, Kachkovsky O, Verbitsky A, Rozhin A (2016) A sensing mechanism for the detection of carbon nanotubes using selective photoluminescent probes based on ionic complexes with organic dyes. Light-Sci Appl 5:e16028CrossRefPubMedPubMedCentralGoogle Scholar
  29. 29.
    Xu J, Li W, Shen P, Li Y, Li Y, Deng Y, Zheng Q, Liu Y, Ding Z, Li J, Zheng T (2017) Microfluidic fabrication of photonic encoding magnetized silica microspheres for aptamer-based enrichment of Ochratoxin a. Microchim Acta 184(10):3755–3763CrossRefGoogle Scholar
  30. 30.
    Mahdi M, Mansour B, Afshin M (2016) Competitive immunoassay for Ochratoxin a based on FRET from quantum dot-labeled antibody to rhodamine-coated magnetic silica nanoparticles. Microchim Acta 183(12):3093–3099CrossRefGoogle Scholar
  31. 31.
    Dai S, Wu S, Duan N, Wang Z (2016) A luminescence resonance energy transfer based aptasensor for the mycotoxin Ochratoxin a using upconversion nanoparticles and gold nanorods. Microchim Acta 183(6):1909–1916CrossRefGoogle Scholar
  32. 32.
    Wu H, Liu R, Kang X, Liang C, Lv L, Guo Z (2018) Fluorometric aptamer assay for ochratoxin a based on the use of single walled carbon nanohorns and exonuclease III-aided amplification. Microchim Acta 185(1)Google Scholar
  33. 33.
    Lv X, Zhang Y, Liu G, Du L, Wang S (2017) Aptamer-based fluorescent detection of ochratoxin a by quenching of gold nanoparticles. RSC Adv 7(27):16290–16294CrossRefGoogle Scholar
  34. 34.
    Lv Z, Chen A, Liu J, Guan Z, Zhou Y, Xu S, Yang S, Li C (2014) A simple and sensitive approach for Ochratoxin a detection using a label-free fluorescent Aptasensor. PLoS One 9(1):e85968CrossRefPubMedPubMedCentralGoogle Scholar

Copyright information

© Springer-Verlag GmbH Austria, part of Springer Nature 2018

Authors and Affiliations

  • Renjie Liu
    • 1
  • Hua Wu
    • 1
    • 2
  • Lei Lv
    • 2
  • Xiaojiao Kang
    • 3
  • Chengbi Cui
    • 2
  • Jin Feng
    • 2
  • Zhijun Guo
    • 2
  1. 1.Institute of food science and engineeringJilin agricultural UniversityChangchunChina
  2. 2.College of agricultureYanbian universityYanjiChina
  3. 3.School of Electrical Engineering and IntelligentizationDongguan University of TechnologyDongguanChina

Personalised recommendations