Table 2 Primers used for RT‐PCR

From: Resveratrol induces PD-L1 expression through snail-driven activation of Wnt pathway in lung cancer cells

Gene GenBank accession number Primer (5′–3′)
PD-L1 NM_001314029.1 Fwd: ACTGGCATTTGCTGAACGC
Rev: ACAATTAGTGCAGCCAGGTCT
GAPDH NM_002046 Fwd: GACCCCTTCATTGACCTCAAC
Rev: CTTCTCCATGGTGGTGAAGA
Axin2 NM_004655.3 Fwd: CAGGACACTGCTCTCTCAGATTCA
Rev: TCACAACAGCCTTTGCAGGG-
Snail NM_005985.4 Fwd: AGGCAGCTATTTCAGCCTCC
Rev: CACATCGGTCAGACCAGGC
β-actin NM_001101.5 Fwd: CCTTCCTGGGCATGGAGTCCT
Rev: GGAGCAATGATCTTGATCTTC