Table 1 Primers used for cloning

From: Resveratrol induces PD-L1 expression through snail-driven activation of Wnt pathway in lung cancer cells

Gene GenBank accession number Primer (5′–3′)
PD-L1 NM_001314029.1 Fwd: TTGGTACCAGAAGGAAAGGCAAACAACGAAGAGTC
Rev: TCTCGAGGGAGCCTCGGGAAGCTGCGCAGAACTG
PD-L1 NM_001314029.1 Fwd: TCTAGAATTAAAACCTTTGCCATATGGGTCT
Rev: AGACCCATATGGCAAAGGTTTTAATTCTAGA
PD-L1 NM_001314029.1 Fwd: GACCCTGAGCATTCTCATTTTATGTAGCTCGGGA
Rev: TCCCGAGCTACATAAAATGAGAATGCTCAGGGTC
PD-L1 NM_001314029.1 Fwd: ATTTAGAAAA AGAGACATTTTAGAAAAGGGAGCA
Rev: TGCTCCCTTTTCTAAAATGTCTCTTTTTCTAAAT
AXIN2 NM_004655.3 Fwd: CCCAAGCTTATGAGTAGCGCTATGTTGGT
Rev: CGGGGTACCTCAATCGATCCGCTCCACTT
AXIN2 NM_004655.3 Fwd: CGGGGTACCGGCGCCGGGCCTTTCTTTATGTT
Rev: CATGCTAGCGAGTGAGTTGGTTTCTGGTTTGGG
AXIN2 NM_004655.3 Fwd: CCGCTAGGCTGTGTGAGTCACAAACCAATTTCGGTA
Rev: TACCGAAATTGGTTTGTGACTCACACAGCCTAGCGG