Advertisement

Planta

, Volume 247, Issue 5, pp 1099–1108 | Cite as

Development of Thinopyrum ponticum-specific molecular markers and FISH probes based on SLAF-seq technology

  • Liqin Liu
  • Qiaoling Luo
  • Wan Teng
  • Bin Li
  • Hongwei Li
  • Yiwen Li
  • Zhensheng Li
  • Qi Zheng
Original Article

Abstract

Main conclusion

Based on SLAF-seq, 67 Thinopyrum ponticum-specific markers and eight Th. ponticum-specific FISH probes were developed, and these markers and probes could be used for detection of alien chromatin in a wheat background.

Abstract

Decaploid Thinopyrum ponticum (2n = 10x = 70) is a valuable gene reservoir for wheat improvement. Identification of Th. ponticum introgression would facilitate its transfer into diverse wheat genetic backgrounds and its practical utilization in wheat improvement. Based on specific-locus-amplified fragment sequencing (SLAF-seq) technology, 67 new Th. ponticum-specific molecular markers and eight Th. ponticum-specific fluorescence in situ hybridization (FISH) probes have been developed from a tiny wheat—Th. ponticum translocation line. These newly developed molecular markers allowed the detection of Th. ponticum DNA in a variety of materials specifically and steadily at high throughput. According to the hybridization signal pattern, the eight Th. ponticum-specific probes could be divided into two groups. The first group including five dispersed repetitive sequence probes could identify Th. ponticum chromatin more sensitively and accurately than genomic in situ hybridization (GISH). Whereas the second group having three tandem repetitive sequence probes enabled the discrimination of Th. ponticum chromosomes together with another clone pAs1 in wheat–Th. ponticum partial amphiploid Xiaoyan 68.

Keywords

FISH GISH Molecular markers SLAF-seq Thinopyrum ponticum  Triticum aestivum 

Abbreviations

GISH

Genome in situ hybridization

FISH

Fluorescence in situ hybridization

CS

Wheat cv. Chinese spring

SLAF-seq

Specific-locus-amplified fragment sequencing

Introduction

Decaploid tall wheatgrass [Thinopyrum ponticum (Podp.) Barkworth & D. R. Dewey, 2n = 10x = 70, syn. Agropyron elongatum (Host) P. Beauv., Elytrigia pontica (Podp.) Holub, Lophopyrum ponticum (Podp.) Á Löve] is an important forage crop (Li and Wang 2009) and a valuable gene donor for wheat (Triticum aestivum, 2n = 6x = 42) improvement because of its biotic and abiotic stress tolerance and high crossability with various Triticum species (Shannon 1978; Sharma et al. 1989). To transfer its advantageous traits into wheat, distant hybridization has been performed between wheat and Th. ponticum (Yang et al. 2006; Jauhar et al. 2009; Lin et al. 2009). Rapid and accurate characterization of tall wheatgrass chromatin would clearly improve the efficiency of applying elite genes in wheat breeding. Nowadays, cytological methods and molecular markers are widely used to distinguish and follow alien chromosomes or chromosome segments during crossing and selection (Schwarzacher et al. 1992; Kruppa et al. 2016; Sibikeev et al. 2017).

A conventional cytological method, genomic in situ hybridization (GISH), can be used to recognize related species chromosomes in a wheat background (Han et al. 2003; Sepsi et al. 2008; Wang et al. 2011). Li et al. (2003) characterized the chromosome constitution of the wheat—Th. ponticum partial amphiploid line and its derivatives by GISH. Zheng et al. (2006b) identified eight T. aestivumTh. ponticum translocations and estimated the size of Th. ponticum chromosome segments by GISH. However, GISH is rather time-consuming and its hybridization specificity is influenced by the ratio of probe DNA to blocking DNA. Another cytological method, fluorescence in situ hybridization (FISH) with labeled cloned DNA containing a species-specific sequence, can also paint alien chromosome segments (Zheng et al. 2006a; Linc et al. 2012). Kong et al. (1999) developed a C-genome-specific repetitive sequence pAeca212 from Aegilops caudata so as to separate Ae. caudate chromosome and translocation segments from wheat chromosome. FISH localized the dispersed repetitive DNA sequence pHvNAU62 to six of seven Haynaldia villosa chromosome pairs in telomeric or sub-telomeric regions (Li et al. 1995). Using the probes developed from Thinopyrum elongatum, chromosome painting of Thinopyrum chromosomes was successfully performed (Bournival et al. 1994). However, up to now, only a few probes developed from Thinopyrum have been reported (Bai et al. 2002).

With regard to molecular markers, developing species-specific markers for the identification of alien chromosomes is of great significance in breeding programs. In recent years, several Th. ponticum species-specific molecular markers have been developed by random-amplified polymorphic (RAPD), expressed sequence tag (EST), cleaved amplification polymorphism sequence (CAPS), sequence-tagged sites (STS), and simple sequence repeats (SSR) (Liu and Kolmer 1998; Yu et al. 2001; Santra et al. 2006; Li et al. 2007; Wang et al. 2010, 2015). Nevertheless, the existing markers are extremely inadequate to meet the needs in Th. ponticum chromatin detection. Fortunately, since next-generation sequencing (NGS) technology became available, it is now possible to achieve dense marker coverage without a reference genome (Davey et al. 2011). As one method using NGS technology, specific-locus-amplified fragment sequencing (SLAF-seq) provides a high-throughput, high-accuracy, and low-cost tool for developing an ample number of markers of Triticale species (Chen et al. 2013a, b; Li et al. 2016). In fact, 518 specific fragments on the 7E chromosome of Th. elongatum were successfully obtained by SLAF-seq, and depended on 135 randomly selected fragments, 89 specific molecular markers of Th. elongatum were developed, with efficiency of up to 65.9% (Chen et al. 2013a). However, to the best of our knowledge, the development of specific molecular markers of decaploid Th. ponticum based on SLAF-seq technology has yet to be reported.

In this study, SLAF-seq technology was applied to a small wheat—Th. ponticum translocation line, EA, which carried a TTh-4DS·4DL translocation. By comparison of genome-wide SLAFs between wheat and Thinopyrum species, we selected all of the EA-specific sequences for the development of new PCR-based Th. ponticum-specific molecular markers and FISH probes, which make it more convenient to discriminate Th. ponticum chromatin from wheat chromosome.

Materials and methods

Plant materials and DNA extraction

Chinese spring (CS) (2n = 42), wheat cultivated variety Xiaoyan 81 (2n = 42), Shaan 229 (2n = 42), wheat–Th. ponticum partial amphiploid Xiaoyan 68 (2n = 56), Th. ponticum (2n = 70), wheat–Th. ponticum translocation line EA (2n = 42) (Xiaoyan 81/4/Xiaoyan 81/3/Xiaoyan 81//Shaan 229/Xiaoyan 68), the 61 individuals from F2 population of wheat cv. Xiaoyan 60 and EA (2n = 42) were maintained by our laboratory. Seeds of Th. elongatum (2n = 14, EeEe), Thinopyrum bessarabicum (2n = 14, EbEb) and Pseudoroegneria strigosa (2n = 14, StSt) were obtained from the US National Plant Germplasm System (NPGS). Seeds of Haynaldia villosa (2n = 14, VV) and Hordeum vulgare (2n = 14, HH) were kindly provided by Prof. Yonghong Zhou (Sichuan Agricultural University), Agropyrum cristatum (2n = 14, PP) by Dr. Jinpeng Zhang (Chinese Academy of Agricultural Sciences), Secale cereale (2n = 14, RR) by Prof. Diaoguo An (Institute of Genetics and Developmental Biology, Chinese Academy of Sciences). Total genomic DNA was extracted from the fresh young leaves, using a cetyl-trimethyl-ammonium bromide (CTAB) method (Gill et al. 1991), and adjusted to a final concentration of 150 ng/µl.

Specific-locus amplified fragment sequencing

Genomic DNA samples of EA, Th. ponticum, and CS were subjected to SLAF-seq with some modifications (Sun et al. 2013), performed by the Beijing Biomarker Technologies Corporation (Beijing, China). All paired-end reads (160 bp per read) generated from SLAF-seq raw reads were clustered according to sequence similarity. Sequences with over 90% identity were grouped into one SLAF locus, as described (Sun et al. 2013).

Sequence comparison and Th. ponticum-specific fragment acquisition

To get the Th. ponticum-specific SLAFs, we filtered the SLAFs by a specificity comparison with some modifications (Chen et al. 2013a). First, the good quality sequences of EA were compared with the CS sequences on http://www.ncbi.nlm.nih.gov and http://www.cerealsdb.uk.net, and then, they were compared with the CS sequences acquired by SLAF-seq in this study. Finally, the comparison was made between the sequences of EA and Th. ponticum, and the specific sequences of Th. ponticum were acquired.

Development, verification, and detection of Th. ponticum-specific molecular markers

According to these Th. ponticum-specific sequences, PCR primers (forward and reverse primer) were designed for the amplification of EA, Th. ponticum, Xiaoyan 68, Xiaoyan 81, Shaan 229, and CS. All PCR primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd. (Shanghai, China). The amplified products were examined by 2% agarose electrophoresis. Those markers amplified the specific bands in EA, Xiaoyan 68 and Th. ponticum, but not in Xiaoyan 81, Shaan 229 and CS were identified as the Th. ponticum-specific molecular markers. Then, the stability, repeatability, and specificity of these markers were detected in the F2 individuals of Xiaoyan 60 and EA and in several wheat-related species.

The PCR system final volume was set to 20 µl containing 1 µl of template DNA (150 ng/µl), 17 µl of 1.1 × Taq Mix (Tsingke Biological Technology, Beijing, China), and 1 µl of each primer (10 µM). The PCR reactions were performed as follows: denaturation at 94 °C for 3 min, followed by 30 cycles of 94 °C for 30 s, appropriate anneal temperature (48–60 °C) for 30 s, 72 °C for 30 s, and a final extension at 72 °C for 5 min.

Chromosome preparation

Seeds were germinated on moistened filter paper in petri dishes at 23 °C for 48 h. Actively growing roots of 1–2 cm length were removed from seedlings and pretreated in N2O at 10 atm pressure for 2 h to accumulate metaphases, then fixed in 90% acetic acid and stored in 70% v/v ethanol. Chromosome spread preparation was carried out following the procedures of Zheng et al. (2014). Good slides were stored at 4 °C until use.

Fluorescence in situ hybridization

For cytological characterization, FISH was performed using published protocols with some modification (Zheng et al. 2014). All Th. ponticum-specific sequences were amplified by PCR from Th. ponticum genomic DNA and labelled with fluorescein-12-dUTP (green) (Life Technologies Corporation, Eugene, OR, USA) or Texas-red-5-dCTP (red) (PerkinElmer Life Sciences, Boston, MA, USA) served as probes. After hybridization, the slides were washed in 2 × SSC and mounted in Vectashield mounting medium with 4, 6-diamindino-2-phenyl-indole (DAPI) (Vector Laboratories, Youngstown, OH, USA) (Zheng et al. 2014). All cells with good hybridization signals were captured by Olympus DP80 CCD camera attached to an Olympus BX53 and analyzed using program CellSens Standard 1.12 (Olympus Corporation, Tokyo, Japan).

Sequential genomic and multicolor fluorescence in situ hybridization (sequential GISH and mc-FISH)

Procedures for sequential GISH and mc-FISH were according to Zheng et al. (2015) with some modification. Briefly, Th. ponticum genomic DNA was labelled with Texas-red-5-dCTP (red) and served as probe, and wheat DNA was used as a block. The ratio of probe to block was 1:250. Mc-FISH was carried out after GISH analysis using two probes, pAs1 labeled with Texas-red-5-dCTP (red) and Th. ponticum-specific sequence labelled with fluorescein-12-dUTP (green). Two probes were mixed 1:1 before the hybridization. After the hybridization, the slides were counterstained with DAPI. The image acquisition and analysis were described as those in FISH process.

Results

Molecular marker development for Th. ponticum

A total of 96,565, 121,256, and 108,782 effective SLAFs were obtained for CS, Th. ponticum, and EA by high-throughput sequencing, respectively. After comparison with the CS fragments and sequences in the online databases at http://www.ncbi.nlm.nih.gov and http://www.cerealsdb.Uk.net, 2035 EA fragments with homologies less than 50% of CS were acquired. By sequence alignment with the Th. ponticum fragments obtained by SLAF-seq, 171 EA fragments whose homology with Th. ponticum was greater than 50% were selected, which were identified as the Th. ponticum-specific fragments.

Subsequently, based on these fragments, 171 pairs of primers were designed for marker development. PCR products were yielded from EA, CS, Xiaoyan 81, Shaan 229, Xiaoyan 68, and Th. ponticum. Among these, 67 primer pairs, such as EA5-84, amplified specific bands from EA, Xiaoyan 68, and Th. ponticum, but did not from CS, Xiaoyan 81, and Shaan 229 (Fig. 1). Therefore, these 67 primers were regarded as Th. ponticum-specific markers (Table S1), with a success rate of up to 39.18%.
Fig. 1

PCR amplification of EA5-84 in CS and the parents of wheat—Th. ponticum translocation line EA. Lanes: M, Marker; 1, EA; 2, CS; 3, Xiaoyan 81; 4, Shaan 229; 5, Xiaoyan 68; 6, Th. ponticum

Utility verification of Th. ponticum-specific markers

PCR amplification using newly developed markers was performed in 61 F2 individuals of wheat cv. Xiaoyan 60 and EA for sensitivity, stability, and repeatability analysis (Fig. 2). In 43 plants, specific bands could be amplified by these markers, but not in the other 18 plants. Those 43 plants with specific bands carried TTh-4DS·4DL translocations as determined by GISH, while the 18 plants without specific bands had no GISH signal in their chromosome preparation. It turned out that the 67 specific markers of Th. ponticum could amplify fragments of this species stably and repeatedly.
Fig. 2

Stability and repeatability of EA5-84 in 61 F2 individuals of wheat cv. Xiaoyan 60 and EA. Lanes: M, Marker; 1–61, 61 F2 individuals; 62, Xiaoyan 60; 63, EA; 64, CS; 65, Th. ponticum

To confirm the specificity of this approach, these markers were used to amplify products from several wheat-related species (Fig. 3). The assignment of the Th. ponticum-specific markers in wheat-related species is presented in Table S2. Out of the 67 Th. ponticum-specific markers, 20 amplified products only from decaploid Th. ponticum, but could not amplify any band from other related diploid species (Table S2). In total, 24, 27, and 32 markers amplified specific bands not only from Th. ponticum, but also from its putative diploid donor species Th. elongatum, Th. bessarabicum, and Ps. strigosa, respectively. There were 10, 7, 3, and 5 markers that amplified products from Ag. cristatum, H. villosa, H. vulgare, and S. cereale, respectively.
Fig. 3

Specificity of EA5-84 in other wheat-related species. Lanes: M, Marker; 1, Thinopyrum bessarabicum; 2, Agropyrum cristatum; 3, Haynaldia villosa; 4, Hordeum vulgare; 5, Secale cereale; 6, Pseudoroegneria strigosa; 7, Thinopyrum elongatum; 8, CS; 9, Xiaoyan 68; 10, Th. ponticum; 11, EA

FISH probes exploitation of Th. ponticum

PCR products of 67 Th. ponticum-specific markers were fluorescently labelled as probes in FISH analysis on partial amphiploid Xiaoyan 68. Among them, eight Th. ponticum-specific probes (Table 1) specifically dyed the Th. ponticum chromosomes and chromosome segments. Five out of eight probes, pThp2.31, pThp2.77, pThp2.83, pThp3.93, and pThp5.84, produced dispersed patterns on all tall wheatgrass chromatin in Xiaoyan 68. For instance, pThp3.93 hybridized strongly over the length of all Th. ponticum chromosomes and chromosome segments (Fig. 4b). The pattern was patchy with stronger hybridization nearer the telomeric region (Fig. 4e). Whereas the other three probes, pThp3.81, pThp3.96, and pThp5.121, were associated with a punctate pattern of coloring on ten chromosomes, including eight intact alien chromosomes and two translocated Th. ponticum chromosomes segments in Xiaoyan 68.
Table 1

SLAF sequences of the Th. ponticum-specific probes

Specific markers

Specific probe

SLAF-seq sequences (5′–3′) of the special probe

EA2-31

pThp2.31

TTATAGCGAAGGTCACCGTACACCGACAAAGTGACACGGCGATGTTTTTTAAATAGGCTCAACCACCTCGCGAGAGCCCAXXXXXXXXXXTATGGGTCTATGGAGACTAGTCAAAGCTGGGGGTGTCCATGGCTCATGGTGAGCCATGCCTTCTGATCCAATCATGAACG

EA2-77

pThp2.77

CTGTTGACTGGTCAGCTGACCGTTTGACCTGCTGACGTCATTTTGACGCCATGCTGACGTCATATTTACTTTTCTGAATAXXXXXXXXXXGCTGCATACTTTTATTGTGTATTTATCTGTTTCCTTCCCCTCTTCTCTTCCGTAGACCCCGACGTCGCCGTAGCTCCCGA

EA2-83

pThp2.83

GGCATCCCATTCTTCCCGTACAAGCCAAAGGACGTTCCTCCCCGCACATCCTGTCATTTGCAAAAAAGCAACAGTTATATXXXXXXXXXXAACAAATAGCTCTAGTTTTTTCCTACCTACTCTACGTTCCATCAAGACCAAGTCATATTATTGAAGCAGGTACATATAGA

EA3-81

pThp3.81

CGTCGGAGAGGCGTAGCGGAGGCCGCGACCCGGGGAGACTACCTTCCGCGTCCCGGGCGCGTCCGCACTACGTGCCCTCTXXXXXXXXXXAAAAGGACCGCGACCGCGAGTGTGTGAAAGCGCTCCCGGAGGTGTAAAAACGGTTATGGGAACGTGTGACGGAGTTCGGT

EA3-93

pThp3.93

ATGTATTCATCTCTTGGGTACCCTCATGGTCAACCCGATAACACATCACTCACGGGTACCCCTCGGGGTTAACCTGACTTXXXXXXXXXXGGTGATGTACTGGTTCAGCCCGTCGATCACATCGATCGGGGCACTGGAAACTAAGCAGGGCAACTAAGAGAAAGAAGAGG

EA3-96

pThp3.96

GATATACCGGAGCATTGGGACGGTACACCGGAGGAGCTGGTCGATACAAGCTCTGAGGAAACCAGATGTGGCGCTTCTGAXXXXXXXXXXGGAATGTAGCGGGCACGGAAAGCAATCTTGAATTCTTCCCAAGTGACGACAGTAGCAGGAGGCAGAGTCTGTCTGTGGGT

EA5-84

pThp5.84

GATATACCGGAGCATTGGGACGGTACACCGGAGGAGCTGGTCGATACAAGCTCTGAGGAAACCAGATGTGGCGCTTCTGAXXXXXXXXXXGGAATGTAGCGGGCACGGAAAGCAATCTTGAATTCTTCCCAAGTGACGACAGTAGCAGGAGGCAGAGTCTGTCTGTGGGT

EA5-121

pThp5.121

TTCACGGGTAACTCATGTTGGTCGGGTATCGATCTCCGTGCCGATCCGACCGATGACGTGCCGTGTGGGGCGAAATTTCGXXXXXXXXXXAAAGTAACCACGCCGGCGAGTGTCTCAAAGCGCTCCCGTAGGTGTAAAAACATGTATAGGCAAGTAGCACCGAGTCCGGT

X stands for the base that has not been sequenced

Fig. 4

Genomic in situ hybridization (GISH) and multicolor-fluorescence in situ hybridization (mc-FISH) in the partial amphiploid Xiaoyan 68 (2n = 56). a Chromosome spread probed with Th. ponticum total DNA (red). b Same chromosome spread probed with pThp3.93 (green). c Same chromosome spread probed with pThp3.96 (green) and pAs1 (red). d–f Th. ponticum chromosomes in Xiaoyan 68, showing the locations of Th. ponticum genome (d), pThp3.93 (e), pThp3.96, and pAs1 (f). g A diagrammatic representation of the cytogenetic locations of FISH probe pAs1 and pThp3.96. The bar represents 20 µm

These two Th. ponticum-specific probes, pThp3.93 and pThp3.96, were cloned and sequenced (Table S3), and then compared with common wheat sequences in http://www.ncbi.nlm.nih.gov, http://www.cerealsdb.uk.net and https://wheat.pw.usda.gov. The lengths of the probes pThp3.93 and pThp3.96 were 469 and 591-bp, with GC content 49.68 and 54.31%, respectively. BLAST search revealed that the 16–455 bp nucleotide sequence of pThp3.93 had 83% sequence identity to an LTR retrotransposon of Aegilops tauschii (CM008370.1). BLAST search revealed that the 3–412 bp nucleotide sequence of pThp3.96 had 86% sequence identity to an intron of gene (LOC109786650) of Ae. tauschii (NW_017930880.1) (Table S4).

When mixing pThp3.96 with another repetitive DNA clone pAs1 as mc-FISH probes (Fig. 4c), 12 Th. ponticum chromosomes and two wheat—Th. ponticum translocation chromosomes could be clearly distinguished from each other (Fig. 4f, g). Chromosome 1 was shown to be the longest chromosome with an intense pThp3.96 signal on its short arm. Neither chromosome 2 nor chromosome 3 had any pThp3.96 site; however, chromosome 2 was a metacentric chromosome, while chromosome 3 was a sub-metacentric one. Chromosome 2 had strong pAs1 bands on its short arm, while chromosome 3 had these on its long arm. Chromosomes 4 and 6 carried pThp3.96 signals at both ends. The pAs1 signals were more intense on chromosome 4 than on chromosome 6. Chromosome 5 had pThp3.96 sites distributed on its long arm. Chromosome 7 was clearly the most easily identifiable chromosome, because it showed pThp3.96 band on the Th. ponticum chromosome segment and distinctive pAs1 signals on the wheat chromosome segment.

Detection and application of Th. ponticum-specific FISH probes

To confirm the utility of the Th. ponticum-specific FISH probes, the FISH patterns of pThp3.93 and pThp3.96 were analyzed in the TTh-4DS·4DL line EA (Fig. 5), decaploid Th. ponticum (Fig. 6), and three possible diploid donor species of Th. ponticum, namely, Th. elongatum, Th. bessarabicum, and Ps. strigosa (Fig. 7).
Fig. 5

Genomic in situ hybridization (GISH) and multicolor-fluorescence in situ hybridization (mc-FISH) in EA (2n = 42). a Chromosome spread probed with Th. ponticum genome (red). b Same chromosome spread probed with pThp3.93 (green). c Same chromosome spread probed with pThp3.96 (green) and pAs1 (red). Arrows indicate the translocation chromosome segments of Th. ponticum. The bar represents 20 µm

Fig. 6

Fluorescence in situ hybridization (FISH) in Th. ponticum (2n = 70), using pThp3.93 (a) and pThp3.96 (b) as probes (red). The bar represents 20 µm

Fig. 7

FISH karyotypes using pThp3.93 (red) as probes. a Th. elongatum; b Th. bessarabicum; c Ps. strigosa. The arrows show signals present on the distal arms of a pair of chromosomes. Fish karyotypes using pThp3.96 (red) as probes. d Th. elongatum; e Th. bessarabicum; f Ps. strigosa. The bar represents 20 µm

Compared with the GISH pattern of total Th. ponticum genomic DNA as a probe (Fig. 5a), the FISH pattern of pThp3.93 in the translocation line EA did more clearly show the two alien chromosome segments without unspecific hybridization on the wheat chromatin (Fig. 5b). Moreover, the pThp3.93 signals extended to all chromosomes in decaploid Th. ponticum (Fig. 6a), as well as in the three progenitor diploid species (Fig. 7a−c), with stronger hybridization towards the distal ends on both short and long arms.

As for pThp3.96, the hybridization band was strong on the alien chromosome segments in EA (Fig. 5c). In decaploid Th. ponticum, there were 22 chromosomes having pThp3.96 signals on both chromosome ends, 29 chromosomes having strong or faint pThp3.96 signals on their short or long arm ends, and 19 chromosomes having no pThp3.96 bands at all (Fig. 6b). In three progenitor diploid species, there was one pair of chromosomes in each of Th. elongatum and Th. bessarabicum showing hybridization signals at the terminals of their short arms (Fig. 7d, e). Significantly, the hybridization signals in the two arms differed in Th. elongatum: the signal was intense at one site, while it was weak at the other. In contrast, in Th. bessarabicum, both signals were faint. However, no hybridization site of pTh3.96 was found in the chromosomes of Ps. strigosa (Fig. 7f).

Discussion

SLAF-seq, an efficient next-generation sequencing (NGS)-based method and high-resolution strategy of large-scale genotyping, has been applied successfully in the development of large numbers of molecular markers in various species (Jia et al. 2016; Luo et al. 2016). Compared with the conventional methods, such as RFLP and AFLP, SLAF-seq technology possesses a remarkable advantage in developing large numbers of highly accurate molecular markers with less sequencing. In a previous study (Chen et al. 2013a), 89 specific molecular markers of diploid Th. elongatum were developed, which notably were from the whole length of chromosome 7E. In our study, 67 specific molecular markers were developed from a tiny Th. ponticum chromosome segment. The obtained findings proved that the SLAF-seq technology is efficient for developing alien-specific molecular markers in a wheat background. The markers were also shown to be suitable for tracking chromosome fragments in advanced backcross derivatives from the distance hybridization between wheat and its wild relatives.

FISH analysis with repetitive DNA probes, which can identify alien introgression in a wheat genetic background, would facilitate gene transfer from Thinopyrum to wheat (Gonzalez-Garcia et al. 2011). For instance, Yao et al. (2016) isolated seven Th. ponticum genome-specific repetitive sequences, which could discriminate chromosomes of Th. ponticum and Th. intermedium from wheat chromosomes without wheat DNA block. In the present study, five Th. ponticum-specific sequence probes, namely, pThp2.31, pThp2.77, pThp2.83, pThp3.93, and pThp5.84, produced a dispersed pattern on all Th. ponticum chromosomes and chromosome segments. Although there was no need to add blocking DNA, nonspecific hybridization was not obvious on the wheat chromosomes. Therefore, FISH analysis with dispersed repetitive DNA probes is more convenient, efficient and accurate than GISH. Three tandem repetitive sequence, probes, namely pThp3.81, pThp3.96, and pThp5.121, showed hybridization sites at the majority of Th. ponticum chromosome arms, and thus, they offered a good probability of distinguishing some different Th. ponticum chromosomes with other repetitive DNA clones, such as pAs1, in this study. Although, owing to the limited number of tandem repetitive sequences, it is difficult to achieve the accurate identification of every chromosome of Th. ponticum, FISH with repetitive DNA has become a useful tool in detecting alien chromatin.

The complex genomic composition of Th. ponticum has been investigated for decades and various hypotheses have been proposed (Dewey 1984; Muramatsu 1990; Wang et al. 1991). Zhang et al. (1996a, b) proposed that the formula of the Th. ponticum genome was EeEbExStSt, whereas Chen et al. (1998) concluded that the haploid genomic constitution of Th. ponticum was JJJJsJs. The previous studies also indicated that Th. elongatum (EeEe), Th. bessarabicum (EbEb), and Pseudoroegneria (StSt) were probably the donor species of Th. ponticum (Muramatsu 1990; Wang et al. 1991). However, our specificity analysis of newly developed Th. ponticum-specific markers showed that the amplification frequencies of the markers in these three putative diploid progenitors are far higher than in other wheat-related species. In addition, all chromosomes of Th. elongatum, Th. bessarabicum, and Ps. strigosa were dyed by the Th. ponticum-specific probe pThp3.93. Moreover, only two chromosomes had pThp3.96 signals on the short arm end in Th. elongatum and Th. bessarabicum. In contrast, in decaploid Th. ponticum, there were 51 chromosomes showing pThp3.96 signals. Among these, 22 chromosomes had pThp3.96 signals on both ends. The above FISH analysis results showed that the distribution and number of repetitive DNA sequence had altered a lot. The most likely explanation for these finding is that diploid progenitor DNA sequences had changed as a result of polyploidization (Mcintyre et al. 1988). Our results provide further evidence that Th. ponticum originated from diploid Th. elongatum, Th. bessarabicum, and Pseudoroegneria and these three genomes were modified during hybridization and polyploidization.

In conclusion, based on SLAF-seq, 67 Th. ponticum-specific markers and eight Th. ponticum-specific FISH probes were successfully developed. These markers and probes could be used not only for sensitive and accurate detection of alien chromosomes and chromosome segments in a wheat background, but also for chromosome fingerprinting in partial amphiploid Xiaoyan 68 as well as for understanding the genomic composition of Th. ponticum.

Author contribution statement

QZ, ZSL, and LQL conceived and designed the research. LQL, QLL, and WT performed the research. LQL and QZ wrote the manuscript. WT, BL, HWL, and YWL participated in the preparation of the reagents and materials in this study. All authors read and approved the manuscript.

Notes

Acknowledgements

We would like to thank Prof. Yonghong Zhou from Sichuan Agricultural University, Prof. Diaoguo An from Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and Dr. Jinpeng Zhang from Chinese Academy of Agricultural Sciences, for kindly providing seeds of some of the accessions used in this study. This project was supported by the National Key Research and Development Program of China (2016YFD0102000) and the Strategic Priority Research Program of the Chinese Academy of Sciences (No. XDA08030105).

Supplementary material

425_2018_2845_MOESM1_ESM.docx (23 kb)
Supplementary material 1 (DOCX 23 kb)
425_2018_2845_MOESM2_ESM.docx (26 kb)
Supplementary material 2 (DOCX 25 kb)
425_2018_2845_MOESM3_ESM.docx (16 kb)
Supplementary material 3 (DOCX 16 kb)
425_2018_2845_MOESM4_ESM.docx (17 kb)
Supplementary material 4 (DOCX 17 kb)

References

  1. Bai JR, Jia X, Wang DW (2002) Advances in studies of genome-specific repetitive DNA sequences in wheat and related species. Hereditas 24(5):595–600PubMedGoogle Scholar
  2. Bournival B, Obanni M, Abad A, Ohm H, Mackenzie S (1994) Isolation of a new species-specific repetitive sequence from Thinopyrum elongatum and its use in the studies of alien translocations. Genome 37(1):97–104CrossRefPubMedGoogle Scholar
  3. Chen Q, Conner RL, Laroche A, Thomas JB (1998) Genome analysis of Thinopyrum intermedium and Thinopyrum ponticum using genomic in situ hybridization. Genome 41(4):580–586CrossRefPubMedGoogle Scholar
  4. Chen SQ, Huang ZF, Dai Y, Qin SW, Gao YY, Zhang LL, Gao Y, Chen JM (2013a) The development of 7E chromosome-specific molecular markers for Thinopyrum elongatum based on SLAF-seq technology. PLoS One 8(6):e65122.  https://doi.org/10.1371/journal.pone.0065122 CrossRefPubMedCentralPubMedGoogle Scholar
  5. Chen SQ, Qin SW, Huang ZF, Dai Y, Zhang LL, Gao YY, Gao Y, Chen JM (2013b) Development of specific molecular markers for Thinopyrum elongatum chromosome using SLAF-seq technique. Acta Agron Sin 39(4):727.  https://doi.org/10.3724/sp.j.1006.2013.00727 CrossRefGoogle Scholar
  6. Davey JW, Hohenlohe PA, Etter PD, Boone JQ, Catchen JM, Blaxter ML (2011) Genome-wide genetic marker discovery and genotyping using next-generation sequencing. Nat Rev Genet 12(7):499–510.  https://doi.org/10.1038/nrg3012 CrossRefPubMedGoogle Scholar
  7. Dewey DR (1984) The genomic system of classification as a guide to intergeneric hybridization with the perennial Triticeae. Stadler Genet Symp 16:209–279CrossRefGoogle Scholar
  8. Gill KS, Lubbers EL, Gill BS, Raupp WJ, Cox TS (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34(3):362–374.  https://doi.org/10.1139/g91-058 CrossRefGoogle Scholar
  9. Gonzalez-Garcia M, Cuacos M, Gonzalez-Sanchez M, Puertas MJ, Vega JM (2011) Painting the rye genome with genome-specific sequences. Genome 54(7):555–564CrossRefPubMedGoogle Scholar
  10. Han FP, Fedak G, Benabdelmouna A, Armstrong K, Ouellet T (2003) Characterization of six wheat x Thinopyrum intermedium derivatives by GISH, RFLP, and multicolor GISH. Genome 46(3):490–495.  https://doi.org/10.1139/G03-032 CrossRefPubMedGoogle Scholar
  11. Jauhar PP, Peterson TS, Xu SS (2009) Cytogenetic and molecular characterization of a durum alien disomic addition line with enhanced tolerance to Fusarium head blight. Genome 52(5):467–483.  https://doi.org/10.1139/G09-014 CrossRefPubMedGoogle Scholar
  12. Jia QJ, Tan C, Wang JM, Zhang XQ, Zhu JH, Luo H, Yang JM, Westcott S, Broughton S, Moody D, Li CD (2016) Marker development using SLAF-seq and whole-genome shotgun strategy to fine-map the semi-dwarf gene ari-e in barley. BMC Genom 17(1):911.  https://doi.org/10.1186/s12864-016-3247-4 CrossRefGoogle Scholar
  13. Kong XY, Zhou RH, Dong YS, Jia JZ (1999) Cloning and characterization of a genome-specific repetitive sequence in Aegilops caudata L. Chin Sci Bull 44:1301–1305CrossRefGoogle Scholar
  14. Kruppa K, Turkosi E, Mayer M, Toth V, Vida G, Szakacs E, Molnar-Lang M (2016) McGISH identification and phenotypic description of leaf rust and yellow rust resistant partial amphiploids originating from a wheat × Thinopyrum synthetic hybrid cross. J Appl Genet 57(4):427–437.  https://doi.org/10.1007/s13353-016-0343-8 CrossRefPubMedCentralPubMedGoogle Scholar
  15. Li HJ, Wang XM (2009) Thinopyrum ponticum and Th. intermedium: the promising source of resistance to fungal and viral diseases of wheat. J Genet Genom 36(9):557–565.  https://doi.org/10.1016/S1673-8527(08)60147-2 CrossRefGoogle Scholar
  16. Li WL, Chen PD, Qi LL, Liu DJ (1995) Isolation, characterization and application of a species-specific repeated sequence from Haynaldia villosa. Theor Appl Genet 90(3–4):526–533PubMedGoogle Scholar
  17. Li HJ, Chen O, Conner RL, Guo BH, Zhang YM, Graf RJ, Laroche A, Jia X, Liu GS, Chu CC (2003) Molecular characterization of a wheat-Thinopyrum ponticum partial amphiploid and its derivatives for resistance to leaf rust. Genome 46(5):906–913CrossRefPubMedGoogle Scholar
  18. Li XM, Lee BS, Mammadov AC, Koo BC, Mott IW, Wang RRC (2007) CAPS markers specific to Eb, Ee, and R genomes in the tribe Triticeae. Genome 50(4):400–411.  https://doi.org/10.1139/G07-025 CrossRefPubMedGoogle Scholar
  19. Li GR, Wang HJ, Lang T, Li JB, La SX, Yang EN, Yang ZJ (2016) New molecular markers and cytogenetic probes enable chromosome identification of wheat-Thinopyrum intermedium introgression lines for improving protein and gluten contents. Planta 244(4):865–876CrossRefPubMedGoogle Scholar
  20. Lin F, Sun Q, Xu SC, Chen XM, Zhang LJ, Zhang CY, Xu YF, Miao Q, Qu B, Li N, Zhai Q (2009) Identification of wheat-Thinopyrum intermedium alien disomic addition lines conferring resistance to stripe rust. Can J Plant Sci 89(3):569–574CrossRefGoogle Scholar
  21. Linc G, Sepsi A, Molnar-Lang M (2012) A FISH karyotype to study chromosome polymorphisms for the Elytrigia elongata E genome. Cytogenet Genome Res 136(2):138–144.  https://doi.org/10.1159/000334835 CrossRefPubMedGoogle Scholar
  22. Liu JQ, Kolmer JA (1998) Molecular and virulence diversity and linkage disequilibria in asexual and sexual populations of the wheat leaf rust fungus, Puccinia recondite. Genome 41(6):832–840CrossRefGoogle Scholar
  23. Luo C, Shu B, Yao Q, Wu H, Xu W, Wang S (2016) Construction of a high-density genetic map based on large-scale marker development in mango using specific-locus amplified fragment sequencing (SLAF-seq). Front Plant Sci 7:1310.  https://doi.org/10.3389/fpls.2016.01310 PubMedCentralPubMedGoogle Scholar
  24. Mcintyre CL, Clarke BC, Appels R (1988) Amplification and dispersion of repeated DNA-sequences in the Triticeae. Plant Syst Evol 160(1–2):39–59.  https://doi.org/10.1007/Bf00936708 CrossRefGoogle Scholar
  25. Muramatsu M (1990) Cytogenetics of decaploid Agropyron elongatum (Elytrigia elongata) (2n = 70). I. Frequency of decavalent formation. Genome 33(6):811–817CrossRefGoogle Scholar
  26. Santra DK, Watt C, Little L, Kidwell KK, Campbell KG (2006) Comparison of a modified assay method for the endopeptidase marker Ep-D1b with the sequence tag site marker XustSSR2001-7DL for strawbreaker foot rot resistance in wheat. Plant Breed 125(1):13–18.  https://doi.org/10.1111/j.1439-0523.2006.01172.x CrossRefGoogle Scholar
  27. Schwarzacher T, Anamthawatjonsson K, Harrison GE, Islam AKMR, Jia JZ, King IP, Leitch AR, Miller TE, Reader SM, Rogers WJ, Shi M, Heslop-Harrison JS (1992) Genomic in situ hybridization to identify alien chromosomes and chromosome segments in wheat. Theor Appl Genet 84(7–8):778–786PubMedGoogle Scholar
  28. Sepsi A, Molnar I, Szalay D, Molnar-Lang M (2008) Characterization of a leaf rust-resistant wheat-Thinopyrum ponticum partial amphiploid BE-1, using sequential multicolor GISH and FISH. Theor Appl Genet 116(6):825–834.  https://doi.org/10.1007/s00122-008-0716-4 CrossRefPubMedGoogle Scholar
  29. Shannon MC (1978) Testing salt tolerance variability among tall wheatgrass lines. Agron J 70:719–722.  https://doi.org/10.2134/agronj1978.00021962007000050006x CrossRefGoogle Scholar
  30. Sharma HC, Ohm HW, Lister RM, Foster JE, Shukle RH (1989) Response of wheatgrasses and wheat × wheatgrass hybrids to barley yellow dwarf virus. Theor Appl Genet 77(3):369–374.  https://doi.org/10.1007/BF00305830 CrossRefPubMedGoogle Scholar
  31. Sibikeev SN, Badaeva ED, Gultyaeva EI, Druzhin AE, Shishkina AA, Dragovich AY, Kroupin PY, Karlov GI, Khuat TM, Divashuk MG (2017) Comparative analysis of Agropyron intermedium (Host) Beauv 6Agi and 6Agi2 chromosomes in bread wheat cultivars and lines with wheat-wheatgrass substitutions. Russ J Genet 53(3):314–324.  https://doi.org/10.1134/s1022795417030115 CrossRefGoogle Scholar
  32. Sun X, Liu D, Zhang X, Li W, Liu H, Hong W, Jiang C, Guan N, Ma C, Zeng H, Xu C, Song J, Huang L, Wang C, Shi J, Wang R, Zheng X, Lu C, Wang X, Zheng H (2013) SLAF-seq: an efficient method of large-scale de novo SNP discovery and genotyping using high-throughput sequencing. PLoS One 8(3):e58700.  https://doi.org/10.1371/journal.pone.0058700 CrossRefPubMedCentralPubMedGoogle Scholar
  33. Wang RRC, Marburger JE, Hu CJ (1991) Tissue-culture-facilitated production of aneuploid haploid Thinopyrum ponticum and amphiploid Hordeum violaceum × H. bogdenii and their use in phylogenetic studies. Theor Appl Genet 81:151–156CrossRefPubMedGoogle Scholar
  34. Wang RRC, Larson SR, Jensen KB (2010) Analyses of Thinopyrum bessarabicum, T. elongatum, and T. junceum chromosomes using EST-SSR markers. Genome 53(12):1083–1089.  https://doi.org/10.1139/G10-088 CrossRefPubMedGoogle Scholar
  35. Wang Y, Yu KF, Xie Q, Kang HY, Lin LJ, Fan X, Sha LN, Zhang HQ, Zhou YH (2011) Cytogenetic, genomic in situ hybridization (GISH) and agronomic characterization of alien addition lines derived from wheat-Psathyrostachys huashanica. Afr J Biotechnol 10(12):2201–2211Google Scholar
  36. Wang RRC, Larson SR, Jensen KB, Bushman BS, DeHaan LR, Wang S, Yan X (2015) Genome evolution of intermediate wheatgrass as revealed by EST-SSR markers developed from its three progenitor diploid species. Genome 58(2):63–70.  https://doi.org/10.1139/gen-2014-0186 CrossRefPubMedGoogle Scholar
  37. Yang ZJ, Li GR, Chang ZJ, Zhou JP, Ren ZL (2006) Characterization of a partial amphiploid between Triticum aestivum cv. Chinese Spring and Thinopyrum intermedium ssp trichophorum. Euphytica 149(1–2):11–17Google Scholar
  38. Yao H, Tang CG, Zhao J, Zheng Q, Li B, Hao CY, Li ZS, Zhang XY (2016) Isolation of Thinopyrum ponticum genome specific repetitive sequences and their application for effective detection of alien segments in wheat. Sci Agri Sin 49(19):3683–3693.  https://doi.org/10.3864/j.issn.0578-1752.2016.19.002 Google Scholar
  39. Yu BL, Huang ZF, Zhou WJ, Zhang WJ (2001) The creation of 1H chromosome-specific CAPs and ASA markers of barley. Acta Genet Sin 28(6):550–555PubMedGoogle Scholar
  40. Zhang XY, Dong YS, Wang RRC (1996a) Characterization of genomes and chromosomes in partial amphiploids of the hybrid Triticum aestivum x Thinopyrum ponticum by in situ hybridization, isozyme analysis, and RAPD. Genome 39(6):1062–1071.  https://doi.org/10.1139/g96-133 CrossRefPubMedGoogle Scholar
  41. Zhang XY, Koul A, Petroski R, Ouellet T, Fedak G, Dong YS, Wang RRC (1996b) Molecular verification and characterization of BYDV-resistant germ plasms derived from hybrids of wheat with Thinopyrum ponticum and Th. intermedium. Theor Appl Genet 93(7):1033–1039CrossRefPubMedGoogle Scholar
  42. Zheng Q, Li B, Mu SM, Zhou HP, Li ZS (2006a) Physical mapping of the blue-grained gene(s) from Thinopyrum ponticum by GISH and FISH in a set of translocation lines with different seed colors in wheat. Genome 49(9):1109–1114.  https://doi.org/10.1139/G06-073 CrossRefPubMedGoogle Scholar
  43. Zheng Q, Li B, Zhang X, Mu S, Zhou H, Li Z (2006b) Molecular cytogenetic characterization of wheat-Thinopyrum ponticum translocations bearing blue-grained gene(s) induced by r-ray. Euphytica 152(1):51–60.  https://doi.org/10.1007/s10681-006-9176-6 CrossRefGoogle Scholar
  44. Zheng Q, Lv Z, Niu Z, Li B, Li H, Xu SS, Han F, Li Z (2014) Molecular cytogenetic characterization and stem rust resistance of five wheat-Thinopyrum ponticum partial amphiploids. J Genet Genom 41(11):591–599.  https://doi.org/10.1016/j.jgg.2014.06.003 CrossRefGoogle Scholar
  45. Zheng Q, Luo Q, Niu Z, Li H, Li B, Xu SS, Li Z (2015) Variation in chromosome constitution of the Xiaoyan series partial amphiploids and its relationship to stripe rust and stem rust resistance. J Genet Genom 42(11):657–660.  https://doi.org/10.1016/j.jgg.2015.08.004 CrossRefGoogle Scholar

Copyright information

© Springer-Verlag GmbH Germany, part of Springer Nature 2018

Authors and Affiliations

  1. 1.Institute of Genetics and Developmental BiologyChinese Academy of Sciences/State Key Laboratory of Plant Cell and Chromosome EngineeringBeijingChina
  2. 2.University of Chinese Academy of SciencesBeijingChina

Personalised recommendations