Journal of Biosciences

, Volume 24, Issue 1, pp 35–41 | Cite as

Random amplification of polymorphic DNA with conserved sequences reveals genome-specific monomorphic amplicons: Implications in clad identification



The enzymatic amplification of genomic DNA with an arbitrary primer generates informative band profile useful for genome analysis. We used a set of synthetic oligodeoxyribonucleotide primers OAT15.2 (GACA)3.75, OAT18. 2 (GACA)4.5, OAT24.2 (GACA)6, OAT36 (GACA)9, comprising 4–9 consecutive units of GACA repeat, O33.15 (CACCTCTCCACCTGCC) and 033.6 (CCTCCAGCCCTCCTCCAGCCCT) for RAPD reactions of genomic DNA from different sources. The GACA based oligos of 15 and 18 base residues generated discernible genome specific amplicons whereas primers larger than 18 bases revealed smeary signals. The other oligos O33.15 and O33.6 also generated genome specific amplicons with more bands compared with those obtained from OAT15.2 or OAT18.2. The presence of OAT15.1 (GATA)3.75 and OAT15.2 (GACA)3.75 sequences in different genomes were ascertained by independent dot-blot hybridization prior to using them for RAPD reactions. The RAPD amplicons generated by evolutionarily conserved primer(s) or sequences shared by many species may be useful for clad identification in controversial systematics, comparative genome analysis, and for establishing the phylogenetic status of an organism.


Genome analysis conserved sequences RAPD monomorphic amplicons molecular systematics clad identification 


Unable to display preview. Download preview PDF.

Unable to display preview. Download preview PDF.


  1. Afroze D, Misra M A, Sulaiman I M, Sinha S, Sarkar C, Mahapatra A K and Hasnain S E 1998 Genetic alteration in brain tumors identified by RAPD analysis;Gene 206 45–48CrossRefGoogle Scholar
  2. Ali S and Epplen J T 1991 DNA fingerprinting of eukaryotic genomes by synthetic oligonucleotide probes;Indian J. Biochem. Biophys. 28 1–9PubMedGoogle Scholar
  3. Ali S, Gauri and Bala S 1993 Detection of genome specific monomorphic loci inBos taurus andBubalus bubalis with oligodeoxyribonucleotide probes;Anim. Genet. 24 199–202PubMedCrossRefGoogle Scholar
  4. Ali S, Ansari S, Ehtesham N Z, Azfer M A, Homkar U, Gopal R and Hasnain S E 1998 Analysis of the evolutionarily conserved repeat motifs in the genome of the highly endangered central Indian Swamp deerCervus duvauceli branderi;Gene 223 361–367PubMedCrossRefGoogle Scholar
  5. Ali S, Müller C R and Epplen J T 1986 DNA fingerprinting by oligonucleotide probes specific for simple repeats;Hum. Genet. 74 239–243PubMedCrossRefGoogle Scholar
  6. Dinesh K R, Lim R M. Chua K L, Chan W K and Phang V P 1993 RAPD analysis: An efficient method of DNA fingerprinting in fishes;Zool. Sci. 10 849–854PubMedGoogle Scholar
  7. Epplen J T, McCarrey J R, Sutou S and Ohno S 1982 Base sequence of a cloned snake W chromosome DNA fragment and identification of a male-specific putative mRNA in the mouse;Proc. Natl. Acad. Sci. USA 79 3798–3802PubMedCrossRefGoogle Scholar
  8. Epplen J T 1988 On simple repetitive GATA/GACA sequences in animal genomes: a critical appraisal;J. Hered. 79 409–417PubMedGoogle Scholar
  9. Hering O and Nirenberg H I 1995 Differentiation ofFusarium sambucinum, Fuckel sensulato and related species by RAPD-PCR;Mycopathology 129 159–164CrossRefGoogle Scholar
  10. Jeffreys A J, Wilson V and Thein S L 1985 Hypervariable minisatellite regions in human DNA;Nature (London) 314 67–73CrossRefGoogle Scholar
  11. John M V, Parwez I, Sivaram M V S, Mehta S, Marwah N and Ali S 1996 Analysis of VNTR loci in fish genomes using synthetic oligodeoxyribonucleotide probes;Gene 172 191–197PubMedCrossRefGoogle Scholar
  12. John M V and Ali S 1997 Synthetic DNA based genetic markers reveal intra and inter-species DNA sequence variability in theBubalus bubalis and related genomes;DNA Cell Biol. 16 369–378PubMedCrossRefGoogle Scholar
  13. Kaemmer D, Afza R, Weising K, Kahl G and Novak F J 1992 Oligonucleotide and amplification fingerprinting of wild species and cultivars of Banana (Musa spp);Bio-Technol. 10 1030–1035Google Scholar
  14. Lorenz M, Partensky F, Borner T and Hess W R 1995 Sequencing of RAPD fragments amplified from the genome of the prokaryoteProchlorococcus marinas (Prochlorophyla);Biochem. Mol. Biol. Int. 36 705–713PubMedGoogle Scholar
  15. Meyer W, Mitchell T G, Freedman E Z and Vilgalys R 1993 Hybridization probes for conventional DNA fingerprinting used as single primer in the polymerase chain reaction to distinguish strains ofCryptococcus neoformans;J. Clin. Microbiol. 31 2274–2280PubMedGoogle Scholar
  16. Rafalski J A, Tingey S V and Williams J G K 1991 RAPD markers—a new technology for genetic mapping and plant breeding;Agric. Biotech. News Inform. 3 645–648Google Scholar
  17. Royle N J, Clarkson R E, Wong Z and Jeffreys A J 1988 Clustering of hypervariable minisatellite in the proterminal regions of human autosomes;Genomics 3 352–360PubMedCrossRefGoogle Scholar
  18. Singh L and Jones K W 1986Bkm sequences are polymorphic in humans and are clustered in pericentric regions of various acrocentric chromosomes including the Y;Hum. Genet. 73 304–308PubMedCrossRefGoogle Scholar
  19. Singh L, Purdom I F and Jones K W 1981 Conserved sex chromosome associated nucleotide sequences in eukaryotes;Cold Spring Harbor Symp. Quant. Biol. 45 805–813PubMedGoogle Scholar
  20. Sulaiman I M and Hasnain S E 1996 Random amplified polymorphic DNA (RAPD) markers reveal genetic homogeneity in the endangered Himalayan speciesMeconopsis paniculata andM. simplicifolia;Theor. Appl. Genet. 93 91–96CrossRefGoogle Scholar
  21. Walbot V 1988 Preparation of DNA from single rice seedlings;Rice Genet. News L5 149–151Google Scholar
  22. Wang G, Whittam T S, Berg C M and Berg D E 1993 RAPD Arbitrary Primer PCR is more sensitive than multilocus enzyme electrophoresis for distinguishing related bacterial strains;Nucleic Acids Res. 21 5930–5933PubMedCrossRefGoogle Scholar
  23. Welsh J and McClelland M 1990 Fingerprinting genomes using PCR with arbitrary primers;Nucleic Acids Res. 18 7213–7218PubMedCrossRefGoogle Scholar
  24. Welsh J and McClelland M 1991 Genomic fingerprinting using arbitrarily primed PCR and a matrix of pairwise combinations of primers;Nucleic Acids Res. 19 5275–5279PubMedCrossRefGoogle Scholar
  25. Williams J G, Kubelik A R, Livak K J, Rafalski J A and Tingey S V 1990 DNA polymorphisms amplified by arbitrary primers are useful as genetic markers;Nucleic Acids Res. 18 6531–6535PubMedCrossRefGoogle Scholar

Copyright information

© Indian Academy of Sciences 1999

Authors and Affiliations

  • Asim Azfer
    • 1
    • 2
  • Anu Bashamboo
    • 1
  • Nasser Ahmed
    • 1
    • 3
  • Sher Ali
    • 1
  1. 1.Molecular Genetics LaboratoryNational Institute of ImmunologyNew DelhiIndia
  2. 2.Department of ZoologyAligarh Muslim UniversityAligarhIndia
  3. 3.College of Veterinary ScienceAssam Agricultural UniversityGuwahatiIndia

Personalised recommendations