Abstract
The enzymatic amplification of genomic DNA with an arbitrary primer generates informative band profile useful for genome analysis. We used a set of synthetic oligodeoxyribonucleotide primers OAT15.2 (GACA)3.75, OAT18. 2 (GACA)4.5, OAT24.2 (GACA)6, OAT36 (GACA)9, comprising 4–9 consecutive units of GACA repeat, O33.15 (CACCTCTCCACCTGCC) and 033.6 (CCTCCAGCCCTCCTCCAGCCCT) for RAPD reactions of genomic DNA from different sources. The GACA based oligos of 15 and 18 base residues generated discernible genome specific amplicons whereas primers larger than 18 bases revealed smeary signals. The other oligos O33.15 and O33.6 also generated genome specific amplicons with more bands compared with those obtained from OAT15.2 or OAT18.2. The presence of OAT15.1 (GATA)3.75 and OAT15.2 (GACA)3.75 sequences in different genomes were ascertained by independent dot-blot hybridization prior to using them for RAPD reactions. The RAPD amplicons generated by evolutionarily conserved primer(s) or sequences shared by many species may be useful for clad identification in controversial systematics, comparative genome analysis, and for establishing the phylogenetic status of an organism.
This is a preview of subscription content, log in via an institution to check access.
Similar content being viewed by others
References
Afroze D, Misra M A, Sulaiman I M, Sinha S, Sarkar C, Mahapatra A K and Hasnain S E 1998 Genetic alteration in brain tumors identified by RAPD analysis;Gene 206 45–48
Ali S and Epplen J T 1991 DNA fingerprinting of eukaryotic genomes by synthetic oligonucleotide probes;Indian J. Biochem. Biophys. 28 1–9
Ali S, Gauri and Bala S 1993 Detection of genome specific monomorphic loci inBos taurus andBubalus bubalis with oligodeoxyribonucleotide probes;Anim. Genet. 24 199–202
Ali S, Ansari S, Ehtesham N Z, Azfer M A, Homkar U, Gopal R and Hasnain S E 1998 Analysis of the evolutionarily conserved repeat motifs in the genome of the highly endangered central Indian Swamp deerCervus duvauceli branderi;Gene 223 361–367
Ali S, Müller C R and Epplen J T 1986 DNA fingerprinting by oligonucleotide probes specific for simple repeats;Hum. Genet. 74 239–243
Dinesh K R, Lim R M. Chua K L, Chan W K and Phang V P 1993 RAPD analysis: An efficient method of DNA fingerprinting in fishes;Zool. Sci. 10 849–854
Epplen J T, McCarrey J R, Sutou S and Ohno S 1982 Base sequence of a cloned snake W chromosome DNA fragment and identification of a male-specific putative mRNA in the mouse;Proc. Natl. Acad. Sci. USA 79 3798–3802
Epplen J T 1988 On simple repetitive GATA/GACA sequences in animal genomes: a critical appraisal;J. Hered. 79 409–417
Hering O and Nirenberg H I 1995 Differentiation ofFusarium sambucinum, Fuckel sensulato and related species by RAPD-PCR;Mycopathology 129 159–164
Jeffreys A J, Wilson V and Thein S L 1985 Hypervariable minisatellite regions in human DNA;Nature (London) 314 67–73
John M V, Parwez I, Sivaram M V S, Mehta S, Marwah N and Ali S 1996 Analysis of VNTR loci in fish genomes using synthetic oligodeoxyribonucleotide probes;Gene 172 191–197
John M V and Ali S 1997 Synthetic DNA based genetic markers reveal intra and inter-species DNA sequence variability in theBubalus bubalis and related genomes;DNA Cell Biol. 16 369–378
Kaemmer D, Afza R, Weising K, Kahl G and Novak F J 1992 Oligonucleotide and amplification fingerprinting of wild species and cultivars of Banana (Musa spp);Bio-Technol. 10 1030–1035
Lorenz M, Partensky F, Borner T and Hess W R 1995 Sequencing of RAPD fragments amplified from the genome of the prokaryoteProchlorococcus marinas (Prochlorophyla);Biochem. Mol. Biol. Int. 36 705–713
Meyer W, Mitchell T G, Freedman E Z and Vilgalys R 1993 Hybridization probes for conventional DNA fingerprinting used as single primer in the polymerase chain reaction to distinguish strains ofCryptococcus neoformans;J. Clin. Microbiol. 31 2274–2280
Rafalski J A, Tingey S V and Williams J G K 1991 RAPD markers—a new technology for genetic mapping and plant breeding;Agric. Biotech. News Inform. 3 645–648
Royle N J, Clarkson R E, Wong Z and Jeffreys A J 1988 Clustering of hypervariable minisatellite in the proterminal regions of human autosomes;Genomics 3 352–360
Singh L and Jones K W 1986Bkm sequences are polymorphic in humans and are clustered in pericentric regions of various acrocentric chromosomes including the Y;Hum. Genet. 73 304–308
Singh L, Purdom I F and Jones K W 1981 Conserved sex chromosome associated nucleotide sequences in eukaryotes;Cold Spring Harbor Symp. Quant. Biol. 45 805–813
Sulaiman I M and Hasnain S E 1996 Random amplified polymorphic DNA (RAPD) markers reveal genetic homogeneity in the endangered Himalayan speciesMeconopsis paniculata andM. simplicifolia;Theor. Appl. Genet. 93 91–96
Walbot V 1988 Preparation of DNA from single rice seedlings;Rice Genet. News L5 149–151
Wang G, Whittam T S, Berg C M and Berg D E 1993 RAPD Arbitrary Primer PCR is more sensitive than multilocus enzyme electrophoresis for distinguishing related bacterial strains;Nucleic Acids Res. 21 5930–5933
Welsh J and McClelland M 1990 Fingerprinting genomes using PCR with arbitrary primers;Nucleic Acids Res. 18 7213–7218
Welsh J and McClelland M 1991 Genomic fingerprinting using arbitrarily primed PCR and a matrix of pairwise combinations of primers;Nucleic Acids Res. 19 5275–5279
Williams J G, Kubelik A R, Livak K J, Rafalski J A and Tingey S V 1990 DNA polymorphisms amplified by arbitrary primers are useful as genetic markers;Nucleic Acids Res. 18 6531–6535
Author information
Authors and Affiliations
Corresponding author
Rights and permissions
About this article
Cite this article
Azfer, A., Bashamboo, A., Ahmed, N. et al. Random amplification of polymorphic DNA with conserved sequences reveals genome-specific monomorphic amplicons: Implications in clad identification. J. Biosci. 24, 35–41 (1999). https://doi.org/10.1007/BF02941104
Received:
Accepted:
Published:
Issue Date:
DOI: https://doi.org/10.1007/BF02941104