Advertisement

Chemistry Africa

, Volume 2, Issue 2, pp 291–300 | Cite as

A Highly Sensitive Electrochemical Biosensor Based on Carbon Black and Gold Nanoparticles Modified Pencil Graphite Electrode for microRNA-21 Detection

  • Ghita Yammouri
  • Hasna Mohammadi
  • Aziz AmineEmail author
Original Article
  • 359 Downloads

Abstract

This work aims to develop cost-effective, simple and sensitive electrochemical biosensor for detection of microRNA-21. The combination of carbon black (CB) and gold nanoparticles (AuNPs) as nanohybrid was employed for the first time as a platform for microRNA-21 biosensor fabrication. The developed biosensor is based on the immobilization of thiolated capture probe (complementary sequence of microRNA-21) labeled with methylene blue on the surface of the pencil graphite electrode modified with CB/AuNPs nanohybrid. After hybridization with the target microRNA-21, the orientation of the labeled capture probe changed which causes a decrease of the response of methylene blue oxidation. Differential pulse voltammetry was used for monitoring the methylene blue response before and after hybridization. Under the optimal conditions, the developed biosensor was characterized using differential pulse voltammetry (DPV), cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). The detection of microRNA-21 was carried out using a DPV. A wide linear range was obtained between 2.9 fM and 0.7 µM of microRNA-21. The calculated limit of detection was 1 fM of microRNA-21. This approach shows a good reproducibility, stability and an excellent selectivity. The proposed biosensor was used for microRNA-21 analysis in serum and a satisfactory result was obtained.

Keywords

Carbon black Gold nanoparticles MicroRNA-21 Electrochemical biosensor Pencil graphite electrode Differential pulse voltammetry 

1 Introduction

Cancer biomarkers play an important role in the clinical management of cancer patients. Indeed, they allow to develop consistent, cost-effective, powerful methods of analysis and detection of cancer at an early stage.

Among the cancer biomarkers, microRNAs are considered an adequate target for the earlier cancer detection [1]. MicroRNAs, a large class of small non-coding RNA, present in body fluids [2]. They show a significant role in embryonic development, proliferation and apoptosis [3]. MicroRNAs are characteristically stable, show good response under several treatments including extreme temperature, long-term storage, and extreme pH or boiling [4]. MicroRNA-21 is one of the most frequent microRNA in human cells, which was investigated in various kind of cancer diseases [5, 6, 7]. Numerous studies have been focused on microRNA-21 overexpression in the case of cancer [8]. Consequently, microRNA-21 attracts much attention on the development of fast and simple methods for its determination.

Several methods have been generally applied for the quantification of microRNAs, such as northern blot [9], real- time polymerase chain reaction [10] and microarrays [11]. Nevertheless, they present some disadvantages, including high cost, time-consuming, requirement of a qualified personnel and sophisticated instrumentation. In comparison, with the mentioned methods, the electrochemical techniques for microRNA detection are simple, cheap, and sensitive. Furthermore, the time of response is short and minimal sample preparation is needed [12].

A serious challenge is involved with microRNA detection in view of their small size and low amount [13]. It has been described that microRNA-21 concentration in patient serum, with gastric cancer was about 1.1 pM [6]. Additionally, the microRNA-21 concentration in patient-derived tissue samples for esophageal squamous-cell carcinoma was 0.1 pM [7]. For sensitive electrochemical detection of microRNAs, various amplification techniques have been employed, namely rolling circle amplification [14], hybridization chain reaction [15] and catalytic hairpin assembly [16]. The mentioned amplification methods can considerably enhance the detection sensitivity, but suffer from some disadvantage because they are complicated, require expensive reagents and several steps of preparation [16]. Other approaches employed for the amplification of microRNA detection are centered on the use of nanomaterials [17, 18], for the reason that they permit a simple and sensitive detection, offer a high surface area at the surface of electrode and allow a signal amplification [13, 19]. Various kinds of nanomaterials were used as a platform for the detection of microRNA including carbon black (CB) [20] and AuNPs [21], which offers many advantages. AuNPs possess good conductivity, high biocompatibility and they can easily immobilize the thiolated bio-elements by the strong Au–S bond [22]. Furthermore, there are a large application of gold nanomaterial in different field [23, 24, 25]. In other hand, carbon black is amorphous nanomaterial, offers a high conductivity and has been considered recently as the most cost-effective modifier for improving the analytical performances of sensors [26].

As a proof-of-concept, we report for the first time a CB/AuNPs nanohybrid designed for an electrochemical sensitive detection of microRNA-21. The CB and AuNPs were selected owing to the above-mentioned advantages. Furthermore, they allow more capture probe immobilization at the electrode surface. Pencil graphite electrodes were modified with CB/AuNPs nanohybrid for single use measurement. The electrochemical measurement is based on the evaluation of the oxidation response of MB (methylene blue) labeled capture probe in the absence and in the presence of microRNA target. This response decreases after hybridization due to the change of the MB labeled capture probe orientation. The developed biosensor shows a good microRNA analysis in serum sample.

2 Experimental

2.1 Reagents

Chloroauric acid (HAuCl4) and 3-mercaptopropionic acid were obtained from Sigma-Aldrich (Saint Louis, USA). 6-mercapto-1-hexanol (MCH) was obtained from Sigma-Aldrich (Steinheim, Germany). 2-mercaptoethanesulfonic acid and cysteamine were purchased from Sigma-Aldrich (Buchs, Switzerland), Sodium chloride (NaCl), and acetic acid were purchased from Solvachim (Casablanca, Morocco). Sulfuric Acid (H2SO4), potassium nitrate (KNO3) and Tris-Hydrochloride (Tris–HCl) and Magnesium chloride (MgCl2) were obtained from Loba Chemie (Mumbai, India). Carbon black (CB) N220 (32 nm) of commercial grade was obtained from Cabot Corporation (Ravenna, Italy). Ethylenediaminetetraacetic (EDTA) was obtained from Acros Organics (Geel, Belgium). Dimethylformamide (DMF) was purchased from VMW International (Roquemaure, France). Methylene Blue (MB) was obtained from Breckland scientific supplies (Norfolk, United Kingdom).

The lyophilized oligonucleotides were bought from the Eurofins Genomics (The Ulis, France). The employed sequences are mentioned in Table 1.
Table 1

The sequences of the used oligonucleotides

Oligonucleotide name

Sequence (5′–3′)

Capture probe: (complementary sequence of microRNA-21)

SH-AAATCAACATCAGTCTGATAAGCTATTT –T (MB)

MicroRNA-21 target

UAGCUUAUCAGACUGAUGUUGA

Three base mismatch

UUGCUUAUCGGACUGAUCUUGA

microRNA-125a (Non-complementary sequence)

UCCCUGAGACCCUUUAACCUGUGA

The oligonucleotides stock solutions (Probe capture: 978.74 µg/mL; Target: 700.4 µg/mL; Non-complementary sequence microRNA-125a: 754.99 µg/mL; Three base mismatch: 695.7 µg/mL) were prepared with ultrapure water and stored at − 20 °C until use. The buffer solutions used were as follows: 10 mM Tris–HCl (pH: 7.4) containing 0.1 M NaCl and 1 mM EDTA was used for the immobilization of the capture probe. 10 mM Tris–HCl (pH: 7.4), containing 1 M of NaCl was used as hybridization buffer. The washing buffer used after each biosensor modification step was 20 mM Tris–HCl, including 0.1 M NaCl and 5 mM MgCl2 (pH: 7.4). Measurement buffer was 20 mM Tris–HCl (pH 7.4).

2.2 Apparatus

The electrochemical measurements were realized using PalmSens, connected with a laptop and controlled with PSTrace 4.6 software. OriginPro8 and GraphPad Prism5 were used as software for data analysis. Three electrodes were used, Ag/AgCl as a reference electrode, stainless steel bar as an auxiliary electrode and Bic pencil (size: 0.5) was employed as the holder for the graphite mines (Faber-Castell model 0.5 mm) which was used as working electrode named Pencil Graphite Electrode (PGE). Electrical contact with the lead was obtained by welding a metal wire to the metallic belt. The pencil lead was retained vertically with 1.5 cm of the lead protruding outside (0.7 cm, was submerged in the solution). The PGE was dipped in a fixed volume of solutions, which was 3.5 mL for all experiments.

2.3 Procedure of Biosensor Fabrication for microRNA-21 Detection

The PGEs were pre-treated in acetate buffer solution (20 mM, pH 4.8) including 20 mM NaCl at + 1.4 V for 1 min, as previously reported [20]. Pretreated electrodes were incubated in 1 mg/mL CB dispersion for 1 h and kept drying for 20 min to obtain PGEs/CB, the CB dispersion was prepared by sonication of 10 mg of CB in 10 mL of DMF for 1 h. Then, AuNPs were electrochemically deposited on PGEs/CB surface from aqueous solution containing 2 mM of HAuCl4 and 0.1 M of KNO3 using CV between + 0.9 and − 0.3 V at scan rate of 50 mV s−1, as described in [21], in order to obtain PGE/CB/AuNPs. Thereafter a conditioning of the PGEs/CB/AuNPs by CV between + 0.2 and + 1.6 V in a 0.5 M H2SO4 solution was realized until a stable voltammogram was obtained, and then the electrodes were washed with ultra-pure water. The immobilization of the capture probe at the surface of PGEs/CB/AuNPs were then realized. For that, PGEs/CB/AuNPs were immersed in 100 μL of 0.3 µM capture probe solution for overnight at 4 °C, these electrodes named as PGEs/CB/AuNPs/P, were washed with washing buffer. The prepared PGEs/CB/AuNPs/P were incubated in 100 µL of 1 mM of MCH (prepared in 1 M NaCl and 10 mM potassium phosphate buffer, pH 7.0) for 2 h at 4 °C, to get well-aligned capture probe and to eliminate nonspecific binding. These electrodes named as PGEs/CB/AuNPs/P/MCH were washed again with washing buffer. The PGEs/CB/AuNPs/P/MCH were dipped in 100 µL of different concentration of microRNA-21 target solutions (from 2.9 fM to 0.7 μM) for 30 min at room temperature. These electrodes named as PGEs/CB/AuNPs/P/MCH/T.

2.4 Electrochemical methods

Differential pulse voltammetry (DPV), cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS) were the electrochemical methods involved in this work. DPV was performed by applying a sweep potential from − 0.5 to − 0.2 V at a scan rate of 5 mV/s in Tris–HCl buffer (20 mM, pH 7.4). The CV measurements were conducted at a potential range of −0.15 V and + 0.65 V with a scan rate of 50 mV/s in 5 mM [Fe (CN)6]3−/4− including 0.1 M KCl. EIS was accomplished in 5 mM [Fe (CN)6]3−/4− and 0.1 M KCl at the applied potential of + 0.24 V in the frequency range of 0.1 Hz and 50 kHz. EIS results were fitted to a Randles indented as equivalent circuit. The components of Randles circuit values were determined by the use of EC-Lab software. The circuit was composed of the resistance of the solution (R1), the Constant Phase Element (Q1), the charge transfer resistance (R2) and the Warburg element (W2).

3 Results and Discussions

The fundamentals of the developed method are presented in Fig. 1. In brief, it involves a DNA probe capture labeled with MB and target microRNA hybridization assay using disposable PGE/CB/AuNPs. In a first step, a thiolated capture probe, was self-assembled onto PGE/CB/AuNPs. Thereafter, MCH was employed to avoid nonspecific adsorption. After hybridization step, we obtained microRNA-21 biosensor. The oxidation response of MB present in capture probe was measured in the absence and presence of microRNA-21 using a DPV.
Fig. 1

Schematic illustration of the electrochemical microRNA-21 nanohybrid biosensor based on the oxidation of MB labeled thiolated capture probe

3.1 Electrochemical Characterization of the Developed Electrochemical Biosensor

3.1.1 Cyclic Voltammetry and Electrochemical Impedance Spectroscopy Measurements

CV and EIS were accomplished in 5 mM [Fe (CN)6]3−/4− including 0.1 M of KCl for the electrochemical characterization of each electrode involved in the developing biosensor for microRNA-21 detection. In CV results, the obtained cyclic voltamograms are presented in Fig. 2a, b. Figure 2a shows a bare PGE (curve a′), which exhibits a couple of redox peaks. After modification of PGE with CB (curve b′), AuNPs (curve c′) and CB/AuNPs nanohybrid modified PGE (curve d′), an increase in current response was observed by 30, 33 and 50%, respectively, compared with the current response of bare PGE. The highest increase in current response was obtained using PGE/CB/AuNPs, thanks to their excellent electrocatalytic activity, the large specific surface area and the high synergistic activity effect of CB and AuNPs. Therefore, the employment of CB/AuNPs nanohybrid as a platform of microRNA-21 biosensor could increase the specific surface for assembling more thiolated capture probe in gold surface. The Iox (oxidation current) and Ired (reduction current) values obtained with PGE/CB/AuNPs were + 262 and − 254 μA, respectively. As shown in the Fig. 2b after immobilization of thiolated capture probes at PGE/CB/AuNPs by Au–S bond [22] (curve e’), a decrease of current responses corresponding to Iox = + 244 µA and Ired = − 222 µA were observed. This decrease could be attributed to the negatively charged orthophosphate backbone of the capture probe that produces an electrostatic repulsive force to the negatively charged [Fe (CN)6]3−/4−. This also a proof of the immobilization of thiolated capture probe at PGE/CB/AuNPs. The current response, decreases obviously after reacting of PGE/CB/AuNPs with non-conductive MCH (curve f′), which was attributed to the MCH that could block the electron transfer. After hybridization (curve g′), additional decreasing of the current response was observed. This response decrease is caused by the electrostatic repulsive-force between the phosphate skeleton of duplex capture probe DNA-RNA structure and the redox couple of [Fe(CN)6]3−/4−.
Fig. 2

CV (a, b) and EIS (c, d) in 5 mM [Fe(CN)6]3−/4− containing 0.1 M KCl at bare PGE (a′), PGE/CB (b′), PGE/AuNPs, (c′), PGE/CB/AuNPs (d′), PGE/CB/AuNPs after immobilization of 0.3 µM capture probe (e′), PGE/CB/AuNPs/P after reacting with 1 mM of MCH (f′), PGE/CB/AuNPs/P/MCH after hybridization with 1.4 µM of microRNA-21 (g′)

The EIS is based on the change of the Nyquist plot semicircle diameter varied upon the assembly and binding processes after each electrode modification. From the EIS results (Fig. 2c, d), a small diameter of the semicircle was observed after modification of PGE with CB and AuNPs (curve d′) compared to bare PGE (curve a′), because of the high conductivity of CB and AuNPs. Furthermore, the diameter of a Nyquist plot semicircle increased after immobilization of capture probe (curve g′), due to hindering electron transfer. When MCH (curve f′) was added into the electrode, the diameter of a Nyquist plot semicircle value obviously increases. After hybridization step with microRNA-21 (curve g′), the diameter of a Nyquist plot semicircle further increases, on the account of negative charges from the capture probe and the microRNA-21, which repulsed the negatively charged [Fe(CN)6]3−/4− and hindered the electron transfer.

The charge transfer resistance (Rct) values corresponding to the diameter of a Nyquist plot semicircle obtained at different steps of biosensor construction are summarized in Table 2. From this characterization experiments, it appears clearly that the results obtained using CV were in agreement with the EIS measurements. Both characterization results CV and EIS suggested the successful construction of the biosensor.
Table 2

The Rct values obtained at different steps of biosensor construction

Electrodes

Rct (Ohm)

PGE

53

PGE/CB

43

PGE/AuNPs

35

PGE/CB/AuNPs

8

PGE/CB/AuNPs/P

79

PGE/CB/AuNPs/P/MCH

90

PGE/CB/AuNPs/P/MCH/T

135

PGE pencil graphite electrode, AuNPs gold nanoparticles, CB carbon black, P probe capture, MCH 6-mercapto-1-hexanol, T Target microRNA-21

3.1.2 Differential Pulse Voltammetry Measurements

DPV was used for electrode characterization after probe immobilization and microRNA-21 hybridization step. Therefore, the oxidation response of MB was measured before and after hybridization. Consequently, the change of MB oxidation response after hybridization shows the achievement of microRNA-21 hybridization. Figure 3 shows a typical DPV of PGE/CB/AuNPs/P/MCH before (curve a) and after hybridization with 29 nM (curve b) of microRNA-21 concentration. After hybridization the response of the current decreased by 63%. Hybridization between the capture probe and microRNA-21 target leads to the change of capture probe labeled MB orientation. This change of orientation may make the MB more difficult to be electro-oxidized [27], consequently a decrease on the MB oxidation response. The DPV results, confirm the effective construction of the biosensor.
Fig. 3

Typical DPV curves of the PGE/CB/AuNPs/MCH obtained before (a) and after hybridization with 29 nM (b) of microRNA-21. Electrolyte: Tris–HCl (pH 7.4); The concentrations of the capture probe was 0.7 µM

3.2 Optimization of the Electroanalytical Procedure for microRNA-21 Detection

3.2.1 The Effect of the Concentration and Scan Number on Electrodeposition of HAuCl4

The AuNPs have been chosen in this work to for the modification of PGE/CB to obtain a large gold surface for the immobilization of thiolated capture probe. The effect of HAuCl4 concentrations on the electron transfer capacity has been studied at PGEs/CB using CV of 5 mM [Fe(CN)6]3−/4− solution containing 0.1 M of KCl. Different HAuCl4 concentrations (0, 0.1, 1, 2, 3, 4 mM) were tested. Figure S1a shows that the highest oxidation current (Iox) was obtained with PGE/CB/AuNPs obtained using 2 mM of HAuCl4 (246 µA) in comparison with PGE/CB (180 µA). The increase of the Iox is attributed to the high conductivity of CB/AuNPs nanohybrid due to the acceleration of electron transfer. Furthermore, this current enhancement is related to the increase of the effective surface area that allow to assemble more capture probe. In this study, 2 mM was selected as the optimum concentration of HAuCl4 for further experiments.

After that, the effect of scan number of AuNPs electrodeposition in the presence of 2 mM of HAuCl4 was investigated using cyclic voltammetry of 5 mM [Fe (CN)6]3−/4− solution containing 0.1 M of KCl on the electron transfer (Fig. S1b). Various scan numbers of AuNPs deposition were tested (2–14 scans). The highest Iox value was obtained with six scans measured as 246 µA. In this work, six scans were chosen as an optimal scan number for next experiments (Fig. 4).
Fig. 4

DPV curves of 6 µM MB oxidation response obtained using PGE (a), PGE/CB (b), PGE/AuNPs (c), PGE/CB/AuNPs (d). DPV measurement in Tris–HCl (pH 7.4)

3.2.2 Comparison Study Between CB, AuNPs and CB/AuNPs Nanohybrid Platforms Toward Methylene Blue Oxidation

The preliminary experiments have been accomplished using the electrochemical oxidation of 6 µM MB in solution by DPV. The results of unmodified PGE, modified PGE with CB, modified PGE with AuNPs and modified PGE with CB/AuNPs nanohybrid are presented in Fig. 5. The MB oxidation response was increased about 3, 4 and 5 times using PGE/CB, PGE/AuNPs, and PGE/CB/AuNPs respectively, in comparison with the response of unmodified PGE. The highest MB oxidation response was obtained using PGE/CB/AuNPs, owing to an increase of the specific surface area of the electrode after modification and the synergistic activity of AuNPs and CB for MB determination. From this result, we conclude that the presence of CB/AuNPs nanohybrid as a platform of biosensor increases the electrochemical response of MB.
Fig. 5

a Histograms of average current response value (n = 3) representing the capture probe concentrations effect (from 0.1 to 0.9 µM) in the presence of 1.4 µM microRNA-21 concentration. b Histograms of average current responses value (n = 3) representing the time hybridization effect (from 15 to 60 min) in the presence of 1.4 µM microRNA-21 concentration. The concentrations of the capture probe was 0.3 µM. The current response correspond to Iox. CV measurement in 5 mM [Fe(CN)6]3−/4− containing 0.1 M KCl. c Histograms of average current response value (n = 3) representing the effect of different co-adsorbate (MCH, CYS, MPP and MES) before (a′) and after hybridization with 0.7 µM microRNA-21 (b′). The concentration of the capture probe was 0.3 µM. The current responses correspond to methylene blue oxidation present in the capture probe. DPV measurement in Tris–HCl (pH 7.4)

3.2.3 Optimization of the microRNA-21 Detection

The microRNA-21 detection is performed using the thiol terminated capture probe immobilized on PGE/CB/AuNPs. Capture probe concentration (Fig. 5a) and hybridization time effect (Fig. 5b) were investigated using CV of 5 mM [Fe(CN)6]3−/4− in 0.1 M of KCl, to obtain the best condition to have a full coverage of the PGE/CB/AuNPs surface with capture probe. To study the effect of probe capture concentration, the PGEs/CB/AuNPs were incubated overnight at 4 °C in 100 µL with different capture probe concentrations ranging from 0.1 to 1.1 µM, then after the PGEs/CB/AuNPs/P, were dipped in 100 µL of MCH for 2 h at 4 °C. After that, the hybridization was achieved in the presence of 1.4 µM microRNA-21 target. The Iox of different electrodes were measured before and after hybridization. A significant decrease in Iox (204 µA) using 0.3 µM of capture probe was observed after hybridization, compared to 230 µA obtained with PGE/CB/AuNPs/P/MCH before hybridization step. The observed decrease in the current response could be attributed to the presence of duplex capture probe DNA-RNA structure, which causes a decrease in repulsive interaction between [Fe (CN)6]3−/4− and the surface of the electrode. From CV results, 0.3 µM was used as the optimal capture probe concentration.

In order to investigate the effect of hybridization time, the PGE/CB/AuNPs/P/MCH were incubated in 100 µL of 1.4 µM microRNA-21 target for different time from 15 to 60 min to achieve the hybridization. A significant decrease of Iox (204 µA) was obtained after 30 min, compared to 230 µA obtained with PGE/CB/AuNPs/P/MCH before hybridization. From CV results, 30 min were selected as an optimal time of hybridization.

Co-adsorbate are necessary to achieve proper function of PGE/CB/AuNPs/P. Their absence could significantly degrade the reproducibility of the biosensor, leading to an extremely variable biosensor, caused by poor organization of the capture probe on the electrode surface [21]. To evaluate the performance of the developed biosensor against co-adsorbate, different thiolated co- adsorbents were tested, such as 6-Mercapto-1-hexanol (MCH), 3-Mercaptopropionic acid (MPP), cysteamine (CYS) and 2-Mercaptoethanesulfonic acid (MES).

PGEs/CB/AuNPs/P were incubated with the mentioned co-adsorbate for 2 h at 4 °C, thereafter the electrodes were immersed in 100 µL of 0.7 µM of microRNA target. Figure 5c shows the current of MB oxidation response obtained before and after hybridization using a DPV. A decrease in MB oxidation response by 69, 18, 11 and 2% was observed after hybridization using MCH, CYS, MES and MPP, respectively. This decrease can be due to the length of the co-adsorbent. The significant response related to the decreasing in oxidation signal was observed using the longer thiolated MCH co-adsorbent. Additionally, using a shorter thiolated MPP, MES and CYS co-adsorbents, a very low response related to the decreasing of the current was observed. This decreasing can be attributed to the fact that, the capture probe is flexible enough to transfer electrons to the electrode whether or not it is hybridized. However, it has been shown that short thiols co-adsorbent have defective monolayers, allowing electrochemistry to be performed directly on the surface of the electrode. Indeed, as a consequence an electron transfer in the case of the hybrid probe and also non-hybrid probe [28]. From this result, MCH was selected as the appropriate co-adsorbate.

3.3 Analytical Performance of the Biosensor Towards microRNA-21 Detection

Since the experimental conditions were optimized, the present biosensor can be used to detect microRNA-21 at different concentrations. The calibration curve (Fig. 6) was plotted in function of ΔI value (change of current response of MB oxidation before and after hybridization) versus the logarithm of microRNA-21 concentration to get a good linear fitting. Indeed, the direct relation between ΔI value and concentration is not linear within the whole range studied 2.9 fM to 0.7 µM.
Fig. 6

Calibration curve of ΔI value of current response (n = 3) as a function of different microRNA target concentrations (from 2.9 fM to 0.7 μM). The concentration of the capture probe was 0.3 µM. ΔI: change of current response of MB oxidation before and after hybridization. DPV measurement in Tris–HCl (pH 7.4)

DPV revealed the variations of the electrochemical oxidation of MB. Increasing of ΔI is proportional to decreasing current of MB oxidation response after hybridization. Noting that, the MB response decreases in function of increasing concentration of the target microRNA-21. The linear range was from 2.9 fM to 0.7 µM following the equation ΔI (µA) = 0.07 Log [microRNA-21] (mol.L−1) + 1.21 with a correlation coefficient of 0.998, and the limit of detection (LOD) (corresponding to 3 times the standard deviation of the blank) was 1 fM.

The developed biosensor in this work investigate the oxidation of MB used as the chemical labeled of the probe capture. Table 3 showed a comparison of our work with previously reported chemical labeled probe methods. Indeed, our biosensor had a low limit of detection, wide linear range with a simple nanohybrid platform used for improving MB response. Nothing that the high sensitivity of the developed biosensor is mostly attributed to the synergistic effect of CB/AuNPs nanohybrid. Furthermore, the proposed method requires only one-step of the sequence probe hybridization compared to complicated method, which uses several probes hybridization steps. In this method, star trigon structure and endonuclease for MB labeled probe capture oxidation were used as amplification system for microRNA detection [29]. Moreover, compared with another method based also on MB oxidation, using other nanomaterial as a platform of biosensor, the proposed method shows good sensitivity [30]. Furthermore, it is also simple and sensitive compared with others method based on the oxidation of ferrocene as labeled capture probe for microRNA detection [31, 32].
Table 3

Comparison of the developed methods with others one based on the chemical labeled probe

Biosensors platforms

Labeling probe

Detection methods

microRNA type

Concentration range

LOD

References

AuNPs/HA/Popd/CoO/GCE

MB

SWV

microRNA-24

0.1 pM to 0.1 μM

33.3 fM

[30]

ITOE/PET

Fc

DPV

microRNA-21

10 nM to 50 μM

5 nM

[31]

GDE/AuNPs

Fc

DPV

microRNA

0.1 nM to 1 µM

10 pM

[32]

PGE/CB/AuNPs

MB

DPV

microRNA-21

2.9 fM to 0.7 µM

1 fM

This work

AuNPs gold nanoparticles, HA hyaluronic acid, Popd poly(o-phenylenediamine), CoO cobalt oxide, CGE glassy carbon electrode, Fc ferrocene, MB metylene blue, DPV differential pulse voltammetry, SWV square wave voltammetry, ITOE indium tin oxide electrode, PET polyethlene terephthalate, GDE Gold Disk electrode, PGE pencil graphite electrode, CB carbon black

3.4 Selectivity, Reproducibility and Stability Analysis of microRNA-21 Biosensor

The selectivity study of the developed biosensor was performed in the occurrence of complementary sequence (microRNA-21) (a), three-base mismatch sequence (b) and non-complementary sequence (microRNA-125a) (c). Figure 7a presents the change of the current (ΔI) between capture probe response and the obtained response after hybridization using different tested sequences. A significant ΔI was obtained using complementary sequence comparing with non-complementary and three-base mismatch sequences. According to this result, the developed biosensor shows a good selectivity for microRNA-21 detection.
Fig. 7

a ΔI value of current response (n = 3) obtained using PGE/CB/AuNPs/MCH/P in the presence of microRNA-21 complementary (a′), three-based mismatch (b′) and microRNA-125a non-complementary (c′) sequences. The concentration of microRNAs and three-based mismatch sequences was 28.5 nM. The concentration of capture probe was 0.3 µM. b the long-term storage stability of the biosensor detection of microRNA-21 (1 pM) in Tris–HCl buffer

The developed biosensor reproducibility was studied using two concentrations of microRNA-21 using three parallel PGE/CB/AuNP modified with 0.3 μM of probe and MCH. At a small concentration of microRNA-21 (29 nM) the relative standard deviation (RSD) (n = 3) was equal to 3% and at high concentration (0.7 µM) the RSD was equal to 13%, showing that the biosensors has a satisfactory reproducibility for microRNA-21 detection.

The long-term storage stability of the proposed biosensor was tested by storing of PGE/CB/AuNP/P/MCH at 4 °C during a period of 5 weeks (Fig. 7b). The concentration of probe DNA was equal to 0.3 µM. Figure 7b shows the percentage of response corresponding to the calculated ΔI before and after hybridization with 1 pM of microRNA-21 biosensors response, according to the time with a variation of response average of 97 ± 20%. For each response the measurement was repeated 3 times (error bare is presented in the figure). The results show that the biosensor response decreased slightly with time and it retained 93% of its initial one after 5 weeks, indicating the good stability of the developed biosensor for microRNA-21 detection.

In the present work the use of PGE as commercially available, disposable. Furthermore, PGE allows to prepare simultaneously several methylene blue labeled capture probes modified electrodes within a reasonable time. These capture probes electrodes are ready to use for the next experiments, exhibiting a long lifetime (more than 5 weeks). Thus, there is no need of additional treatment for the regeneration by de-hybridization step, which requires the use of high temperature for biosensor regeneration.

3.5 Analysis of microRNA-21 in Serum Sample

The analysis of microRNA-21 was performed in diluted serum (50 times) without and with the addition of 1 pM and 29 nM of microRNA-21. Figure 2S showed the histograms of average of current response corresponding to MB oxidation obtained with (a) 0, (b) 1 pM, (c) 29 nM of microRNA-21 spiked serum. The experiment results showed that they are a decreasing of PGE/CB/AuNP/P labeled MB current response after fortification of serum with 1 pM and 29 nM of microRNA-21 indicate that the hybridization was achieved. The calculated recovery was respectively equal to 98% and 81%, suggesting that the biosensor possessed an acceptable detection performance in serum.

4 Conclusions

As a proof-of-concept, we developed an electrochemical biosensor for microRNA-21 detection based on CB/AuNPs nanohybrid as a novel sensing platform. This strategy has some excellent features. First, the large effective surface area of CB/AuNPs allow loading a large amounts of capture probe. Second, the synergistic activity of AuNPs and CB improve the electrochemical response of MB labeled capture probe (complementary sequence of microRNA-21). Furthermore, the developed biosensor showed an excellent analytical performance in terms of selectivity, reproducibility, stability and sensitivity permitting to achieve a low detection limit (1 fM). Thus, this biosensor exhibits a promising potential for detection of microRNA in clinical applications.

Notes

Acknowledgements

This work was supported by the “Fondation Lalla Salma-Prévention et Traitement du Cancer” under the Project AP2013; and the Islamic Educational, Scientific and Cultural Organization under the Project No. 3.8.2.1.1/3:ICPSR/2015.

Compliance with Ethical Standards

Conflict of Interest

On behalf of all authors, the corresponding author states that there is no conflict of interest.

Supplementary material

42250_2019_58_MOESM1_ESM.docx (408 kb)
Supplementary material 1 (DOCX 407 kb)

References

  1. 1.
    Wang H, Peng R, Wang J, Qin Z, Xue L (2018) Circulating microRNAs as potential cancer biomarkers: the advantage and disadvantage. Clin Epigenetics 10:59CrossRefGoogle Scholar
  2. 2.
    He L, Erratum Hannon GJ (2004) MicroRNAs: small RNAs with a big role in gene regulation. Nat Rev Genet 5:522–531CrossRefGoogle Scholar
  3. 3.
    Hwang H-W, Mendell JT (2006) MicroRNAs in cell proliferation, cell death and tumorigenesis. Br J Cancer 94:776–780CrossRefGoogle Scholar
  4. 4.
    Tavallaie R, De Almeida SRM, Gooding JJ (2015) Toward biosensors for the detection of circulating microRNA as a cancer biomarker: an overview of the challenges and successes: toward biosensors for the detection of circulating microRNA. Wiley Interdiscip Rev Nanomed Nanobiotechnol 7:580–592CrossRefGoogle Scholar
  5. 5.
    Wu K, Li L, Li S (2015) Circulating microRNA-21 as a biomarker for the detection of various carcinomas: an updated meta-analysis based on 36 studies. Tumor Biol 36:1973–1981CrossRefGoogle Scholar
  6. 6.
    Li B, Liu F, Peng Y, Zhou Y, Fan W, Yin H, Ai S, Zhang X (2016) Two-stage cyclic enzymatic amplification method for ultrasensitive electrochemical assay of microRNA-21 in the blood serum of gastric cancer patients. Biosens Bioelectron 79:307–312CrossRefGoogle Scholar
  7. 7.
    Kamal Masud M, Islam MN, Haque MH, Tanaka S, Gopalan V, Alici. Nguyen GNT, Lam AK, Hossain MSA, Yamauchi Y, Shiddiky MJA (2017) Gold-loaded nanoporous superparamagnetic nanocubes for catalytic signal amplification in detecting miRNA. Chem Commun 53:8231–4Google Scholar
  8. 8.
    Alder H, Taccioli C, Chen H, Jiang Y, Smalley KJ, Fadda P, Ozer HG, Huebner K, Farber JL, Croce CM, Fong LY (2012) Dysregulation of miR-31 and miR-21 induced by zinc deficiency promotes esophageal cancer. Carcinogenesis 33:1736–1744CrossRefGoogle Scholar
  9. 9.
    Ding L, Liu H, Zhang L, Li L, Yu J (2018) Label-free detection of microRNA based on the fluorescence quenching of silicon nanoparticles induced by catalyzed hairpin assembly coupled with hybridization chain reaction. Sens Actuators B Chem 254:370–376CrossRefGoogle Scholar
  10. 10.
    Jung S, Kim BK, Lee S, Yoon S, Im H-I, Kim SK (2018) Multiplexed on-chip real-time PCR using hydrogel spot array for microRNA profiling of minimal tissue samples. Sens Actuators B Chem 262:118–124CrossRefGoogle Scholar
  11. 11.
    Clancy E, Burke M, Arabkari V, Barry T, Kelly H, Dwyer RM, Kerin MJ, Smith TJ (2017) Amplification-free detection of microRNAs via a rapid microarray-based sandwich assay. Anal Bioanal Chem 409:3497–3505CrossRefGoogle Scholar
  12. 12.
    Kilic T, Erdem A, Ozsoz M, Carrara S (2018) microRNA biosensors: opportunities and challenges among conventional and commercially available techniques. Biosens Bioelectron 99:525–546CrossRefGoogle Scholar
  13. 13.
    Ciui B, Jambrec D, Sandulescu R, Cristea C (2017) Bioelectrochemistry for miRNA detection. Curr Opin Electrochem 5:183–192CrossRefGoogle Scholar
  14. 14.
    Yu N, Wang Z, Wang C, Han J, Bu H (2017) Combining padlock exponential rolling circle amplification with CoFe2O4 magnetic nanoparticles for microRNA detection by nanoelectrocatalysis without a substrate. Anal Chim Acta 962:24–31CrossRefGoogle Scholar
  15. 15.
    Yuan Y-H, Wu Y-D, Chi B-Z, Wen S-H, Liang R-P, Qiu J-D (2017) Simultaneously electrochemical detection of microRNAs based on multifunctional magnetic nanoparticles probe coupling with hybridization chain reaction. Biosens Bioelectron 97:325–331CrossRefGoogle Scholar
  16. 16.
    Zhang Y, Yan Y, Chen W, Cheng W, Li S, Ding X, Li D, Wang H, Ju H, Ding S (2015) A simple electrochemical biosensor for highly sensitive and specific detection of microRNA based on mismatched catalytic hairpin assembly. Biosens Bioelectron 68:343–349CrossRefGoogle Scholar
  17. 17.
    Asadzadeh-Firouzabadi A, Zare HR (2018) Preparation and application of AgNPs/SWCNTs nanohybrid as an electroactive label for sensitive detection of miRNA related to lung cancer. Sens Actuators B Chem 260:824–831CrossRefGoogle Scholar
  18. 18.
    Zhu D, Liu W, Zhao D, Hao Q, Li J, Huang J, Shi J, Chao J, Su S, Wang L (2017) Label-free electrochemical sensing platform for MicroRNA-21 detection using thionine and gold nanoparticles co-functionalized MoS 2 nanosheet. ACS Appl Mater Interfaces 9:35597–35603CrossRefGoogle Scholar
  19. 19.
    Wu L, Xiong E, Zhang X, Zhang X, Chen J (2014) Nanomaterials as signal amplification elements in DNA-based electrochemical sensing. Nano Today 9:197–211CrossRefGoogle Scholar
  20. 20.
    Yammouri G, Mandli J, Mohammadi H, Amine A (2017) Development of an electrochemical label-free biosensor for microRNA-125a detection using pencil graphite electrode modified with different carbon nanomaterials. J Electroanal Chem 806:75–81CrossRefGoogle Scholar
  21. 21.
    Mandli J, Mohammadi H, Amine A (2017) Electrochemical DNA sandwich biosensor based on enzyme amplified microRNA-21 detection and gold nanoparticles. Bioelectrochemistry 116:17–23CrossRefGoogle Scholar
  22. 22.
    Suzuki K, Hosokawa K, Maeda M (2009) Controlling the number and positions of oligonucleotides on gold nanoparticle surfaces. J Am Chem Soc 131:7518–7519CrossRefGoogle Scholar
  23. 23.
    Wang X, Li Z, Lai J, Tang X, Qiu P (2018) Sensitive and highly selective biosensor based on triangular Au nanoplates for detection of uric acid in human serum. Chem Afr 1:29–35CrossRefGoogle Scholar
  24. 24.
    Yang Y, Lu L, Tian X, Li Y, Yang C, Nie Y, Zhou Z (2019) Ratiometric fluorescence detection of mercuric ions by sole intrinsic dual-emitting gold nanoclusters. Sens Actuators B Chem 278:82–87CrossRefGoogle Scholar
  25. 25.
    Akyüz E, Şen FB, Bener M, Başkan KS, Tütem E, Apak R (2019) Protein-protected gold nanocluster-based biosensor for determining the prooxidant activity of natural antioxidant compounds. ACS Omega 4:2455–2462CrossRefGoogle Scholar
  26. 26.
    Cinti S, Arduini F, Carbone M, Sansone L, Cacciotti I, Moscone D, Palleschi G (2015) Screen-printed electrodes modified with carbon nanomaterials: a comparison among carbon black, carbon nanotubes and graphene. Electroanalysis 27:2230–2238CrossRefGoogle Scholar
  27. 27.
    Ricci F, Zari N, Caprio F, Recine S, Amine A, Moscone D, Palleschi G, Plaxco KW (2009) Surface chemistry effects on the performance of an electrochemical DNA sensor. Bioelectrochemistry 76:208–213CrossRefGoogle Scholar
  28. 28.
    Lucarelli F, Marrazza G, Turner AP, Mascini M (2004) Carbon and gold electrodes as electrochemical transducers for DNA hybridisation sensors. Biosens Bioelectron 19:515–530CrossRefGoogle Scholar
  29. 29.
    Miao P, Wang B, Yu Z, Zhao J, Tang Y (2015) Ultrasensitive electrochemical detection of microRNA with star trigon structure and endonuclease mediated signal amplification. Biosens Bioelectron 63:365–370CrossRefGoogle Scholar
  30. 30.
    Wang W, Jayachandran S, Li M, Xu S, Luo X (2018) Hyaluronic acid functionalized nanostructured sensing interface for voltammetric determination of microRNA in biological media with ultra-high sensitivity and ultra-low fouling. Microchim Acta 185:156CrossRefGoogle Scholar
  31. 31.
    Liu S, Su W, Li Y, Zhang L, Ding X (2018) Manufacturing of an electrochemical biosensing platform based on hybrid DNA hydrogel: taking lung cancer-specific miR-21 as an example. Biosens Bioelectron 103:1–5CrossRefGoogle Scholar
  32. 32.
    Liu S, Su W, Li Z, Ding X (2015) Electrochemical detection of lung cancer specific microRNAs using 3D DNA origami nanostructures. Biosens Bioelectron 71:57–61CrossRefGoogle Scholar

Copyright information

© The Tunisian Chemical Society and Springer Nature Switzerland AG 2019

Authors and Affiliations

  1. 1.Laboratory of Process and Environmental Engineering, Faculty of Sciences and Techniques of MohammediaHassan II University of CasablancaMohammediaMorocco

Personalised recommendations