Advertisement

Graft-transmissible agents in oriental persimmons (Diospyros kaki L) in the southeastern USA.

  • Amy Gregory
  • S. W. Scott
  • Phillip M. Brannen
  • D. C. Royal
Article
  • 695 Downloads

Abstract

The “Sudden Death Syndrome” of oriental persimmon (Diospyros kaki L) described from the southeastern USA almost 30 years ago has been associated with infection by Xylella fastidiosa using PCR. The association between symptoms and the etiological agent is not absolute. Moreover, several viroids (Apple fruit crinkle viroid [AFCVd], Persimmon viroid [PEVd], Persimmon viroid 2 [PeVd 2], Citrus viroid VI [CVd VI - formerly referred to as Citrus viroid OS]) and viruses (Persimmon virus A [PeVA], Persimmon virus B [PeVB], Persimmon cryptic virus [PeCV], and Persimmon latent virus [PeLV]) have also been detected both in persimmon germplasm showing the “Sudden Death Syndrome” and in trees that displayed no distinct symptoms typical of infection by viruses or viroids.

Keywords

Xyllela fastidiosa Persimmon Diospyros kaki Viroids Viruses 
The oriental persimmon is native to China, where it has been cultivated for centuries and more than two thousand different cultivars exist. The species was transported to Korea and Japan many years ago where additional cultivars were developed. The plant was introduced to California in the mid 1800’s and the state is today the largest producer of persimmon fruit in the USA with production based in 3 counties: Fresno, Tulare, and San Diego (Kong and Zalom 2017). On more than one occasion cultivation of persimmon has been suggested as an alternative crop in other areas of the USA (Georgia 1980s, Missisippi 1990), but with little success. A trial involving some 19 cultivars located at the Southeastern Fruit and Tree Nut Research Laboratory of the USDA-ARS, Byron, Georgia begun in the 1980s was abandoned after 5 years because of the death of 90% of the trees as a result of a disease that caused a rapid decline with veinal necrosis, premature defoliation, bud death, and the death of individual scaffold limbs (Fig. 1) (Scott and Payne 1988). Trees propagated on rootstocks of D. virginiana using scionwood from the planting at Byron developed the same symptoms 2–4 years after grafting. This “Sudden Death Syndrome” (Reighard and Payne 1991) has appeared intermittently in plantings of kaki persimmon in the southeastern USA over the past 30 years but no association with a specific pathogen has been described. Cohen et al. (1991) documented a decline of persimmon associated with the incompatibility of trees of D. kaki on rootstocks of D. virginiana and suggested the involvement of a transmittable biotic factor”. However, there were inconsistencies between the symptoms they described and the symptoms of “Sudden Death”.
Fig. 1

A 4 year-old persimmon tree displaying symptoms of “Sudden Death Syndrome”. This tree was recorded in the trial at the Southeastern Fruit and Tree Nut Research Laboratory of the USDA-ARS, Byron Georgia that was begun in the mid1980s and abandoned after 5 years due to the disease

Whenever material symptomatic of the “Sudden Death Syndrome” (Figs. 2 and 3) became available, attempts to identify a specific etiological agent (fungus, bacterium or virus) were made without success. On each occasion tissue samples and total nucleic acid (TNA) extracts were stored at −80 °C. Most recently (2016) a few trees in a planting of approximately 500 trees of cv. Fuyu in middle Georgia (Telfair County) began to display the characteristic symptoms described in earlier reports. In some of these most recent samples, cross sections of shoots showed discolored xylem similar to that associated with cross-sections of peach trees diagnosed as displaying symptoms of phony peach (Giesbrecht and Ong 2012). The symptomatic trees were restricted to the perimeter of the planting suggesting that an infectious agent was moving in from surrounding vegetation. This distribution of symptomatic trees mimicked distributions observed in peach orchards in the southeastern USA when infections with diseases that have leafhopper vectors (such as peach rosette caused by a phytoplasma and phony peach caused by X. fastidiosa) had been mapped (Scott, unpublished). The coincidence of the distribution, the discolored xylem, and the incidence of the disease in an area of the USA in which X. fastidiosa is endemic (Mizell et al. 2015), led us to test both the most recent samples and those in storage for the presence of X. fastidiosa using PCR and Real-time PCR protocols (Table 1).
Fig. 2

Leaf and stem symptoms of “Sudden Death Syndrome” seen on trees growing in Clemson, South Carolina in 2008. Blackening of segments of the veins and die-back and curving of the shoot tips are visible. The curving and die-back of newly developing shoots is typical of the disease. Similar symptoms were observed in trees of cv. Fuyu growing in Telfair County, Georgia in 2016

Fig. 3

Trunk of young persimmon tree cv. Fuyu displaying “Sudden Death Syndrome” collected in Telfair County Georgia in 2016: A. Asymptomatic tree. B. Symptomatic tree showing dark patches moving down from apex of the tree toward the root. C. Blackening does not appear to spread below the graft union and indeed some rootstocks continue to grow after the scion has died

Table 1

A listing of the PCR, RT-PCR and real time PCR techniques used to detect pathogens in samples of Diospyros kaki. The primer pairs used for the PCR assays are described and the accession numbers for the products that were amplified, sequenced, and deposited in GenBank, are presented. The 2 real-time assays for X. fastidiosa each were completed using a probe labelled with FAM and which had a BHQ-1 quencher. CT values for the real-time reactions of positive controls typically had values of >20

Pathogen

Assay

Citation

5’primer sequence 3’

Amplicon size (bp)

GenBank Accession #

Xylella fastidosa

PCR

Rodrigues et al. 2003

CGGCAGCACATTGGTAGTA(F)

  
   

CTCCTCGCGGTTAAGCTAC(R)

1349

KY776470

 

PCR

Rodrigues et al. 2003

CAGTTAGGGGTGTCAGCG(F)

  
   

CTCAATGTAATTACCCAAGGT(R)

429

MF581192

 

PCR

Minsavage et al. 1994

GCGTTAATTTTCGAAGTGATTCGATTGC(F)

  
   

CACCATTCGTATCCCGGTG(R)

721

MF581193

 

Real-Time

Schaad et al. 2002

AAAAATCGCCAACATAAACCC(F)

  
 

PCR

 

CCAGGCGTCCTCACAAGTTAC (R)

71

 
  

Probe

ACCTATGCCAACATCAAACCCTGAATGCA

  
 

Real Time

Harper et al. 2010

CACGGCTGGTAACGGAAGA (F)

70

 
 

PCR

 

GGGTTGCGTGGTGAAATCAAG (R)

  
  

Probe

TCGCATCCCGTGGCTCAGCC

  

Apple fruit crinkle viroid

RT-PCR

Nakaune and Nakano 2008

GCCCGGTCGTGGATACCTAG (F)

373

MF804513

   

GCCCGCAGGGAAAAATAGGA (R)

  

Persimmon viroid

RT-PCR

Nakaune and Nakano 2008

AGCTCGGGCTGTGAGCTTGG (F)

394

MF804515

   

CGGCAGGGAGCCTTGCGAAC (R)

  

Persimmon viroid 2

RT-PCR

Ito et al. 2013a

CTCCGTGTGGTTCCTGTGTG (F)

358

MF804512

   

GACTCCACTCTCCCTAGGCT (R)

  

Citrus viroid VI

RT-PCR

Nakaune and Nakano 2008

TCGTCGACGAAGGCATGTGA (F)

326

MF804514

   

CGACAGGTGAGTCTCCTTGC (R)

  

Persimmon Cryptic Virus

RT-PCR

Morelli et al. 2015

TCCACGACCGATTGTGC (F)

141

MF804510

   

ACGAAGACACGTAACCACGCAGTGG (R)

  
 

RT-PCR

Morelli et al. 2015

AGTTTCGAGTCGTCTTCGGCGG (F)

144

MF804511

   

GTGTTGTTCACCGGTGTAGTAACT (R)

  

Persimmon latent virus

RT-PCR

Ito et al. 2013b

CGATCCACTGACCTGATCAAC (F)

250

MF804509

   

TAGAGCACGCGCAAATACTC (R)

  

Persimmon virus A

RT-PCR

Ito et al. 2013b

GGATGGCTTCTGATGTGTGG (F)

296

MF581191

   

TTGACCCGAATATGTGCGAT (R)

  

Persimmon virus B

 

Ito et al. 2015

   

Variant 1

RT-PCR

 

CAGTCACATTGGTGAAATGATACCGGA (F)

No amplicon detected

 
   

TGTGCCTCGAGATGGCCACAA (R)

  

Variant 2

RT-PCR

 

CGAAGGACGACGGTCCTG (F)

209

MF782854

   

TATTTGGAGCGTGGACACGA (R)

  

Variant 3

RT-PCR

 

ACTTCTCTTCGTCCATATCTG (R)

246

MF782854

   

CTACTTTCACAGTAAATGCTGC (F)

  

Variant 4

RT-PCR

 

TCCAACCGAATACGATCTCC (F)

245

MF782855

   

GTAGGTAGCTAGCACCGCAG (R)

  

A number of viroids and viruses have been detected in persimmon in the past decade, using RT-PCR techniques (Ito et al. 2013a, b, 2015; Nakaune and Nakano 2008) and next generation sequencing (Morelli et al. 2015). We chose to test all the samples from Telfair County for the presence of these agents by RT-PCR using the primers and cycling conditions described in published manuscripts as appropriate (Table 1). Wherever possible we also tested the materials collected over the past 30 years for these viroids and viruses.

Total nucleic acid (TNA) samples were extracted from the material collected in Telfair County, Georgia in 2016 using the method of Li et al. (2008). TNA extracted from petioles of a peach tree infected with X. fastidiosa was used as a positive control in PCR. TNA extracted from petioles of a peach seedling (Prunus persica cv. Nemaguard) that was maintained in an insect-proof screenhouse was used as a negative control for PCR. We did not have positive controls for the viruses and viroids. The quality of the TNA preparations was verified using spectrophotometry. Internal control primer pairs (Nad5 for RNA – Menzel et al. 2002) and (COX for DNA- Weller et al. 2000) were included in reactions to avoid false negative results. Multiple detection procedures were employed as we had no idea of the possible identity of any potential X. fastidiosa isolate that might be involved. In all cases where an amplicon of the size described in the original publication was produced in PCR or RT-PCR, the product was cloned and sequenced in both directions (Scott et al. 2003). Sequences were submitted to a Basic Local Alignment Search Tool (megablast) search at the National Center for Biotechnology Information (NCBI) website and relationships to bacteria, viruses, and viroids described previously submitted to GenBank were identified. The sequences of the amplicons were deposited in GenBank (Table 1). Comparison of the sequences of the amplicons we obtained from persimmon with those of X. fastidiosa held in GenBank showed 100% nucleotide identity with many of the curated accessions.

X. fastidiosa was detected in all the samples from the planting in Telfair County, Georgia displaying the symptoms of “Sudden Death” (Table 2). In addition, the viroid (PeVd2) and 4 viruses (PeVA, PeVB, PeLV, and PeCV) were detected in trees from this planting. However, this viroid and these viruses were also detected in trees within the planting that showed neither symptoms of “Sudden Death” nor symptoms typical of any other viral infection. The bacterium (X. fastidiosa) was also detected in almost all (16 out of 18) of the TNA extracts from samples showing symptoms of the disease that had been collected, extracted and stored at −80 °C in previous years. Three other viroids (AFCVd, PeVd and CVd VI) were detected in some of these samples (Table 3). We were unable to conduct a complete screening of this material collected over the years as we had a limited amount of TNA and had to select the agents against which we should test.
Table 2

Results of PCR testing of samples collected from Telfair County, Georgia, USA in 2016. All trees were of the cultivar “Fuyu”

Sample ID

SDS

Xf

AFCVd

PeVd

PEVd 2

CVd-VI

PeVA

PeVB

PeLV

PeCV

Telfair 1

+

+

+

+

+

+

+

+

+

+

Telfair 2

+

+

+

+

+

+

+

+

+

+

Telfair 3

+

+

+

+

+

+

+

+

+

+

Telfair 4

+

+

+

+

+

+

+

+

+

+

Telfair 5

+

+

+

+

+

+

+

+

+

+

Telfair 6

+

+

+

+

+

+

+

+

+

+

Telfair 7

+

+

+

+

+

+

+

+

+

+

Telfair 8

+

+

+

+

+

+

+

+

+

+

Telfair 9

as

nd

+

+

+

+

+

+

+

+

Telfair 10

as

nd

+

+

+

+

+

+

+

+

Table 3

Results of PCR testing of samples of persimmon cultivars from which samples were collected between 1988 and 2008

Cultivar

SDS

Xf

AFCVd

PeVd

PEVd2

CVd-VI

Fuyu(*)

+

+

+

+

+

+

Matsumoto

+

+

+

+

+

+

Ichikikei jiro

+

+

+

+

+

+

Korean

+

nd

+

+

+

+

Izu

+

+

nd

nd

nd

+

Sheng

+

+

nd

nd

+

+

Jiro

+

+

nd

nd

nd

+

Hanagosho

+

+

+

+

+

+

Siajo

+

+

+

+

+

+

Eureka

+

+

nt

nt

nt

nt

Tamopan

+

+

nt

nt

nt

nt

Aizumishirazu

+

+

nt

nt

nt

nt

Giombo,

+

+

nt

nt

nt

nt

Hana fuyu(*)

+

nd

nt

nt

nt

nt

Shogatsu

+

+

nt

nt

nt

nt

Tanenashi

+

+

nt

nt

nt

nt

Hiratanenashi

+

+

nt

nt

nt

nt

Hachiya

+

+

nt

nt

nt

nt

Key Tables 2 and 3. Agent detected using PCR (+). The presence of “Sudden Death Syndrome” (SDS) Xylella fastidiosa (Xf), Apple fruit crinkle viroid [AFCVd], Persimmon viroid [PEVd], Persimmon viroid 2 [PeVd 2], Citrus viroid VI [CVd -VI] and viruses (Persimmon virus [PeVA], Persimmon virus B [PeVB], Persimmon cryptic virus [PeCV]), and Persimmon latent virus [PeLV])

as = asymptomatic for SDS, nd = not detected by PCR, nt = not tested. *PeCV detected in this sample in Table 3

This is the first report worldwide of X. fastidiosa in persimmon of which we are aware. However, symptoms similar to those observed for “Sudden Death” had been reported on persimmons from Italy in the late 1940s (Mezzetti 1947, 1950, 1956 and 1957 – See images). Mezzetti concluded that the graft-transmissible nature of the disease suggested viral or bacterial etiology but did not identify the agent.

This is also the first report of various viroids (AFCVd, PeVd, PeVd 2, CVd VI) and viruses (PeVA, PeVB, PeLV, and PeCV) being detected in persimmon germplasm in the southeastern USA. However, the detection of these viruses and viroids is not surprising as persimmon germplasm has been moved world-wide from Japan where these viruses and viroids were initially detected. Recently, PeCV has been detected in Italy (Morelli et al. 2015) and Spain (Ruiz-García et al. 2017).

Although the association between the “Sudden Death Syndrome” and the presence of X. fastidiosa is not absolute, the PCR results suggest a relationship between this bacterium and the disease. Despite previous research this is the first time that a potential etiological agent has been identified for this syndrome and clearly, pathogenicity studies are necessary to demonstrate Koch’s postulates and to validate the relationship between “Sudden Death Syndrome” and infection with X. fastidiosa.

In the original report of the “Sudden Death Syndrome” (Scott and Payne 1988) crystals of isometric viruses were revealed by electron microscopy of fixed and embedded tissue from diseased leaves, and concentrated leaf dip preparations showed a few isometric particles. In addition, comparison of dsRNA banding patterns in asymptomatic and symptomatic trees detected the presence of two bands of dsRNA (MW 1.2 and 1.03 × 106, respectively) in some, but not all, infected cultivars. Although supporting the idea of a graft-transmissible agent being associated with the symptoms, no definitive identification was made. The detection in this work of the previously unknown PeCV (a possible cryptovirus) in two samples collected between 1988 and 2008 support the evidence of the isometric particles and small dsRNA molecules in the original report.

The fact that the disease reduced a trial of 238 trees comprising 17 cultivars of persimmon to 22 trees within 5 years would indicate that this is a serious problem, and potentially a limiting factor in the development of persimmon as an alternative crop in the southeastern USA, particularly when X. fastidiosa is endemic to the region.

Lyophilized tissues from Diospyros kaki displaying symptoms of “Sudden Death Syndrome”, and which has been shown to be positive for X. fastidiosa in real-time PCR, is freely available from the corresponding author at Clemson University. The material has been stored at −80 °C since collection and lyophilization.

References

  1. Cohen Y, Gur A, Barkai Z, Blumenfeld A (1991) Decline of persimmon (Diospyros kaki L.) trees on Diospyros virginiana rootstocks. Sci Hortic 48:61–70CrossRefGoogle Scholar
  2. Giesbrecht M, Ong K (2012) Phony Peach Disease. Texas A & M, AgriLife Extension PLP-009Google Scholar
  3. Harper SJ, Ward LI, Clover GRG (2010) Development of LAMP and real-time PCR methods for the rapid detection of Xylella fastidiosa for quarantine and field applications. Phytopathology 100:1282–1288CrossRefGoogle Scholar
  4. Ito T, Suzaki K, Nakano M (2013a) b. Genetic characterization of novel putative rhabdovirus and dsRNA virus from Japanese persimmon. J Gen Virol 94:1917–1921CrossRefGoogle Scholar
  5. Ito T, Suzaki K, Nakano M, Sato A (2013b) a. Characterization of a new apscaviroid from American persimmon. Arch Virol 158:2629–2631CrossRefGoogle Scholar
  6. Ito T, Sato A, Suzaki K (2015) An assemblage of divergent variants of a novel putative closterovirus from American persimmon. Virus Genes 51:205–111CrossRefGoogle Scholar
  7. Kong M, Zalom J (2017), Persimmon in California. Fruit & Nut Research & Information Center, Dept. of Plant Sciences, UC Davis http://fruitandnuteducation.ucdavis.edu/fruitnutproduction/Persimmon/ Accessed 17 July, 2017
  8. Li R, Mock R, Huang Q, Abad J, Hartung J, Kinard G (2008) A reliable and inexpensive method of nucleic acid extraction for the PCR-based detection of diverse plant pathogens. J Virol Methods 154(2008):48–55CrossRefGoogle Scholar
  9. Menzel W, Jelkmann W, Maiss E (2002) Detection of four apple viruses by multiplex RT-PCR assays with coamplification of plant mRNA as internal control. J Virol Methods 99:81–92CrossRefGoogle Scholar
  10. Mezzetti A (1947) Notizie su di una nuova malattia del kaki difusa in Italia. Annali della Sperimentazione Agaria 3:425–430Google Scholar
  11. Mezzetti A (1950) Altre observaziopni sulla `defogliazione del Kaki. Annali della Sperimentazione Agaria 4:291–294Google Scholar
  12. Mezzetti A (1956) A new disorder of oriental persimmon in Italy. FAO Plant Protection Bulletin 4:181–183Google Scholar
  13. Mezzetti A (1957) 'Defogliazione" o "giallume latente' del Kaki con partticolare riguardo alla sua epidemiologia. Terzo contributo Annali della Sperimentazione Agaria 11:959–977Google Scholar
  14. Minsavage GV, Thompson CM, Hopkins DL, Leite RMVBC, Stall RE (1994) Development of a polymerase chain reaction protocol for detection of Xylella fastidiosa in plant tissue. Phytopath 84:456–461CrossRefGoogle Scholar
  15. Mizell RF, Andersen PC, Tipping C, Brodbeck BV (2015) Xylella Fastidiosa Diseases and Their Leafhopper Vectors. ENY-683, http://edis.ifas.ufl.edu Accessed 17 July, 2017
  16. Morelli M, Chiumenti M, De Stradis A, La Notte P, Minafra A (2015) Discovery and molecular characterization of a new cryptovirus dsRNA genome from Japanese persimmon through conventional cloning and high-throughput sequencing. Virus Genes 50:160–164CrossRefGoogle Scholar
  17. Nakaune R, Nakano M (2008) Identification of a new Apscaviroid from Japanese persimmon. Arch Virol 153:969–972CrossRefGoogle Scholar
  18. Reighard GL, Payne J. (1991) Sudden Death Syndrome in Kaki Persimmon: Some Observations. 82nd Annual Report of the Northern Nut Growers Association 3ppGoogle Scholar
  19. Rodrigues JLM, Silva-Stenico ME, Gomes JE, Lopes JRS, Tsai SM (2003) Detection and diversity assessment of Xylella fastidiosa in field-collected plant and insect samples by using 16S rRNA and gyrB sequences. Appl Environ Microbiol 69:4249–4255CrossRefGoogle Scholar
  20. Ruiz-García AB, Chamberland N, Martínez C, Massart S, Olmos A (2017) First report of persimmon cryptic virus in Spain. J Plant Path 99:287Google Scholar
  21. Schaad NW, Opgenorth D, Gaush P (2002) Real-time polymerase chain reaction for one-hour on-site diagnosis of Pierce’s disease of grape in early season asymptomatic vines. Phytopath 92:721–728CrossRefGoogle Scholar
  22. Scott SW, Payne JA (1988) A decline of persimmon. Phytopath 78:1568 (Abstr)Google Scholar
  23. Scott SW, Zimmerman MT, Ge X (2003) Viruses in subgroup 2 of the genus Ilarvirus share properties at the molecular level. Arch Virol 148:2063–2075CrossRefGoogle Scholar
  24. Weller SA, Elphinstone JG, Smith NC, Boonham N, Stead DE (2000) Detection of Ralstonia solanacearum strains with a quantitative, multiplex, real time, fluorogenic PCR (TaqMan) assay. Appl Environ Microbiol 66:2853–2858CrossRefGoogle Scholar

Copyright information

© Australasian Plant Pathology Society Inc. 2018

Authors and Affiliations

  1. 1.Department of Biological SciencesClemson UniversityClemsonUSA
  2. 2.Plant Pathology DepartmentUniversity of Georgia AthensAthensUSA
  3. 3.Agricultural and Natural Resources AgentMcRaeUSA

Personalised recommendations