Advertisement

RHD Genotyping by Molecular Analysis of Hybrid Rhesus box in RhD-Negative Blood Donors from Iran

  • Behzad Nazel Khosroshahi
  • Arezoo Oodi
  • Saba Namjou
  • Tahereh Gholamali
  • Naser AmirizadehEmail author
Open Access
Original Article
  • 262 Downloads

Abstract

D antigen is the most important and immunogenic antigen of the Rh blood group. The RhD-negative phenotype has different genetic backgrounds with variable distribution in different populations. Hybrid Rhesus box, resulting from RHD gene deletion, is used in genotyping studies of the Rh blood group as a marker to identify the RHD gene deletion. This study for the first time identified genetic mechanisms for the occurrence of RhD-negative phenotype among the Iranian population. 200 RhD-negative blood donors were randomly selected from Tehran Blood Transfusion Center. The phenotype of D, C, Ε, e and c antigens was serologically identified, and DNA was extracted from buffy coat. The molecular analysis of hybrid Rhesus box was performed by PCR-SSP and PCR-RFLP. Moreover, the presence of different exons of RHD gene was investigated by real-time PCR on extracted DNA. Hybrid Rhesus box was detected in all samples, and PCR-RFLP confirmed that 198 (99%) were homozygous for an RHD gene deletion and 2 were heterozygous for hybrid Rhesus box in which one (0.5%) had a weak D type 11 and the other one (0.5%) had a RHD-CE (2-9)-D2 hybrid allele. Similar to Caucasians, the frequency of RHD gene deletion was high among the Iranian population studied in this investigation, so hybrid Rhesus box can be used as an efficient marker to detect RHD gene deletion in our population.

Keywords

RHD genotype Hybrid Rhesus box RHD gene alleles RhD-negative donors Iran 

Introduction

The antigen D is the most important and immunogenic antigen of the Rh blood group [1, 2]. The proper identification of RhD antigen has a high clinical significance, and can play an important role in preventing the occurrence of hemolytic anemia in patients and newborns [2]. Serology is the standard method for detection of RhD antigen, but has limitations. Genotyping by molecular techniques is a complementary tool to overcome these limitations. Some of the clinical applications of these methods are determination of RHD zygosity in RhD-positive fathers, assessment of RhD status in the fetus and multi-transfused patients, resolving the discrepancies in RhD typing in blood donors and patients with auto or alloantibodies [3, 4]. Knowing the prevalence of alleles responsible for the phenotype in a special population, and the establishment of appropriate molecular methods for detection of alleles are required for genotyping and its application in the clinic [5]. Whereas in Caucasians deletion of the entire RHD gene is the most common cause of the RhD-negative phenotype, RHDψ (66%), RHD-CE-D hybrid gene (15%) and RHD gene deletion (18%) are the most prevalent causes of the RhD-negative phenotype among black Africans [1, 6]. Studies have shown that the D-negative phenotype is present in about 10.08% of the Iranian population [7], but there are not any reports identifying the molecular background of D-negative phenotypes in our country. This study for the first time identified the genetic mechanisms of RhD-negative phenotype among the Iranian population. The hybrid Rhesus box is a genomic segment with an approximate length of 9000 base, resulting from the RHD gene deletion and the integration of two segments of upstream and downstream Rhesus boxes that flank the RHD gene. This hybrid sequence was used as a marker to identify the RHD gene deletion [1]. Regarding the similarity of RhD-negative frequency among Caucasians and Iranian population and high prevalence of RHD gene deletion in Caucasians, we decided to evaluate the presence of hybrid Rhesus box genomic segment by PCR-SSP and PCR-RFLP. In addition, we performed real-time PCR to investigate the presence of RHD gene exons in our samples as a confirmatory test for gene deletion.

Materials and Methods

Sample Collection

Blood samples obtained into K3EDTA-containing tubes from 200 RhD-negative randomly selected donors at the Tehran Blood Transfusion Center. This study was approved by the Ethics Committee of the Institute for Educational and Research in Transfusion Medicine.

Phenotype Determination

The antigenic phenotype (D, C, E, c, e) of red blood cells were determined for all specimens using a monoclonal antibody (IMMUNDIAGNOSTIKA, GmbH, Germany) by standard serological method. Monoclonal antibody reagents were used to test the following specificities: anti-C (RH2, clone MS24), anti-E (RH3, clone MS80/MS258), anti-c (RH4, clone MS33) and anti-e (RH5, clone MS62/MS69).The anti-D reagent was a blend of both IgG and IgM. Subsequently, weak D test was performed on all samples by indirect antiglobulin test (IAT) according to the standard serological guidelines. Adsorption–elution test was not performed in this study.

DNA Extraction

Genomic DNA was extracted from buffy coat samples using column-based DNA extraction kit (YT 9040, YEKTA TAJHIZ AZMA, IRAN). The extracted DNA was stored at − 20 °C after determining the concentration using the Nano Drop (one/onec, Thermo Fisher Scientific Inc, USA).

PCR-SSP

A 2778-bp fragment was amplified from the hybrid Rhesus box gene, causing by deletion the RHD gene. This segment flanking the breakpoint region in the hybrid Rhesus box gene comprised of segments from upstream Rhesus box (775 bp), identity region (1467 bp) and downstream Rhesus box (536 bp) [1]. The segment was amplified by the forward primer (u1-s) and reverse primer (rnb31) (Table 1). PCR reaction was performed in a volume of 25 μl in 35 cycles using thermal cycler (PEQSTAR 2X 95-08002, PEQLAB Biotechnology GmbH, Germany) under the following conditions: initial denaturation at 95 °C for 10 min, denaturation at 92 °C for 20 s, annealing at 64 °C for 30 s, extension at 68 °C for 3 min, final extension at 72 °C for 5 min. The concentration of forward and reverse primers was 0.4 μm. The PCR products were electrophoresed on 0.8% agarose gel.
Table 1

Sequence and specificity of primers comprising segments of hybrid (AJ252313), downstream (AJ252312) and upstream Rhesus box (AJ252311)

(Reproduced with permission from [1, 8, 9])

Primer

Sequence

Specificity

u1-s

TGAGCCTATAAAATCCAAAGCAAGTTAG

Hybrid and upstream Rhesus box

rnb31

CCTTTTTTTGTTTGTTTTTGGCGGTGC

Hybrid and downstream Rhesus box

rez7

CCTGTCCCCATGATTCAGTTACC

Hybrid and downstream and upstream Rhesus box

PCR-RFLP

The PCR-RFLP was used to discriminate the status of homo- or heterozygosity of RHD gene deletion allele [1]. The primers were designed so that they could amplify both fragments of the hybrid Rhesus box in the deletion of RHD gene and also of the downstream Rhesus box in the presence of RHD gene [1, 8, 9]. The sequences of forward (Rez7) and reverse (rnb31) primers are shown in Table 1. PCR reaction was performed as described for PCR-SSP, but the number of cycles was 30 and annealing temperature was 68 °C. The PCR products were digested with PstI enzyme (Jena Bioscience, GmbH, Germany) for 1 h at 37 °C and electrophoresed on 2% agarose gel.

Real-time PCR

The real-time PCR was used to investigate the presence of three exons 5, 7 and 10 in the RHD gene by sequence-specific primers (Table 2). The RHD-positive sample was used as a control for the amplification of exons and melting curve analysis of PCR products. In the presence of RHD gene deletion, none of the three exons would be amplified, while in the presence of any RHD allele that resulted in RhD-negative phenotype it was expected that one or more of these exons would be amplified based on the type of the allele [10, 11].
Table 2

Primers’ sequence of exons 5, 7, and 10 of the RHD gene

(Reproduced with permission from [12])

Gene

Forward/reverse

Sequence

Product size

Exon 5

F

5′-CGCCCTCTTCTTGTGGATG-3′

82 bp

R

5′-GAACACGGCATTCTTCCTTTC-3′

Exon 7

F

5′-CTCCATCATGGGCTACAA-3′

90 bp

R

5′-CCGGCTCCGACGGTATC-3′

Exon 10

F

5′-CCTCTCACTGTTGCCTGCATT-3′

74 bp

R

5′-AGTGCCTGCGCGAACATT-3′

Real-time PCR reaction was performed in a volume of 25 μl in 30 cycles using thermal cycler (Rotor-Gene, RG3000, Corbett, Australia) and SYBR Green Master Mix under the following conditions: initial denaturation at 94 °C for 2 min, denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 30 s. The concentration of forward and reverse primers for each exon was 0.4 μm.

RHD-CE-D Hybrid Molecular Analysis

We initially analyzed the presence of exons 3, 4, 6 and 9 of RHD gene using the PCR-SSP method [13] in one sample whose real-time PCR reaction was positive for exon 10. Then, we investigated the presence of introns 1 and 2 of the RHD gene by PCR-RFLP [14, 15].

Weak D Molecular Analysis

Weak D molecular diagnostic kit (inno-train, Diagnostic GmbH, Germany) was used for further analysis of the positive sample in which the three exons 5, 7 and 10 were amplified by RT-PCR according to the manufacturer’s guidelines. Exon 6 was sequenced (ABI 3130 XL Applied Biosystem, Macrogene, Korea) to confirm the weak D allele type.

Results

Rh Antigen Phenotypes

The phenotype of the antigens D, C, E, c, e was determined on samples of 200 blood donors (Table 3). An indirect antiglobulin test was performed for the elimination of donors with weak D phenotype. The result of indirect antiglobulin test proved negative in all donors.
Table 3

Frequency of phenotypes and predicted genotypes

Phenotypes

The most probable genotypes

Number(200 samples)

Frequency (%)

D−C−E−c+e+

cde/cde

184

92

D−C+E−c−e+

Cde/Cde

4

2

D−C+E−c+e+

Cde/cde

11

5.5

D−C−E+c+e+

cdE/cde

1

0.5

Hybrid Rhesus box Gene Analysis by PCR-SSP

The genomic segment with a length of 2778 bp was amplified using PCR-SSP technique, indicating that all 200 (100%) donors were positive for hybrid Rhesus box gene in at least one allele (Fig. 1).
Fig. 1

PCR-SSP for hybrid Rhesus box gene. A 2778 bp fragment was amplified by PCR-SSP indicates the presence of hybrid Rhesus box gene (lanes 1–10). Lane 11: Negative control. M: Molecular marker 1 kb (YT8507, YEKTA TAJHIZ AZMA, IRAN)

Zygosity Analysis of Hybrid Rhesus box Gene by PCR-RFLP

A genomic segment with an approximate length of 3030 bp was amplified by PCR and specific primers and digested with PstI enzyme. The number and size of fragments on a 2% agarose gel showed that 198 (99%) of donors had a hybrid Rhesus box genomic segment in both RH gene alleles (homozygote) (Fig. 2a) and the 2 remaining donors (1%) had a hybrid Rhesus box in one of the RH gene alleles (heterozygote); in the latter, in addition to hybrid Rhesus box, a genomic segment was amplified from downstream Rhesus box of another allele (Fig. 2b).
Fig. 2

PCR-RFLP analysis for RHD gene deletion. a Banding patterns of RHD−/RHD− homozygotes. There are 3 PstI sites in the hybrid Rhesus box amplicons. Digestion with this enzyme (PstI) results in 179, 397, 564, 1887-bp fragments (lanes 1–9). b PCR-RFLP for RHD+/RHD− heterozygous samples. An additional 744-bp fragment results from downstream Rhesus box digestion and indicates the heterozygous situation (lanes 1–2). M: Molecular marker 100 bp (YT8503, YEKTA TAJHIZ AZMA, IRAN)

RHD Exons Analysis

In this study, none of the exons 5, 7 and 10 were amplified in 198 (99%) of 200 samples studied by real-time PCR. Of the two remaining samples (1%), all three exons 5, 7 and 10 were amplified in one sample, and in the other one only exon 10 was amplified. In the positive sample for all three exons 5, 7 and 10 with more molecular analysis by the diagnostic kit, weak D allele type 11 (885 G>T) was detected and confirmed by sequencing of exon 6. In the sample that was positive only for exon 10, the results of PCR-SSP for exons 3, 4, 6 and 9 indicated that these exons were absent in the RHD gene in this case. Results of molecular analysis of introns 1 and 2 showed that this sample is a RHD-CE (2-9)-D2 hybrid allele. (Table 4).
Table 4

Frequency of RHD gene alleles in RhD-negative samples

RHD gene alleles

Number

(200 samples)

(%)

Phenotypes

PCR-SSP (for hybrid Rhesus box)

PCR-RFLP

(for RHD gene deletion)

RHD exons 5, 7, 10

Gene deletion

198

99

D−C−E−c+e+ (92.92%)

D−C−E+c+e+ (0.5%)

D−C+E−c−e+ (1.51%)

D−C+E−c+e+ (5.05%)

+

Homozygote

Weak D type 11

1

0.5

D−C+E−c−e+

+

Heterozygote

+

RHD-CE(2-9)-D2

1

0.5

D−C+E−c+e+

+

Heterozygote

Only 10 +

Discussion

The prevalence of D-negative phenotype is estimated to be between 15 and 17% among Caucasians, 5% in black Africans and less than 3% in Asians [16]. The prevalence of D-negative phenotype in Iran is estimated at approximately 10.08% [7], which is more consistent with the Caucasian population. This study for the first time identified the genetic mechanisms of D-negative phenotype among the Iranian population.

Our results, using the PCR-SSP, showed that all donors were positive for the presence of a 2778 bp genomic segment obtained from the hybrid Rhesus box gene. The amplification of this segment implies that all donors have at least one RHD gene deletion allele, and another allele of the RHD gene may be a deletion or non-deletion allele. Therefore, the PCR-RFLP was used to check the status of the other allele for the presence or absence of RHD gene.

The results of PCR-RFLP showed that 198 (99%) of donors in both RH gene alleles had a hybrid Rhesus box genomic segment, which means that these cases are homozygote for RHD gene deletion. Analysis of exons 5, 7 and 10 using real-time PCR also showed that none of the three exons were amplified in these 198 donors, and the PCR-SSP and PCR-RFLP results were confirmed. Moreover, the PCR-RFLP results showed that 2 (1%) of the RhD-negative donors had a RHD gene allele. The analysis of exons 5, 7 and 10 using real-time PCR showed that all three exons 5, 7 and 10 were amplified in one sample, but, in the other one, only exon 10 was amplified. In the first sample, further molecular analysis showed that the donor had a weak D allele type 11 that has not been detected by the weak D serological test. In some cases, the weak D phenotype may not be detected by the conventional serological tests (indirect anti-globulin test) [17]. The 885 G>T mutation associated with the replacement of M295I results in lowered density of D antigen on red blood cells in the weak D type 11 [18]. In the second sample that was positive only for exon 10, the results of further molecular analyses for exons 3, 4, 6 and 9 and introns 1 and 2 of RHD gene indicated the presence of the RHD-CE (2-9)-D2 hybrid allele. Several studies in East Asia have shown that the most common mechanisms for the D-negative phenotype in this population are the RHD gene deletion, the DEL allele (approximately 10–30%) and the RHD-CE-D hybrid allele (approximately 10%) [19, 20]. These genetic backgrounds of RhD-negative are different from the Iranian population located in the Middle East, while the frequency of our results is more similar to the European population [21]. The frequency of D-negative phenotype with a non-deletion RHD gene allele is approximately 0.6% in Caucasians, 10% in black Africans and 30% in Asians [2, 22]. In our study, non-deletion RHD gene allele was found in 2 (1%) D-negative donors, indicating more consistency with the Caucasian population. Genotyping of RhD-negative donors at the blood transfusion centers is very important because some alleles like DEL and weak D may not be detected by conventional serological tests and are considered as RhD-negative. Transfusion of these blood products into RhD-negative individuals, especially for girls and women with childbearing potential, may increase the risk of immunization with anti-D in these individuals. So, the screening of RhD-negative donors by genotyping for identification of RHD gene alleles, especially in a population where these alleles are highly prevalent, can be very important [17, 23]. Despite the high prevalence of DEL allele in East Asia (approximately 10–30% of the RhD-negative population), our results (high frequency of RHD gene deletion) imply that the frequency of the DEL allele among the Iranian population should be very low and similar to the Caucasian population [21, 24]. In our study, the RHD gene deletion had the highest association with the D−C−E−c+e+ phenotype (92.92%) and 87.5% of the C+/E+ donors had RHD gene deletion alleles. The frequency of D-negative phenotype with the presence of RHD gene non-deletion alleles in association with C and E antigens has also been reported [2, 11]. Both donors with non-deletion allele in this study were positive for C antigen.

Conclusion

In this study, using PCR-SSP, PCR-RFLP, and real-time PCR to identify the genetic background of D-negative phenotype showed that RHD gene deletion is the most common genetic mechanism for D-negative phenotype in Iran. The results of the present study are consistent with other studies performed in Caucasians. Furthermore, hybrid Rhesus box molecular analysis could effectively identify this allele.

Notes

Compliance with Ethical Standards

Conflict of interest

All authors of this article declare that they have no conflict of interest.

Informed consent

Informed consent was obtained from all individual participants included in the study.

References

  1. 1.
    Wagner FF, Flegel WA (2000) RHD gene deletion occurred in the Rhesus box. Blood 95:3662–3668Google Scholar
  2. 2.
    Sassi A, Ouchari M, Houissa B, Romdhane H, Abdelkefi S, Chakroun T, Jemni Yacoub S (2014) RHD genotyping its implication in transfusion practice. Transfus Apheres Sci 51:59–63CrossRefGoogle Scholar
  3. 3.
    Flegel WA (2006) Molecular genetics of RH and its clinical application. Transfus Clin Biol 13:4–12CrossRefGoogle Scholar
  4. 4.
    Flegel WA (2007) Blood group genotyping in Germany. Transfusion 47:47S–53SCrossRefGoogle Scholar
  5. 5.
    Trucco Boggione C, Luján Brajovich ME, Tarragó M, Mattaloni SM, Biondi CS, Muñiz-Díaz E, Nogués N, Cotorruelo CM (2014) Molecular structures identified in serologically D-samples of an admixed population. Transfusion 54:2456–2462CrossRefGoogle Scholar
  6. 6.
    Singleton BK, Green CA, Avent ND, Martin PG, Smart E, Daka A, Narter-Olaga EG, Hawthorne LM, Daniels G (2000) The presence of an RHD pseudogene containing a 37 base pair duplication and a nonsense mutation in Africans with the Rh D-negative blood group phenotype. Blood 95:12–18Google Scholar
  7. 7.
    Pourfathollah AA, Oody A, Honarkaran N (2004) Geographical distribution of ABO and Rh (D) blood groups among Iranian blood donors in the year 1361 (1982) as compared with that of the year 1380 (2001). Blood J 1:11–17Google Scholar
  8. 8.
    Kacem N, Jemni-Yacoub S, Chiaroni J, Bailly P, Silvy M (2015) Paternal RHD zygosity determination in Tunisians: evaluation of three molecular tests. Blood Transfus 13:59–65Google Scholar
  9. 9.
    Perco P, Shao CH, Richard Mayr W, Panzer S, Jorg Legler T (2003) Testing for the D zygosity with three different methods revealed altered Rhesus boxes and a new weak D type. Transfusion 43:335–339CrossRefGoogle Scholar
  10. 10.
    Szulman A, Marcondes Machado Nardozza L, Augusto Barreto J, Araujo E Jr, Fernandes Moron A (2012) Investigation of pseudogenes RHDΨ and RHD-CE-D hybrid gene in D-negative blood donors by the real time PCR method. Transfus Apheres Sci 47:289–293CrossRefGoogle Scholar
  11. 11.
    Moussa H, Tsochandaridis M, Chakroun T, Jridi S, Abdelneji B, Hmida S, Silvy M, Bailly P, Gabert J, Levy-Mozziconacci A, Jemni-Yacoub S (2012) Molecular background of D-negative phenotype in the Tunisian Population. Transfus Med 22:192–198CrossRefGoogle Scholar
  12. 12.
    Oliveira J, Osório N, Rocha J, Cruz B, Figueiredo J, Caseiro A, Valado A, Gabriel A, Mendes F (2012) Fetal RHD and RHCE Genotyping in Plasma of Rh Negative Pregnant Women. Int J Biomed Lab Sci (IJBLS) 1(2):50–58Google Scholar
  13. 13.
    Cai Lan J, Chen Q, Lin WuD, Dao Be Pong HD, Zaho T (2000) Genetic Polymorphism of RhD-negative associated haplotypes in the Chinese. J Hum Genet 45:224–227CrossRefGoogle Scholar
  14. 14.
    Kemp TJ, Poulter M, Carritt B (1996) A recombination hot spot in the Rh genes revealed by analysis of unrelated donors with the rare D-phenotype. Am J Hum Genet 59:1066–1073Google Scholar
  15. 15.
    Poulter M, KempT J, Carritt B (1996) DNA-based rhesus typing: simultaneous determination of RHC and RHD status using the polymerase chain reaction. Vox Sang 70:164–168CrossRefGoogle Scholar
  16. 16.
    Westhoff CM (2007) the structure and function of the Rh antigen complex. Semin Hematol 44:42–50CrossRefGoogle Scholar
  17. 17.
    Flegel WA, Von Zabern I, Wagner FF (2009) Six years’ experience performing RHD genotyping to confirm D- red blood cell units in Germany for preventing anti-D immunizations. Transfusion 49:465–471CrossRefGoogle Scholar
  18. 18.
    Wagner FF, Frohmajer A, Ladewig B, Eicher NI, Lonicer CB, Muller TH, Siegel MH, Flegel WA (2000) Weak D allele’s express distinct phenotypes. Blood 95(8):2699–2708Google Scholar
  19. 19.
    Qun X, Grootkerk-Tax MG, de Haas HM, Maaskant-van Wijk PA, van der Schoot CE (2005) Systemic analysis and zygosity determination of the RHD gene in a D-negative Chinese Han population reveals a novel D-negative RHD gene. Vox Sang 88:35–40CrossRefGoogle Scholar
  20. 20.
    Ji Yeon Kim, Yeun Kim S, Kim C, Sung Yon G, Sup Park S (2005) Molecular characterization of D– Korean persons: development of a diagnostic strategy. Transfusion 45:345–352CrossRefGoogle Scholar
  21. 21.
    Wagner FF, Frohmajer A, Flegel WA (2001) RHD positive haplotypes in D negative Europeans. BMC Genet 2:10CrossRefGoogle Scholar
  22. 22.
    Cruz BR, Chiba AK, Moritz E, Bordin JO (2012) RHD alleles in Brazilian blood donors with weak D or D-negative phenotypes. Transfus Med 22:84–89CrossRefGoogle Scholar
  23. 23.
    Touinssi M, Chapel-Fernandes S, Granier T, Bokilo A, Bailly P, Chiaroni J (2009) Molecular analysis of inactive and active RHD alleles in native Congolese cohorts. Transfusion 49:1353–1360CrossRefGoogle Scholar
  24. 24.
    Li Q, Hou L, Guo Z-H, Ye L-Y, Yue D-Q, Zhu Z-Y (2009) Molecular basis of the RHD gene in blood donors with DEL phenotypes in Shanghai. Vox Sang 97:139–146CrossRefGoogle Scholar

Copyright information

© The Author(s) 2018

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.

Authors and Affiliations

  • Behzad Nazel Khosroshahi
    • 1
  • Arezoo Oodi
    • 1
  • Saba Namjou
    • 1
  • Tahereh Gholamali
    • 1
  • Naser Amirizadeh
    • 1
    Email author
  1. 1.Blood Transfusion Research CenterHigh Institute for Research and Education in Transfusion MedicineTehranIran

Personalised recommendations