Advertisement

American Journal of Potato Research

, Volume 96, Issue 1, pp 21–32 | Cite as

DNA Fingerprinting and Genetic Diversity Analysis with Simple Sequence Repeat Markers of 217 Potato Cultivars (Solanum tuberosum L.) in China

  • Yanfeng Duan
  • Jie Liu
  • Jianfei Xu
  • Chunsong Bian
  • Shaoguang Duan
  • Wanfu Pang
  • Jun Hu
  • Guangcun Li
  • Liping JinEmail author
Open Access
Article
  • 620 Downloads

Abstract

Since 1950, more than 620 potato cultivars have been released from Chinese breeding programs, some of which have similar genetic background and phenotype. In this study, 16 parental cultivars widely used in breeding were used to screen 138 simple sequence repeat (SSR) markers. Out of 138 SSR markers, 20 were polymorphic that were used to analyze the genetic diversity of 217 potato cultivars grown in China. In total, 249 alleles were detected with these 20 markers and 244 of them (97.99%) showed polymorphism. The number of alleles ranged from 7 to 22 with an average of 12.45 alleles per primer and polymorphic information content (PIC) ranged from 0.64–0.93 with an average of 0.83. Fragment sizes varied from 80 to 380 bp. Based on PIC values and the clarity of PCR amplification bands, 11 SSR markers were selected and able to differentiate all of the 217 cultivars. The estimated similarity using these polymorphic SSR markers between the cultivars ranged from 0.63 to 0.99, indicating a narrow genetic base. Fingerprinting and genetic diversity analysis in this study provides useful information for the protection of intellectual property, as well as the exploration and utilization of these potato cultivars.

Keywords

Solanum tuberosum Polymorphic information content Microsatellites Genetic similarity 

Resumen

Desde 1950, se han liberado más de 620 variedades de papa de los programas chinos de mejoramiento, algunos de los cuales tienen antecedentes genéticos y fenotipo similares. En este estudio, se usaron 16 variedades parentales utilizadas ampliamente en mejoramiento, para hacer un estudio de 138 marcadores de repeticiones simples de secuencia (SSR). De los 138 marcadores SSR, 20 fueron polimórficos que fueron usados para analizar la diversidad genética de 217 variedades de papa cultivadas en China. En total, se detectaron 249 alelos con estos 20 marcadores y 244 de ellos (97.99%) mostraron polimorfismo. El número de alelos tuvo un rango de 7–22 con un promedio de 12.45 alelos por iniciador, y el contenido de la información polimórfica (PIC) varió de 0.64–0.93 con un promedio de 0.83. Los tamaños de los fragmentos variaron de 80–380 pb. Con base en los valores PIC y la claridad de las bandas de amplificación, se seleccionaron 11 marcadores SSR y fue posible diferenciar a la totalidad de las 217 variedades. La similitud estimada usando estos marcadores polimórficos SSR entre las variedades varió de 0.63 a 0.99, indicando una base genética angosta. Los análisis de huellas y diversidad genética en este estudio proporcionan información útil para la protección de propiedad intelectual, así como para la exploración y utilización de estas variedades de papa.

Introduction

Potato (Solanum tuberosum L.) is the third most important food crop in the world. It is adapted to a wide range of environmental conditions (Vreugdenhil 2007) and contains high level of nutrients (Gibson and Kurilich 2013). In addition, it also plays an important role in ensuring food security and promoting farmers’ income. In 2016, 162 countries and regions planted 19.25 million hectares of potato and the yield reached 376.83 million tons (http://www.fao.org/faostat/en/#data/QC).

China is the largest producer of potato in the world with a growing area of 5.63 million hectares and total production of 97.4 million tons in 2016 (Qu 2016). Potato cultivars grown in China have contributed immensely to increased yields and acted as germplasm resources for cultivar improvement. In China, breeding for crop improvement in potato started in 1950 and currently more than 620 potato cultivars have been released. For a long period, confusion has existed in cultivar names because of missing or incorrect records. Sometimes the same cultivar might be known by different names, and sometimes different cultivars have the same name. Therefore, a quick and accurate identification of different cultivars has great importance for seed production, protection of intellectual property, and commercialization of cultivars in China.

Cultivar identification in potato is mainly based on traditional morphological traits, such as tuber morphology (shape, skin and flesh color, distribution and depth of the eyes), leaf type, flower color, and sprout appearance. However, collecting trait data is time consuming, difficult and sometimes strongly affected by environmental factors (Chimote et al. 2004). In addition, the repeated use of selected elite parental clones in breeding further narrows down the genetic diversity among the cultivars. Therefore, it is difficult to distinguish similar cultivars morphologically. Isozyme markers developed in the 1970s were widely used to directly detect the gene products, and have proved to be useful in identification of different potato cultivars (Stegemann and Schnick 1985; Oliver and Martinez-Zapater 1985; Douches and Ludlam 1991). However, isozyme analysis is reported to be affected by plant developmental stage (Hahn and Grifo 1996), and is also limited by the number of loci that can be used (Karaagac et al. 2014).

DNA-based molecular markers can overcome the above mentioned limitations and have been successfully used in potato fingerprinting. Moreover, to increase the efficiency of breeding programs, molecular markers have also been used for the analysis of genetic relationships in various potato cultivars, allowing breeders to establish a broad genetic base for breeding purposes (Bisognin and Douches 2002). Such markers include random amplified polymorphic DNA (RAPD) (Demeke et al. 1993; Ford and Taylor 1997; Chakrabarti et al. 2001), amplified fragment length polymorphisms (AFLPs) (Milbourne et al. 1997), inter-simple sequence repeats (ISSRs) (Prevost and Wilkinson 1999; Bornet et al. 2002), simple sequence repeats (SSRs) (Raker and Spooner 2002), single nucleotide polymorphisms (SNPs) (Bali et al. 2017) and various combinations of above markers (McGregor et al. 2000; Gorji et al. 2011).

SSR markers are highly polymorphic, co-dominant and the primer sequences are generally well conserved within and between related species (Karaagac et al. 2014). Additional advantages of SSR markers over dominant marker systems are their high heterozygosity and capacity to reflect ploidy status in potato (Ghislain et al. 2004). Many researchers have therefore developed potato SSR markers from genomic libraries and expressed sequence tags (ESTs) databases (Milbourne et al. 1998; Ashkenazi et al. 2001; Ghislain et al. 2004; Feingold et al. 2005; Ghislain et al. 2009). These markers have been extensively used for DNA fingerprinting (Norero et al. 2002; Coombs et al. 2004; Barandalla et al. 2006; Karaagac et al. 2014; Bali et al. 2017), genetic diversity analysis (Chimote et al. 2004; Ispizúa et al. 2007), germplasm migrations (Ríos et al. 2007), and parental analysis (Spanoghe et al. 2015) in potato.

In the present study, SSR markers were used to fingerprint 217 potato cultivars and to analyze the genetic diversity in Chinese germplasm. The data generated will be used for cultivar identification and future germplasm management programs.

Materials and Methods

Plant Material

Among the 217 cultivars included in the study, eight (Atlantic, Favorita, Mira, Katahdin, Kuannae, Epoka, Schwalbe, and Anemone) were imported from other countries, and the remaining 209 were bred by 44 regional breeding programs in China from 1950 to 2007 (Fig. 1, Table 1).
Fig. 1

Map of China showing the geographical distribution of the 44 breeding programs of the cultivars used in the present study. Numbers are cited as map locality in Table 1

Table 1

Cultivars analyzed, parentage, breeding programs and map locations

Code

Cultivar

Parentage

Breeding program

Map locality

1

Changshu 3

Unknown

Potato Research Institute, Heilongjiang Academy of Agricultural Sciences

1

2

Changshu 4

Self inbred progeny of Epoka

Potato Research Institute, Heilongjiang Academy of Agricultural Sciences

1

3

Changshu 5

Unknown

Potato Research Institute, Heilongjiang Academy of Agricultural Sciences

1

4

Kexin 1

374–128 × Epoka

Potato Research Institute, Heilongjiang Academy of Agricultural Sciences

1

5

Kexin 2

Mira×Epoka

Potato Research Institute, Heilongjiang Academy of Agricultural Sciences

1

6

Kexin 3

Mira×Katahdin

Potato Research Institute, Heilongjiang Academy of Agricultural Sciences

1

7

Kexin 4

Anemome×Katahdin

Potato Research Institute, Heilongjiang Academy of Agricultural Sciences

1

8

Kexin 5

Anemome×Katahdin

Potato Research Institute, Heilongjiang Academy of Agricultural Sciences

1

9

Kexin 6

S41956 × 96–56

Potato Research Institute, Heilongjiang Academy of Agricultural Sciences

1

10

Kexin 8

Kexin 4 × Kexin 6

Potato Research Institute, Heilongjiang Academy of Agricultural Sciences

1

11

Kexin 9

(Anemome×Zaopuli) × Duozibai

Potato Research Institute, Heilongjiang Academy of Agricultural Sciences

1

12

Kexin 11

CIP7176 × Epoka

Potato Research Institute, Heilongjiang Academy of Agricultural Sciences

1

13

Kexin 12

Self inbred progeny of Dorita

Potato Research Institute, Heilongjiang Academy of Agricultural Sciences

1

14

Kexin 13

Two generation self inbred progeny of Mira

Potato Research Institute, Heilongjiang Academy of Agricultural Sciences

1

15

Kexin 14

S16–1–1-14-1-3-6-(5) × A-11–1-8-(9)

Potato Research Institute, Heilongjiang Academy of Agricultural Sciences

1

16

Kexin 15

Belmont×Hu 8342–36

Potato Research Institute, Heilongjiang Academy of Agricultural Sciences

1

17

Kexin 16

Beifanghong×KeBP9601

Potato Research Institute, Heilongjiang Academy of Agricultural Sciences

1

18

Kexin 17

F81109 × B5141–6

Potato Research Institute, Heilongjiang Academy of Agricultural Sciences

1

19

Kexin 18

Epoka×374–128

Potato Research Institute, Heilongjiang Academy of Agricultural Sciences

1

20

Kexin 19

Kexin 2 × KPS92–1

Potato Research Institute, Heilongjiang Academy of Agricultural Sciences

1

21

Kexin 20

Fortune×Kexin 2

Potato Research Institute, Heilongjiang Academy of Agricultural Sciences

1

22

Huangmazi

Unknown

Local Cultivar in Wangkui County, Heilongjiang Province

2

23

Jinong 958

Unknown

Jixian Farm, Heilongjiang Province

3

24

Dongnong 303

Anemome×Katahdin

Northeast Agricultural University

4

25

Dongnong 304

S4–5–3-9-1-25-(6) × NS12–156-(1)

Northeast Agricultural University

4

26

Dongnong 305

Atlantic×NS12–156–1-1

Northeast Agricultural University

4

27

Dongnong 306

All Blue

Northeast Agricultural University

4

28

Dongnong 307

DDGS-1

Northeast Agricultural University

4

29

Chunshu 1

Red Warba×Katahdin

Institute of Vegetables and Flowers, Jilin Province

5

30

Chunshu 2

Gaoyuan7 × Katahdin

Institute of Vegetables and Flowers, Jilin Province

5

31

Chunshu 3

S.demissumA6 × Kexin 3

Institute of Vegetables and Flowers, Jilin Province

5

32

Chunshu 4

Wensheng 4 × Kexin 2

Institute of Vegetables and Flowers, Jilin Province

5

33

Chunshu 5

Chunshu 2 × Ke S2–14–1-12-3-(9)

Institute of Vegetables and Flowers, Jilin Province

5

34

Tuqiang 2

Zaopuli×Heilongjiang3

Institute of Vegetables and Flowers, Jilin Province

5

35

Yanshu 4

Liesiji from Moscow

Yanbian Korean Autonomous Prefecture Academy of Agricultural Sciences, Jilin Province

6

36

Liaoling 1

5903–2 × Epoka

Institute of Crop Sciences, Liaoning Academy of Agricultural Sciences

7

37

Jinkengbai

Epoka×Duozibai

Benxi Institute of Agricultural Sciences, Liaoning Province

8

38

Youjin

NS80–31 × 8023–10

Benxi Institute of Agricultural Sciences, Liaoning Province

8

39

Zaodabai

Wulibai×74–128

Benxi Institute of Agricultural Sciences, Liaoning Province

8

40

Chaobai

372–18 × Kexin 3

Dalian Institute of Agricultural Sciences, Liaoning Province

9

41

Zhongda 1

w2/D-6-1

Institute of Vegetables and Flowers of Chinese Academy of Agricultural Sciences. Daxinganling Institute of Agricultural Sciences

10

42

Zhongshu 1

Dongnong 303 × NS79–12-1

Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences

10

43

Zhongshu 2

LT-2 × DTO-33

Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences

10

44

Zhongshu 3

Jingfeng 1 × BF67A

Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences

10

45

Zhongshu 4

Dongnong 3012 × 85 T-13-8

Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences

10

46

Zhongshu 5

Self inbred progeny of ZhongShu 3

Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences

10

47

Zhongshu 6

85 T-13-8 × NS79–12-1

Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences

10

48

Zhongshu 7

Zhongshu 2 × Jizhangshu 4

Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences

10

49

Zhongshu 8

W953 × FL475

Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences

10

50

Zhongshu 9

Shepody×Zhongshu 3

Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences

10

51

Zhongshu 10

F79055 × ND860–2

Institute of Vegetables and Flowers of Chinese Academy of Agricultural Sciences. Potato Research Centre, Agriculture and Agri-Food Canada

10

52

Zhongshu 11

Aminca×Chaleur

Institute of Vegetables and Flowers of Chinese Academy of Agricultural Sciences. Potato Research Centre, Agriculture and Agri-Food Canada

10

53

Zhongshu 12

W953 × FL475

Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences

10

54

Zhongshu 13

Shepody×Zhongshu 3

Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences

10

55

Zhongshu 14

Shepody×Zhongshu 3

Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences

10

56

Zhongxin 24

Unknown

Chinese Academy of Agricultural Sciences

10

57

Bashu 5

Amuxier×Fushanhongyanquan

Zhangjiakou Bashang Institute of Agricultural Sciences, Hebei Province

11

58

Bashu 7

35–131 × 73–21–1

Zhangjiakou Bashang Institute of Agricultural Sciences, Hebei Province

11

59

Bashu 9

Duozibai×Epoka

Zhangjiakou Bashang Institute of Agricultural Sciences, Hebei Province

11

60

Bashu 10

Hutou×Schwalbe

Zhangjiakou Bashang Institute of Agricultural Sciences, Hebei Province

11

61

Hutou

Zishanyao×B76–16 (Xiaoyezi)

Zhangjiakou Bashang Institute of Agricultural Sciences, Hebei Province

11

62

Jizhangshu 3

Ostara

Zhangjiakou Bashang Institute of Agricultural Sciences, Hebei Province

11

63

Kangbingchi

Zishanyao×Epoka

Zhangjiakou Bashang Institute of Agricultural Sciences, Hebei Province

11

64

Shaza 1

Nanjue×Epoka

Zhangjiakou Bashang Institute of Agricultural Sciences, Hebei Province

11

65

Jizhangshu 8

720,087 × X4.4

High Latitude Crops Institute, Hebei Provinces

12

66

Zhangshu 7

Yagana×XY.20

High Latitude Crops Institute, Hebei Provinces

12

67

Hushu 1

Kexin 2 × (Fengshoubai×Duozibai)

Hulun Buir Institute of Agricultural Sciences, Inner Mongolia Autonomous Region

13

68

Hushu 4

Anemome×Changshu 4

Hulun Buir Institute of Agricultural Sciences, Inner Mongolia Autonomous Region

13

69

Hushu 5

Kexin 2 × Duozibai

Hulun Buir Institute of Agricultural Sciences, Inner Mongolia Autonomous Region

13

70

Hushu 8

Hu 8209 × Hudan 81–118

Hulun Buir Institute of Agricultural Sciences, Inner Mongolia Autonomous Region

13

71

Mengshu 9

543 × Hudan 81–149

Hulun Buir Institute of Agricultural Sciences, Inner Mongolia Autonomous Region

13

72

Mengshu 10

Hudan 81–118 × Hudan 80–298

Hulun Buir Institute of Agricultural Sciences, Inner Mongolia Autonomous Region

13

73

Mengshu 12

546 × Hudan 81–149

Hulun Buir Institute of Agricultural Sciences, Inner Mongolia Autonomous Region

13

74

Mengshu 13

Hongwenbai×Hudan 81–149

Hulun Buir Institute of Agricultural Sciences, Inner Mongolia Autonomous Region

13

75

Neishu 7

Hudan 80–298 × Hu 8206

Hulun Buir Institute of Agricultural Sciences, Inner Mongolia Autonomous Region

13

76

Mengshu 11

Unknown

Ulanqab Institute of Agricultural Sciences, Inner Mongolia Autonomous Region

14

77

Wumeng 601

B76–16 (Xiaoyezi) × Duozibai

Ulanqab Institute of Agricultural Sciences, Inner Mongolia Autonomous Region

14

78

Wumeng 684

Fuluduo×Duozibai

Ulanqab Institute of Agricultural Sciences, Inner Mongolia Autonomous Region

14

79

Jinshu 1

Arran Peak×Argo

High Latitude Crops Institute, Shanxi Academy of Agricultural Sciences

15

80

Jinshu 2

Ebro×Industria

High Latitude Crops Institute, Shanxi Academy of Agricultural Sciences

15

81

Jinshu 3

Heishanyao×Kennibaike

High Latitude Crops Institute, Shanxi Academy of Agricultural Sciences

15

82

Jinshu 4

Liwaihaung×Duozibai

High Latitude Crops Institute, Shanxi Academy of Agricultural Sciences

15

83

Jinshu 5

Jinshu 2 × Schwalbe

High Latitude Crops Institute, Shanxi Academy of Agricultural Sciences

15

84

Jinshu 6

Jinshu 2 × Schwalbe

High Latitude Crops Institute, Shanxi Academy of Agricultural Sciences

15

85

Jinshu 7

6401–3-35 × Schwalbe

High Latitude Crops Institute, Shanxi Academy of Agricultural Sciences

15

86

Jinshu 8

Jinshu 2 × NS78–7

High Latitude Crops Institute, Shanxi Academy of Agricultural Sciences

15

87

Jinshu 11

H319–1 × NT/TBULK

High Latitude Crops Institute, Shanxi Academy of Agricultural Sciences

15

88

Jinshu 13

K299 × Jinshu 7

High Latitude Crops Institute, Shanxi Academy of Agricultural Sciences

15

89

Jinshu 14

9201–59 × (6401–3-35 × Schwalbe)

High Latitude Crops Institute, Shanxi Academy of Agricultural Sciences

15

90

Jinshu 15

Jin 11 × 9424–2

High Latitude Crops Institute, Shanxi Academy of Agricultural Sciences

15

91

Jinshu 16

NL94014 × 9333–11

High Latitude Crops Institute, Shanxi Academy of Agricultural Sciences

15

92

Jinshu 17

II-14[8408–22 × (Jinshu 6 × Solanum chacoense)]/NS78–7

High Latitude Crops Institute, Shanxi Academy of Agricultural Sciences

15

93

Tongshu 5

Zishanyao×Epoka

High Latitude Crops Institute, Shanxi Academy of Agricultural Sciences

15

94

Tongshu 9

Liwaihaung×Argo

High Latitude Crops Institute, Shanxi Academy of Agricultural Sciences

15

95

Tongshu 20

(8408–22//Jinshu6/S.chacoense)/NS78–7

High Latitude Crops Institute, Shanxi Academy of Agricultural Sciences

15

96

Tongshu 22

Jinshu 11 × Jinshu 7

High Latitude Crops Institute, Shanxi Academy of Agricultural Sciences

15

97

Tongshu 23

8029-[S2–26–13-(3)]/NS78–4//Helan 7

High Latitude Crops Institute, Shanxi Academy of Agricultural Sciences

15

98

Xishu 1

Self inbred progeny of Duozibai

High Latitude Crops Institute, Shanxi Academy of Agricultural Sciences

15

99

Yanping 1

Lanyan×Katahdin

High Latitude Crops Institute, Shanxi Academy of Agricultural Sciences

15

100

Jinshu 9

Shengli 2 × Schwalbe

Wuzhai Experimental Station, Shanxi Academy of Agricultural Sciences

16

101

Jinshu 10

Self inbred progeny of 81–5-6

Wuzhai Experimental Station, Shanxi Academy of Agricultural Sciences

16

102

Jinshu 12

75–30-7 × Schwalbe

Wuzhai Experimental Station, Shanxi Academy of Agricultural Sciences

16

103

Lupotato 3

BL61–74-167 × And77–1347-280

Institute of Vegetables, Shandong Academy of Agricultural Sciences

17

104

Shuangfeng 4

Co-rina×Fengshoubai

Institute of Vegetables, Shandong Academy of Agricultural Sciences

17

105

Shuangfeng 5

IROSE×Fengshoubai

Institute of Vegetables, Shandong Academy of Agricultural Sciences

17

106

Shuangfeng 6

83,119-(10) × PVY-31

Institute of Vegetables, Shandong Academy of Agricultural Sciences

17

107

Taishan 1

Anemome×(Anemome×Katahdin)

Shandong Agricultural University

18

108

Zhengshu 2

Anemome×Kexin 2

Zhengzhou Institute of Vegetables, Henan Province. Potato Research Institute of Heilongjiang Academy of Agricultural Sciences

19

109

Zhengshu 5

Gaoyuan 7 × Zheng 762–93

Zhengzhou Institute of Vegetables, Henan Province

19

110

Zhengshu 6

Gaoyuan 7 × Zheng 762–93

Zhengzhou Institute of Vegetables, Henan Province

19

111

Zhengshu 7

Favorita×Zhengshu 5

Zhengzhou Institute of Vegetables, Henan Province

19

112

B76–16 (Xiaoyezi)

96–44 × 528–170

Former Central Agricultural Institute

20

113

Fengshou

Huoma×B76–23

Former Central Agricultural Institute

20

114

Wuxia

B76–43(96–44 × 528–170)

Former Central Agricultural Institute

20

115

Shaza 15

Jinpingguo×Duozibai

Yulin Agricultural Research Institute, Shaanxi Provinces

21

116

Annong 5

Self inbred progeny of Hajiao 25

Ankang Institute of Agricultural Sciences, Shaanxi Provinces

22

117

Anshu 56

175 × Kexin 2

Ankang Institute of Agricultural Sciences, Shaanxi Provinces

22

118

Qinyu 30

Epoka×4081

Ankang Institute of Agricultural Sciences, Shaanxi Provinces

22

119

Qinyu 31

Yun 94–51 × 89–1

Ankang Institute of Agricultural Sciences, Shaanxi Provinces

22

120

Wensheng 4

Self inbred progeny of Changshu 4

Ankang Institute of Agricultural Sciences, Shaanxi Provinces

22

121

Ningshu 1

Gan 65–17-1 × Gan 65–15-7

Guyuan Institute of Agricultural Sciences, Ningxia Hui Autonomous Region

23

122

Ningshu 4

Self inbred progeny of Lanhuayangyu

Guyuan Institute of Agricultural Sciences, Ningxia Hui Autonomous Region

23

123

Ningshu 5

Self inbred progeny of 76–2-15

Guyuan Institute of Agricultural Sciences, Ningxia Hui Autonomous Region

23

124

Ningshu 6

Self inbred progeny of BESON

Guyuan Institute of Agricultural Sciences, Ningxia Hui Autonomous Region

23

125

Ningshu 7

Ningshu1 × (Aputa×71–18-2)

Guyuan Institute of Agricultural Sciences, Ningxia Hui Autonomous Region

23

126

Ningshu 8

Self inbred progeny of Shenyanwo

Guyuan Institute of Agricultural Sciences, Ningxia Hui Autonomous Region

23

127

Ningshu 9

Self inbred progeny of 93

Guyuan Institute of Agricultural Sciences, Ningxia Hui Autonomous Region

23

128

Ningshu 10

Self inbred progeny of Dongnong 303

Guyuan Institute of Agricultural Sciences, Ningxia Hui Autonomous Region

23

129

Ningshu 11

Self inbred progeny of Longshu 3

Guyuan Institute of Agricultural Sciences, Ningxia Hui Autonomous Region

23

130

Tianshu 5

Unknown

Tianshui Institute of Agricultural Sciences, Gansu Province

24

131

Tianshu 7

Tianshu 6 × Weihui 2

Tianshui Institute of Agricultural Sciences, Gansu Province

24

132

Tianshu 8

62–118 × DTO-33

Tianshui Institute of Agricultural Sciences, Gansu Province

24

133

Tianshu 9

91–26–116 × 85–6-14

Tianshui Institute of Agricultural Sciences, Gansu Province

24

134

Xindaping

Unknown

Anding Agricultural Technology Center in Dingxi, Gansu Province

25

135

Weishu 1

Weihui4 × Weihui 2

Huichuan Farm inWeiyuan County, Gansu Province

26

136

Weishu 8

Unknown

Huichuan Farm inWeiyuan County, Gansu Province

26

137

Linshu 2

B76–16 (Xiaoyezi) × Ewerest

Linxia Institute of Agricultural Sciences, Gansu Province

27

138

Linshu 3

B76–16 (Xiaoyezi) × Ewerest

Linxia Institute of Agricultural Sciences, Gansu Province

27

139

Linshu 7

Dahongyanwo×Duozibai

Linxia Institute of Agricultural Sciences, Gansu Province

27

140

Gannongshu 2

83–1 × P30–1

Gansu Agricultural University

28

141

Gannongshu 3

Unknown

Gansu Agricultural University

28

142

Kangyi 1

Epoka×3NKNHreH

Institute of Food Crops, Gansu Academy of Agricultural Sciences

29

143

Longshu 1

Cornelia×Changshu 4

Institute of Food Crops, Gansu Academy of Agricultural Sciences

29

144

Longshu 3

35–131 × 73–21–1

Institute of Food Crops, Gansu Academy of Agricultural Sciences

29

145

Longshu 4

62–47/119-ll

Institute of Food Crops, Gansu Academy of Agricultural Sciences

29

146

Longshu 5

Xiaobaihua×119–8

Institute of Food Crops, Gansu Academy of Agricultural Sciences

29

147

Longshu 6

Wushu 86–6-14 × Longshu 4

Institute of Food Crops, Gansu Academy of Agricultural Sciences

29

148

Shengli 1

63–8-27 × 62–1-10

Institute of Food Crops, Gansu Academy of Agricultural Sciences

29

149

Gaoyuan 1

Niutou×Duozibai

Qinghai Academy of Agricultural and Forestry Sciences

30

150

Gaoyuan 2

Duozibai×Mira

Qinghai Academy of Agricultural and Forestry Sciences

30

151

Gaoyuan 4

Duozibai×Mira

Qinghai Academy of Agricultural and Forestry Sciences

30

152

Gaoyuan 5

Shenyanwo×742

Qinghai Academy of Agricultural and Forestry Sciences

30

153

Gaoyuan 6

Niutou×Deyou 4

Qinghai Academy of Agricultural and Forestry Sciences

30

154

Gaoyuan 7

Gaoyuan 4 × Gaoyuan 3

Qinghai Academy of Agricultural and Forestry Sciences

30

155

Qingshu 2

Gaoyuan 4 × magura

Qinghai Academy of Agricultural and Forestry Sciences

30

156

Qingshu 3

Shenyanwo×Gaoyuan 3

Qinghai Academy of Agricultural and Forestry Sciences

30

157

Qingshu 4

Niutou×Desiree

Qinghai Academy of Agricultural and Forestry Sciences

30

158

Qingshu 5

93–5-1 × 92–32-42

Qinghai Academy of Agricultural and Forestry Sciences

30

159

Qingshu 6

Gu33–1 × 92–9-44

Qinghai Academy of Agricultural and Forestry Sciences

30

160

Qingshu 7

92–32-42 × 92–5-2

Qinghai Academy of Agricultural and Forestry Sciences

30

161

Qingshu 8

Qingshu 2 × Tuodu 175

Qinghai Academy of Agricultural and Forestry Sciences

30

162

Qingshu 168

Fushen 6–3 × Desiree

Qinghai Academy of Agricultural and Forestry Sciences

30

163

Xiazhai 65

Gaoyuan 2 × Star

Huzhu Institute of Agricultural Sciences, Qinghai Province.

31

164

Zangshu 1

Self inbred progeny of Bolan 2

Tibet Institute of Agricultural Sciences

32

165

Epotato 1

674–5 × CFK-69.1

Enshi Southern China Potato Research Center, Hubei Province

33

166

Epotato 3

NS7914.33 × E59–5-86

Enshi Southern China Potato Research Center, Hubei Province

33

167

Epotato 4

Ke 6717–36 × Epotato 1

Enshi Southern China Potato Research Center, Hubei Province

33

168

Epotato 5

393,143–12 × NS51–5

Enshi Southern China Potato Research Center, Hubei Province

33

169

Nanzhong 552

Capella×78–7

Enshi Southern China Potato Research Center, Hubei Province

33

170

Xinyu 3

Epoka×Mira

Enshi Southern China Potato Research Center, Hubei Province

33

171

Xinyu 4

Aquila×Epoka

Enshi Southern China Potato Research Center, Hubei Province

33

172

Wannong 4

pontiac×Duozibai

Wanxian Institute of Agricultural Sciences, Sichuan Province

34

173

Wanshu 8

66,116 × Duozibai

Wanxian Institute of Agricultural Sciences, Sichuan Province

34

174

Wanyu 9

Wuxi×Duozibai

Wanxian Institute of Agricultural Sciences, Sichuan Province

34

175

Yupotato 1

8911–3(119–3 × Desiree)

Sanxia Institute of Agricultural Sciences, Chongqing

35

176

Chuanyu 4

C1an-dia × 7XY-1

Crop Research Institute, Sichuan Academy of Agricultural Sciences

36

177

Chuanyu 5

LT-1 × 377,970.3

Crop Research Institute, Sichuan Academy of Agricultural Sciences

36

178

Chuanyu 6

44–4 × Liangshu 3

Crop Research Institute, Sichuan Academy of Agricultural Sciences

36

179

Chuanyu 8

Unknown

Crop Research Institute, Sichuan Academy of Agricultural Sciences

36

180

Chuanyu 10

44–4 × Liangshu 3

Crop Research Institute, Sichuan Academy of Agricultural Sciences

36

181

Chuanyu 39

379,645.4 × 7XY-1

Crop Research Institute, Sichuan Academy of Agricultural Sciences

36

182

Chuanyu 56

36–150 × Schwalbe

Crop Research Institute, Sichuan Academy of Agricultural Sciences

36

183

Chuanyuzao

7032-2-1 × Schwalbe

Crop Research Institute, Sichuan Academy of Agricultural Sciences

36

184

Liangshu 3

Mira×9–49

Xichang Institute of Agricultural Sciences, Sichuan Province

37

185

Liangshu 8

Liangshu 97 × A17

Xichang Institute of Agricultural Sciences, Sichuan Province

37

186

Liangshu 14

Self inbred progeny of Kuannae

Xichang Institute of Agricultural Sciences, Sichuan Province

37

187

Liangshu 17

105–16 × Schwalbe

Xichang Institute of Agricultural Sciences, Sichuan Province

37

188

Liangshu 97

6–36 × Schwalbe

Xichang Institute of Agricultural Sciences, Sichuan Province

37

189

Weiyu 3

Self inbred progeny of Kuannae

Weining Institute of Agricultural Sciences, Guizhou Province

38

190

Lishu 1

Self inbred progeny of Kuannae

Lijiang Institute of Agricultural Sciences, Yunnan Province

39

191

Lishu 2

Huzi 79–172 × NS79–12-1

Lijiang Institute of Agricultural Sciences, Yunnan Province

39

192

YushuCA

377,427.1 × 7xy.1

Dali Seed Company, Yunnan Province

40

193

Zhongdianhong

Unknown

Dali Institute of Agricultural Sciences and Diqing Seed Company, Yunnan Province

41

194

Yunshu 101

S95–105 × Neishu 7

Industrial Crops Research Institute, Yunnan Academy of Agricultural Sciences

42

195

Yunshu 102

S95–105 × Neishu 7

Industrial Crops Research Institute, Yunnan Academy of Agricultural Sciences

42

196

Yunshu 201

S95–105 × Neishu 7

Industrial Crops Research Institute, Yunnan Academy of Agricultural Sciences

42

197

Yunshu 301

93–92 × C89–94

Industrial Crops Research Institute, Yunnan Academy of Agricultural Sciences

42

198

Yunshu 501

Xuan 92–816 × Xuan 94–232

Industrial Crops Research Institute, Yunnan Academy of Agricultural Sciences

42

199

Cooperation 001

True seed from CIP

Huize Agricultural Technology Center and the Root and Tuber Crops Institute of Yunnan Normal University

43

200

Cooperation 002

True seed from CIP

Huize Agricultural Technology Center and the Root and Tuber Crops Institute of Yunnan Normal University

43

201

Cooperation 003

True seed from CIP

Huize Agricultural Technology Center and the Root and Tuber Crops Institute of Yunnan Normal University

43

202

Cooperation 23

True seed from CIP

Huize Agricultural Technology Center and the Root and Tuber Crops Institute of Yunnan Normal University

43

203

Cooperation 88

“I-1085” × BLK2

Huize Agricultural Technology Center and the Root and Tuber Crops Institute of Yunnan Normal University

43

204

Hui-2

Yinxike×Weihui 2

Huize Agricultural Technology Center, Yunnan Province

43

205

Jinguan

Sprout mutation of Favorita

South China Agricultural University

44

206

Hua 525

Unknown

Unknown

 

207

Weibian 94–18

Unknown

Unknown

 

208

Wenchuan 9–1

Unknown

Unknown

 

209

Zhuanxinwu

Unknown

Local Cultivar in Yunnan Province

 

210

Epoka

Stamm913 × Delfin

Imported from Poland

 

211

Anemone

Viola×Flava

Imported from Germany

 

212

Mira

Capella×B.R.A.089

Imported from Germany

 

213

Schwalbe

Aquila×Capella

Imported from Germany

 

214

Favorita

ZPC50–35 × ZPC55–37

Imported from the Netherlands

 

215

Kuannae

Unknown

Imported from Czech Republic

 

216

Atlantic

B5141–6 × Wauseon

Imported from the United States

 

217

Katahdin

USDA24642 × USDA40568

Imported from the United States

 

Sixteen cultivars that represented the most commonly used parental materials in Chinese potato breeding programs before 2007, were used to screen for polymorphic SSR markers. Katahdin and B76-16 (Xiaoyezi) originated from the United States; Mira, Anemone and Schwalbe originated from Germany; Epoka from Poland; Favorita from the Netherlands; DTO-33 from the International Potato Center (CIP); and, Mengshu 10, Chuanyu 6, Xishu 1, Kexin 2, Gaoyuan 7, Zhongshu 3 and Hutou were domestic cultivars.

DNA Extraction and SSR Analysis

Genomic DNA was extracted from 2 g of fresh young leaves according to the modified CTAB procedure of Doyle and Doyle (1987) and quantified using 1% agarose gel electrophoresis. The DNA samples were diluted to 25 ng μL-1 and stored at – 20 °C until use.

A total of 138 markers located on all 12 potato chromosomes were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). The primer sequences of these markers were obtained from previous studies (Ghislain et al. 2004; Feingold et al. 2005). Marker polymorphism was evaluated using the 16 cultivars mentioned above. Polymorphic markers were used to fingerprint and analyze the genetic diversity of 217 potato cultivars.

PCR amplifications were performed in a 20 μL reaction mixture, containing 2.0 μL of 25 ng μL-1 DNA template, 0.8 μL of 10 pmol μL-1 forward primer, 0.8 μL of 10 pmol μL-1 reverse primer, 1.6 μL of 2.5 mmol L-1 dNTPs, 2.0 μL of 10 × PCR buffer, 0.4 μL of Taq DNA polymerase (2.5 U μL-1) (Tiangen Biotech Co., Ltd., Beijing, China), and 12.4 μL of ddH2O. A modified PCR program was used: 5 min at 94 °C, 35 cycles of 30 s at 94 °C, 30 s at SSR specific annealing temperature (53 °C to 64 °C) and 45 s at 72 °C; with a final extension step of 7 min at 72 °C. The PCR products were fractioned on 8% denatured polyacrylamide gel electrophoresis, and stained with silver nitrate.

Data Analysis

A data file was constructed by scoring 0 for absence and 1 for presence of specific amplification product for each sample. The following related genetic parameters were then calculated:
  1. (1).

    Percentage of polymorphic loci p = (k/n) × 100%, where k is the number of polymorphic loci, and n is the total number of measured loci.

     
  2. (2).

    Polymorphic information content (PIC) =\( 1-\sum \limits_1^i{f}_i^2 \), where: fi is the frequency of the ith allele in a locus.

     

Cluster analysis was performed with NTSYS Pc2.11 using the Dice co-efficient (Dice 1945) for calculating similarities and unweighted pair-group arithmetic average method (UPGMA) for constructing dendrograms.

Results

SSR Marker Screening

Among the 138 SSR markers screened on 16 potato cultivars (data not shown), 20 SSR markers generated polymorphism. These 20 markers were used to fingerprint 217 cultivars: a total of 249 alleles were obtained, of which 244 alleles were polymorphic (97.99%). The number of alleles in the 20 loci ranged from seven (primers S7 and S122) to 22 (primer S189) with an average of 12.45. The PIC values for the markers varied from 0.64 (primer S122) to 0.93 (primer S189) with an average of 0.83. The size of amplifications ranged from 80 to 380 bp (Table 2).
Table 2

Summary of 20 SSR markers used in the present study

Primer code

Chromosome location

Repeat

Primer sequences (5′—3′) forward–reverse

Reference

Annealing temperature(°C)

No. of alleles

No. of polymorphic alleles

Ratio of polymorphic alleles (%)

Allele range (bp)

PIC

S122

IX

(ATT)5

GACACGTTCACCATAAAA

AGAAGAATAGCAAAGCAA

Ghislain et al. 2004

53

7

6

85.71

155–185

0.6407

S168

VII

(CTCC)n

CTGCCGCAAAAAGTGAAAAC

TGAATGTAGGCCAAATTTTGAA

Feingold et al. 2005

60

12

12

100

110–165

0.6639

S151

VI

(AAG)n

GCTGCTAAACACTCAAGCAGAA

CAACTACAAGATTCCATCCACAG

Feingold et al. 2005

55

12

12

100

80–153

0.8344

S184

II

(CTT)n

TCATCACAACGTGACCCCA

GGGCTTGAATGATGTGAAGCTC

Feingold et al. 2005

55

17

17

100

160–290

0.8767

S7

II

(CA)imp(TC)imp

GACTGGCTGACCCTGAACTC

GACAAAATTACAGGAACTGCAAA

Feingold et al. 2005

55

7

7

100

135–160

0.8116

S170

VII

(GAA)n

CGCAAATCTTCATCCGATTC

TCCGGCGGATAATACTTGTT

Feingold et al. 2005

58

15

15

100

116–270

0.8623

S118

XII

Compound(GT/GC)(GT)8

AGAGATCGATGTAAAACACGT

GTGGCATTTTGATGGATT

Ghislain et al. 2004

53

11

11

100

115–190

0.8703

S192

III

(ATA)n

ACTTCTGCATCTGGTGAAGC

GGTCTGGATTCCCAGGTTG

Feingold et al. 2005

55

9

8

88.89

160–250

0.7605

S180

VII

(TAA)n

ACTGCTGTGGTTGGCGTC

ACGGCATAGATTTGGAAGCATC

Feingold et al. 2005

55

15

15

100

130–200

0.9081

S174

VII

(AGG)n

TGAGGGTTTTCAGAAAGGGA

CATCCTTGCAACAACCTCCT

Feingold et al. 2005

64

14

14

100

120–195

0.8844

S25

X

(GGC)n(GGT)n

GCGAATGACAGGACAAGAGG

TGCCACTGCTACCATAACCA

Feingold et al. 2005

55

13

12

92.31

180–380

0.8297

S189

IX

(AAG)n

CCTTGTAGAACAGCAGTGGTC

TCCGCCAAGACTGATGCA

Feingold et al. 2005

55

22

22

100

180–380

0.9324

S182

VI

(TCTT)n

GGAAGTCCTCAACTGGCTG

TCAACTATATGCCTACTGCCCAA

Feingold et al. 2005

55

16

16

100

146–270

0.8885

S120

II

(TA)12..(TG)4 GT (TG)5

GTTCTTTTGGTGGTTTTCCT

TTATTTCTCTGTTGTTGCTG

Ghislain et al. 2004

55

9

8

88.89

180–260

0.8130

S187

IV

(AAG)n

CCGTTGATGGGATTGCACA

TGATATTAACCATGGCAGCAGC

Feingold et al. 2005

55

10

10

100

220–380

0.8021

S183

III

(ATA)n

TTCCTCTAAGCGGCAAAAGG

GGAGGAGACTTGGGTTTCTCC

Feingold et al. 2005

55

9

9

100

160–210

0.7833

S162

XI

(CAT)n(TAG)n(AAG)n

TATGGAAATTCCGGTGATGG

GACGGTGACAAAGAGGAAGG

Feingold et al. 2005

64

13

13

100

165–265

0.8839

S153

XII

(GTT)n(GAT)n

TATGTTCCACGCCATTTCAG

ACGGAAACTCATCGTGCATT

Feingold et al. 2005

55

18

18

100

125–190

0.9252

S148

IV

(AAT)n

CAGCAAAATCAGAACCCGAT

GGATCATCAAATTCACCGCT

Feingold et al. 2005

55

12

12

100

180–295

0.8757

S188

II

(TA)n

GACAGAGAATATGGGACCACCA

GCAGCACCTTAAATGGCTGAC

Feingold et al. 2005

55

8

7

87.5

180–235

0.7706

Total

    

249

244

Average

    

12.45

12.2

97.99

0.8309

Construction of DNA Fingerprinting

The 20 polymorphic SSR markers were used to fingerprint 217 cultivars. Eleven markers (S122, S168, S151, S184, S7, S170, S118, S192, S180, S174, and S25) demonstrated high PIC values, high quality amplifications, and were able to differentiate all 217 cultivars (Supplemental Material 1). These markers produced 132 alleles, of which 129 (97.73%) were polymorphic (Table 2). The DNA fingerprint for each cultivar was unique. Figure 2 shows the amplification of 17 potato cultivars by marker S122. The smallest allele amplified by S122 was designated as 1 and the largest allele amplified was designated as 7.
Fig. 2

DNA fragments amplified by SSR marker S122 in 17 potato cultivars

Thirty-one cultivars produced unique alleles with certain markers (Table 3). For Cooperation 001 and Qinyu 31, three markers generated unique alleles. Kexin 20, Cooperation 002, Cooperation 003, Cooperation 88, Jinshu 14 and Zhongdianhong amplified unique alleles with two markers. Only one marker in the remaining 23 cultivars produced unique alleles.
Table 3

List of cultivars that produced unique alleles with certain SSR markers

Cultivar

Marker

Cultivar

Marker

Cultivar

Marker

Kexin 14

S118

Zhongshu 9

S25

Chunshu 4

S25

Kexin 19

S151

Zhongshu 13

S192

Weiyu 3

S184

Kexin 20

S180, S174

Jinshu 14

S7, S118

Liangshu 3

S174

Cooperation 001

S180, S184, S192

Jinshu 16

S170

Xindaping

S118

Cooperation 002

S174, S168

Yunshu 101

S180

Zhongdianhong

S180, S192

Cooperation 003

S7, S174

Yunshu 102

S184

Longshu 3

S170

Cooperation 88

S170, S168

Qinyu 30

S174

Mengshu 10

S151

Qingshu 5

S180

Qinyu 31

S151, S184, S168

Yanshu 4

S7

Qingshu 6

S7

Shuangfeng 4

S118

Jizhangshu 3

S118

Qingshu 7

S25

Shuangfeng 5

S151

  

B76-16 (Xiaoyezi)

S168

Bashu 5

S118

  

Genetic Diversity Analysis

Based on the results from 20 polymorphic SSR markers, a similarity matrix was used to generate a UPGMA dendrogram (Supplemental Material 2). The dendrogram showed that all of the 217 cultivars were closely related and lacked the formation of distinct clusters.

In most cases, the dendrogram grouping fits well with the recorded pedigree information. Cultivars from the same cross usually clustered together, for example, Kexin 4 and Kexin 5 (Anemone X Katahdin); Zhengshu 5 and Zhengshu 6 (Gaoyuan 7 X Zheng 762-93); Zhongshu 8 and Zhongshu 12 (W953 X FL475); and, Yunshu 101, Yunshu 102 and Yunshu 201 (S95-105 X Neishu 7). Cultivars sharing one of the parents also clustered together, such as Kangyi 1, Kangbingchi and Jinkengbai which had Epoka as one of their parents; Wannong 4, Wanshu 8 and Wanyu 9 which had Duozibai as the male parent; and, Chuanyu 39 and Chuanyu 4 which had 7XY.1 as the male parent. Cultivars usually clustered together with their parent(s). As examples, Jinshu 5 and Jinshu 8 clustered with their female parent, Junshu 2; and, Liangshu 8 clustered together with its female parent, Liangshu 97. Most of these 217 cultivars were progeny of cultivars or accessions from the United States, Germany, Poland, the Netherlands, and CIP, and they were distributed in almost all the clusters. There was no obvious clustering trend by their country of origin: perhaps because a few foreign elite lines were used widely as parental clones in most breeding programs.

Nevertheless, the relationship between domestic cultivar distribution and agro-ecological zone could be observed in the UPGMA dendrogram. There are four main potato agro-ecological zones in China, including the northern single cropping zone, the southwest mixed cropping zone, the central double cropping zone and the southern winter cropping zone. Most of the cultivars that were developed in the same cropping zone clustered together. Most of the cultivars from the northern single cropping zone clustered in a large group. Among them, Kexin 19, Dongnong 304, Hushu 5, Kexin 2, Kexin 3, Kexin 13, Kexin 9, Chunshu 5, Hushu 1, Chaobai, Kexin 4, and Kexin 5, all from Northeast China, clustered in one subgroup. Surprisingly, pedigree information revealed that, most of these cultivars were descendants of Mira (one to two generations). Similarly, Qingshu 8, Longshu 1, Wensheng 4, Linshu 7, Xindaping, Ningshu 9, Ningshu 1, Shengli 1, Gaoyuan 7, Weishu 1, Yushu CA, Linshu 3, Weishu 8, Annong 5, Ningshu 6, Kangyi 1, Longshu 3, and Ningshu 7, all from Northwest China, clustered in another subgroup, and they were mostly progeny of the Polish cultivar Epoka and German cultivars Schwalbe and Industria. Cultivars from the southwest mixed cropping zone also clustered in one group, for example, Yunshu 201, Yunshu 102, Yunshu 301, Yunshu 501, Yunshu 101, Chuanyu 6 and Weiyu 3. These cultivars were mainly derived from Mira and neo-tuberosum. Clustering analysis also showed that most of the cultivars that were bred by the same program clustered within the same group, for example, Kexin 2, Kexin 3, Kexin 4, Kexin 5, Kexin 9, Kexin 13, Kexin 14 and Kexin 19 from one breeding program clustered together; Yunshu 201, Yunshu 102, Yunshu 301, Yunshu 501 and Yunshu 101 from another breeding program clustered together.

Discussion

Potato cultivar identification is of great importance for seed production, germplasm management and breeders’ right protection. In this study, we successfully identified 20 polymorphic SSR markers to analyze the fingerprints of 217 potato cultivars grown in China, and 11 of these markers enabled complete differentiation among all the cultivars. Our results indicate that SSR markers have enough power to differentiate the large number of potato cultivars in China. Moreover, genetic diversity analysis of 217 potato cultivars based on 20 polymorphic SSR markers indicates a narrow genetic background in these cultivars.

In our study, the number of alleles per locus (7–22) and PIC values (0.64–0.93) are comparable to the values reported by Ghislain et al. (2004); however, slight differences in these two studies could be attributed to the primer combinations used and the genetic background of the potato cultivars. The study by Ghislain et al. was done on 931 accessions in eight taxonomic groups of cultivated potato ranging from diploids to pentaploids, whereas, our study was done on 217 potato cultivars which were autotetraploid genotypes of different origin (the United States, Germany, Poland, the Netherlands, CIP, Canada, Czech Republic and domestic cultivars).

Previous studies have shown that a small number of SSR markers with high polymorphism could be used to distinguish large numbers of potato varieties. In this study, a subset of 11 SSR markers was sufficient to distinguish all 217 potato cultivars grown in China. Moisan-Thiery et al. (2005) successfully differentiated 286 potato cultivars produced in France with five SSR markers. Reid and Kerr (2007) developed six high polymorphic SSR markers that could differentiate more than 400 cultivars of European germplasm. Ghislain et al. (2009) also developed a potato genetic identification kit to differentiate 93.5% and 98.8% of the 742 landraces using 24 and 51 SSR markers, respectively. Karaagac et al. (2014) reported that 50 tetraploid genotypes could be differentiated with six SSR markers. These studies all indicated that SSR markers can efficiently identify potato germplasm materials at the molecular level. Further, we found that the number of unique alleles amplified by a SSR marker was not directly associated with the number of alleles detected or PIC values. For example, a maximum of six different unique alleles were amplified from six cultivars by marker S118 (Table 3). However, only 11 alleles for this marker were found in the 217 cultivars investigated and its PIC value was 0.87; these were moderate values for both number of alleles and PIC from among the 11 markers used. This finding was in agreement with results of Wang et al. (2003) on maize.

The analysis of genetic diversity of 217 potato cultivars indicated that the genetic base of potato germplasm in China was narrow. The vast majority of potato germplasm resources in China originated from abroad. There’re 288 cultivars released in China during the period from 1950 to 2007, which can be mainly derived from cultivars or accessions from the United States, Germany, Poland, the Netherlands, and CIP. Among them, 100 cultivars were progeny of American cultivars including Katahdin, Early Rose, Houma, Wauseon, Pontiac, Triumph, Atlantic, and B76-16, which account for 34.7% of all the released cultivars in China during this time. 93 cultivars were progeny of German cultivars including Mira, Anemone, Schwalbe, Industria, Jubel, Merkur, Flava, Pepo, Amsel, Apta, and Mitterfrühe, accounting for 32.3%. 53 cultivars were progeny of Polish cultivar Epoka, accounting for 18.4%. Moreover, there’re 20 and 4 cultivars that can be derived from the CIP resources and Netherlands cultivar Favorita, respectively. The other few cultivars were derived from other countries, domestic cultivars, or have unknown pedigree information. Sixteen cultivars we originally selected to screen for SSR marker polymorphism represented most of the germplasm of potato cultivars in China bred from 1950 to 2007.

In China, the use of a limited number of parental lines in the breeding programs may contribute to the narrow genetic base of improved cultivars. For example, six cultivars or accessions of Mira, Katahdin, Epoka, Anemone, Duozibai, and B76-16 (Xiaoyezi) were found repeatedly in the parentage of 74 cultivars released before 1983, accounting for 68.8% of the total cultivars released in that period of time. In this study, cultivars released before 1983 were mostly clustered in one single group. The clustering together of most of the cultivars that came from the same cropping zone or the cultivars that were bred by the same program, strengthens the fact that few elite parental lines have been commonly and repeatedly used in potato breeding programs in China. In contrary, there were some closely related cultivars that did not cluster together in the same group. For example, Cultivar Linshu 2 and Linshu 3 were both bred from the same parents (B76-16 X Everest) but were placed in different groups. This may be attributed to non-specific fingerprints amplified during PCR or incorrect pedigree records for these cultivars.

The cultivated potato is a heterozygous autotetraploid species with four homologous sets of chromosomes (2n=4x=48) (Gebhardt and Valkonen 2001). The selection of parental combinations is mainly dependent on morphological traits like growth habit, yield, resistance and processing quality, and less on pedigree information since the data is often scanty and sometimes incorrect (Braun and Wenzel 2005). However, morphological traits do not always provide a good measure of genetic makeup and may not accurately reveal genetic variation (Tanksley and McCouch 1997). Genetic relatedness measures based on molecular markers may not predict similarity in trait values or parental performance (Jansky et al. 2015). However, in order to improve heterotic effects, better knowledge about the degree of relationship between parents is required. In the present study, SSR markers were used to estimate genetic relationships in tetraploid potato cultivars with known pedigrees. The results showed that the cultivars with similar pedigrees grouped together in most cases. This is in agreement with the results of Braun and Wenzel (2005), who used AFLP and SSR markers to evaluate genetic diversity in the tetraploid potato and to compare the findings with known pedigree information, and they found that in most cases the grouping of related genotypes and the known pedigree information was reflected well in dendrograms. Although our study found a narrow genetic base in the cultivars, breeders could try to choose distinct cultivars grouped in different subclasses as parents to introduce more diversity in the hybrids. In order to further improve the yield and quality of Chinese potato cultivars, it is necessary to extensively increase the genetic basis of the hybrid parents through the introduction and utilization of new germplasm resources.

Notes

Acknowledgments

We thank the 22 breeding programs in China for providing the test materials. This study was supported by National Key R&D Program of China (2017YFD0101905) and China Agriculture Research System (CARS-9).

Author’s Contribution

LJ conceived the project; YD performed the molecular marker analysis; JL and JX conducted part of the experiment; SD collected the materials tested; CB and WP managed the field experiment; GL and JH contributed to the critical revision of the artwork and illustrations. All authors read and approved the final manuscript.

Compliance with Ethical Standards

Conflict of Interest

The authors declare that there are no conflicts of interest.

Supplementary material

12230_2018_9685_MOESM1_ESM.xls (211 kb)
ESM 1 SSR fingerprint database of 217 cultivars with 11 SSR marker combinations 1–217: cultivar codes corresponding with those in Table 1 (XLS 211 kb)
12230_2018_9685_MOESM2_ESM.jpg (23 mb)
ESM 2 Dendrogram of 217 cultivars calculated from 20 SSR marker combinations 1–217: cultivar codes corresponding with those in Table 1. (JPG 23568 kb)

References

  1. Ashkenazi, V., E. Chani, U. Lavi, D. Levy, J. Hillel, and R.E. Veilleux. 2001. Development of microsatellite markers in potato and their use in phylogenetic and fingerprinting analyses. Genome 44 (1): 50–62.CrossRefGoogle Scholar
  2. Bali, S., V. Sathuvalli, C. Brown, R. Novy, L. Ewing, J. Debons, D. Douches, J. Coombs, D. Navarre, J. Whitworth, B. Charlton, S. Yilma, C. Shock, J. Stark, M. Pavek, and N.R. Knowles. 2017. Genetic fingerprinting of potato varieties from the northwest potato variety development program. American Journal of Potato Research 94 (1): 54–63.CrossRefGoogle Scholar
  3. Barandalla, L., J.I. Ruiz de Galarreta, D. Rios, and E. Ritter. 2006. Molecular analysis of local potato cultivars from Tenerife Island using microsatellite markers. Euphytica 152: 283–291.CrossRefGoogle Scholar
  4. Bisognin, D.A., and D.S. Douches. 2002. Genetic diversity in diploid and tetraploid late blight resistant potato germplasm. Horticultural Science 37 (1): 178–183.Google Scholar
  5. Bornet, B., G. Goraguer, G. Joly, and M. Branchard. 2002. Genetic diversity in European and Argentinean cultivated potatoes (Solanum tuberosum subsp. tuberosum) detected by inter-simple sequence repeats (ISSRs). Genome 45: 481–484.CrossRefGoogle Scholar
  6. Braun, A., and G. Wenzel. 2005. Molecular analysis of genetic variation in potato (Solanum tuberosum L.). I. German cultivars and advanced clones. Potato Research 47: 81–92.CrossRefGoogle Scholar
  7. Chakrabarti, S.K., D. Pattanayak, and P.S. Naik. 2001. Fingerprinting Indian potato cultivars by random amplified polymorphic DNA (RAPD) markers. Potato Research 44: 375–387.CrossRefGoogle Scholar
  8. Chimote, V.P., S.K. Chakrabarti, D. Pattanayak, and P.S. Naik. 2004. Semi-automated simple sequence repeat analysis reveals narrow genetic base in Indian potato cultivars. Biologia Plantarum 48 (4): 517–522.CrossRefGoogle Scholar
  9. Coombs, J.J., L.M. Frank, and D.S. Douches. 2004. An applied fingerprinting system for cultivated potato using simple sequence repeats. American Journal of Potato Research 81 (4): 243–250.CrossRefGoogle Scholar
  10. Demeke, T., L.M. Kawchuk, and D.R. Lynch. 1993. Identification of potato cultivars and clonal variants by random amplified polymorphic DNA analysis. American Potato Journal 70: 561–570.CrossRefGoogle Scholar
  11. Dice, L.R. 1945. Measures of the amount of ecologic association between species. Ecology 26: 297–302.CrossRefGoogle Scholar
  12. Douches, D.S., and K. Ludlam. 1991. Electrophoretic characterization of north American potato cultivars. American Potato Journal 68: 767–780.CrossRefGoogle Scholar
  13. Doyle, J.J., and J.L. Doyle. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bull 19: 11–15.Google Scholar
  14. Feingold, S., J. Lloyd, N. Norero, M. Bonierbale, and J. Lorenzen. 2005. Mapping and characterization of new EST-derived microsatellites for potato (Solanum tuberosum L.). Theoretical and Applied Genetics 111 (3): 456–466.Google Scholar
  15. Ford, R., and P.W.J. Taylor. 1997. The application of RAPD markers for potato (Solanum tuberosum L.) cultivar identification in the Australian potato industry. Australian Journal of Agricultural Research 48: 1213–1217.CrossRefGoogle Scholar
  16. Gebhardt, C., and J.P.T. Valkonen. 2001. Organization of genes controlling disease resistance in the potato genome. Annual Review of Phytopathology 39: 79–102.CrossRefGoogle Scholar
  17. Ghislain, M., D.M. Spooner, F. Rodriguez, F. Villamon, J. Nunez, C. Vasquez, R. Waugh, and M. Bonierbale. 2004 Selection of highly informative and user-friendly microsatellites (SSRs) for genotyping of cultivated potato. Theoretical and Applied Genetics 108 (5): 881–890.Google Scholar
  18. Ghislain, M., J. Nunez, M. del Rosario Herrera, J. Pignataro, F. Guzman, M. Bonierbale, and D.M. Spooner. 2009. Robust and highly informative microsatellite-based genetic identity kit for potato. Molecular Breeding 23 (3): 377–388.CrossRefGoogle Scholar
  19. Gibson, S., and A.C. Kurilich. 2013. The nutritional value of potatoes and potato products in the UK diet. Nutrition Bulletin 38 (4): 389–399.CrossRefGoogle Scholar
  20. Gorji, A.M., P. Poczai, Z. Polgar, and J. Taller. 2011. Efficiency of arbitrarily amplified dominant markers (SCOT, ISSR and RAPD) for diagnostic fingerprinting in tetraploid potato. American Journal of Potato Research 88: 226–237.CrossRefGoogle Scholar
  21. Hahn, W.J., and F.T. Grifo. 1996. Molecular markers in plant conservation genetics. In: B.W.S. Sobral (Ed.), The impact of plant molecular genetics. Birkh/iuser, Boston, Chapter 7, 114–136.Google Scholar
  22. Ispizúa, V.N., I.R. Guma, S. Feingold, and A.M. Clausen. 2007. Genetic diversity of potato landraces from northwestern Argentina assessed with simple sequence repeats (SSRs). Genetic Resources and Crop Evolution 54: 1833–1848.CrossRefGoogle Scholar
  23. Jansky, S.H., J. Dawson, and D.M. Spooner. 2015. How do we address the disconnect between genetic and morphological diversity in germplasm collections? American Journal of Botany 102: 1213–1215.CrossRefGoogle Scholar
  24. Karaagac, E., S. Yilma, A. Cuesta-Marcos, and M.I. Vales. 2014. Molecular analysis of potatoes from the pacific northwest tri-state variety development program and selection of markers for practical DNA fingerprinting applications. American Journal of Potato Research 91 (2): 195–203.CrossRefGoogle Scholar
  25. McGregor, C.E., M.M. Greyling, and L. Warnich. 2000. The use of simple sequence repeats (SSRs) to identify commercially important potato (Solanum tuberosum L.) cultivars in South Africa. South African Journal of Plant and Soil 17 (4): 177–179.CrossRefGoogle Scholar
  26. Milbourne, D., R. Meyer, J.E. Bradshaw, E. Baird, N. Bonar, J. Provan, W. Powell, and R. Waugh. 1997. Comparison of PCR-based marker system for the analysis of genetic relationships in cultivated potato. Molecular Breeding 3: 127–136.CrossRefGoogle Scholar
  27. Milbourne, D., R.C. Meyer, A.J. Collins, L.D. Ramsay, C. Gebhardt, and R. Waugh. 1998. Isolation, characterization and mapping of simple sequence repeat loci in potato. Molecular and General Genetics 259: 233–245.CrossRefGoogle Scholar
  28. Moisan-Thiery, M., S. Marhadour, M.C. Kerlan, N. Dessenne, M. Perramant, T. Gokelaere, and Y. Le Hingrat. 2005. Potato cultivar identification using simple sequence repeats markers (SSR). Potato Research 48 (3–4): 191–200.CrossRefGoogle Scholar
  29. Norero, N., J. Malleville, M. Huarte, and S. Feingold. 2002. Cost efficient potato (Solanum tuberosum L.) cultivar identification by microsatellite amplification. Potato Research 45: 131–138.CrossRefGoogle Scholar
  30. Oliver, J.L., and J.M. Martinez-Zapater. 1985. A genetic classification of potato cultivars based on allozyme patterns. Theoretical and Applied Genetics 69: 305–311.CrossRefGoogle Scholar
  31. Prevost, A., and M.J. Wilkinson. 1999. A new system of comparing PCR primers applied to ISSR fingerprinting. Theoretical and Applied Genetics 98: 107–112.CrossRefGoogle Scholar
  32. Qu, D.Y. 2016. China Agriculture Statistical Report. Beijing: China Agriculture Press.Google Scholar
  33. Raker, C.M., and D.M. Spooner. 2002. Chilean tetraploid cultivated potato, Solanum tuberosum, is distinct from the Andean populations: Microsatellite data. Crop Science 42: 1451–1458.CrossRefGoogle Scholar
  34. Reid, A., and E.M. Kerr. 2007. A rapid simple sequence repeat (SSR)-based identification method for potato cultivars. Plant Genetic Resources: Characterization and Utilization 5 (1): 7–13.CrossRefGoogle Scholar
  35. Ríos, D., M. Ghislain, F. Rodriguez, and D.M. Spooner. 2007. What is the origin of the European potato? Evidence from Canary Island landraces. Crop Science 47 (3): 1271–1280.CrossRefGoogle Scholar
  36. Spanoghe, M., T. Marique, J. Rivière, D. Lanterbecq, and M. Gadenne. 2015. Investigation and development of potato parentage analysis methods using multiplexed SSR fingerprinting. Potato Research 58: 43–65.CrossRefGoogle Scholar
  37. Stegemann, H., and D. Schnick. 1985. Index 1985 of European potato varieties. Mitteilungen der Biologische Bundesanstalt 227: 1–128.Google Scholar
  38. Tanksley, S.D., and S.R. McCouch. 1997. Seed banks and molecular maps: Unlocking genetic potential from the wild. Science 277: 1063–1066.CrossRefGoogle Scholar
  39. Vreugdenhil, D. 2007. Potato biology and biotechnology. Amsterdam: Elsevier press.Google Scholar
  40. Wang, F.G., J.R. Zhao, J.L. Guo, H.D. She, and G. Chen. 2003. Comparison of three DNA fingerprint analyzing methods for maize cultivars' identification. Molecular Plant Breeding 1 (5/6): 655–661.Google Scholar

Copyright information

© The Author(s) 2018

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.

Authors and Affiliations

  1. 1.Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences/Key Laboratory of Biology and Genetic Improvement of Tuber and Root CropMinistry of Agriculture and Rural AffairsBeijingChina

Personalised recommendations