Advertisement

Hydrobiologia

, Volume 825, Issue 1, pp 121–136 | Cite as

Analysis of candidate gene expression patterns of adult male Macrobrachium rosenbergii morphotypes in response to a social dominance hierarchy

  • Dania Aziz
  • Md. Lifat Rahi
  • David A. Hurwood
  • Peter B. Mather
CRUSTACEAN GENOMICS

Abstract

In this study, we investigated the relative gene expression pattern of 12 candidate genes from giant freshwater prawn (GFP) using hepatopancreas, eyestalk and testis tissues to compare expression profiles among adult male morphotypes [blue claw (BC), orange claw (OC) and small males (SM)] that reflect a social hierarchy. In particular, we focused our analysis on genes documented in other invertebrate taxa that are known to influence (i) inter-male aggressive behaviour, (ii) visual systems and (iii) olfactory genes. Genes examined here were normalised to 18S rRNA as a reference. Differences in gene expression patterns among male morphotypes and tissues were highly significant (P < 0.0001) with higher expression levels in eyestalk tissue compared with testis and hepatopancreas in all morphotypes. This might imply that differences in expression pattern of key candidate genes in the eyestalk can potentially provide cues to directly influence the formation of the male social dominance hierarchy. Expression stabilities of genes were evaluated using the RefFinder analytical tool, which revealed that STRPC-short transient receptor and BDP-beadex dlmo protein showed relatively similar expression levels. LW OPSIN, a visual system gene, appeared to be directly involved in suppression of subordinate male gene expression related to the social dominance hierarchy in male GFP. This finding could potentially be important for developing technologies that allow male morph frequencies to be manipulated at harvest in farmed stocks.

Keywords

Gene expression QRT-PCR Social dominance hierarchy GFP 

Introduction

Freshwater prawn farming has expanded rapidly, and the industry has become a major contributor to the aquaculture industry globally in terms of both value and quantity (New, 2009). In general, the giant freshwater prawn, or GFP [Macrobrachium rosenbergii (de Man, 1879)], is produced mainly for domestic consumption because of high market familiarity. Because individual size varies at harvest and because of inherent aggressive behaviour, however, GFP cannot be reared intensively in grow-out systems as seen with marine prawns (New & Nair, 2012). Sexually mature, adult males are composed of three male morphotypes: blue clawed males (BC), orange clawed males (OC) and small males (SM). Growth rate varies among the three morph stages that lead to a wide range of individual sizes at harvest that is associated with the male social dominance hierarchy (Ra’anan & Sagi, 1985). GFP farmers and investors have regarded this factor as a major constraint on industry expansion. Due to high market value, research has focused on improving production and performance of farmed GFP, but, in general, little is known currently about the genetics of this species and so most farmed stocks are essentially unimproved.

While agricultural, and more recently, some aquaculture species have shown improvements through the emerging genomic technologies, to date, GFP has not benefitted greatly from the genetics/genomics revolution. Intraspecific communication among conspecifics can play important functions in influencing social hierarchies in prawn populations. If it is possible to modify signals that influence development of the natural dominance hierarchy among adult males, then potentially this knowledge could be used to develop fast-growing, non-aggressive OC forms over slow-growing SM or dominant, aggressive BC forms. An additional benefit would be the reduction of individual size variation while improving total biomass to enhance productivity.

In crustaceans, intraspecific communication is based largely on visual, chemical, and tactile cues (Bushmann, 1999), with chemical signals considered to be of major importance in most aquatic species (Atema & Voigt, 1995). Visual communication in crustaceans commonly involves cues including colour, shape and size of morphological structures or resources that are often linked to elaborate courtship behaviours (Christy et al., 2003). Proteins encoded by key Opsin genes, in complex with retinal chromophores, form visual pigments and control visual sensitivities. The functional link between opsin gene sequence and visual pigment peak absorption has been well documented in protein expression studies in some vertebrate and invertebrate taxa (Cowing et al., 2002; Takahashi & Ebrey 2003; Hunt et al., 2004).

Aggression is a common behaviour seen in many animals, and many species respond to a perceived opponent with a violent, aggressive attack. Animals also alter their behaviour in order to respond to the demands of changing social environments. An abrupt change in intraspecific behaviour from being aggressive to submissive can mark the decision point in social hierarchy formation (Herberholz et al., 2003). Chemical cues or pheromones released passively as a by-product of ecological interactions can provide a rich and reliable source of information that often guides such behavioural decision-making (Wyatt, 2014). Chemical substances or odours (Kr-h1, AmOR11, homovanillyl alcohol, Gp-9, etc.) often play a major role in regulating behaviour and the social life of many animals, including crustaceans, and are usually used for a range of functions including sexual attraction, agonistic interactions and self or conspecific identification (Porter et al., 2013; Berens et al., 2014; Henze & Oakley, 2015).

Transcriptomic and gene expression analyses in recent years have contributed substantially to improving our general understanding of the signalling and metabolic pathways that underlie many developmental and cellular processes (Livak & Schmittgen, 2001; Leelatanawit et al., 2012; Yang et al., 2013; Jiang et al., 2015). Quantitative real- time PCR (qRT-PCR) is currently one of the most powerful and sensitive techniques for analysing gene expression patterns and among several applications (Rahi et al., 2017a), it is often used to validate: RNA-Seq data, output data generated in micro- and macro-arrays of whole genomes and as a primary source for detecting specific gene expression patterns (Maroufi et al., 2010; Rahi 2017).

In our previous M. rosenbergii transcriptome study (Aziz et al., 2017), a list of 40 candidate genes were identified that are likely to be associated with differences between GFP adult male morphotypes. In the current study, we selected 12 of these genes (listed in Table 1) for investigating expression patterns among the male morphotypes. The chosen genes have functional roles in visual perception, or olfactory stimuli, or inter-male aggressive behaviour—traits that logically would be associated with the observed dominance hierarchy. Results from the study can instruct future functional studies that manipulate key genes or that select for gene copies favouring different adult male morphs in GFP that can be applied practically in stock-improvement programmes for the culture industry.
Table 1

Details of candidate genes evaluated, including Unigene ID, gene name, gene symbol, gene function and number of Genbank hits using BLASTX

Unigene ID

Gene name

Gene symbol

Function

#Hits

c94450_g1_i4

18S rRNA

18S

Intracellular part, ribosome

20

c88385_g1_i1

Visual pigment-like receptor peropsin

VPR

Visual perception

20

c76699_g1_i1

x-linked retinitis pigmentosa gtpase regulator

X-linked

Visual perception

20

c77108_g3_i1

OPSIN

OPSIN

Visual perception

20

c31337_g1_i1

Long wave opsin

LW-OPSIN

Visual perception, colour vision

20

c83064_g2_i1

Fatty acid desaturase

FAD

Pheromone biosynthetic process; mating behaviour, sex discrimination; male mating behaviour

20

c14534_g1_i

Short transient receptor potential channel 2-like

STRPC

Inter-male aggressive behaviour; territorial response to pheromone aggressive behaviour;

20

c104749_g1_i1

Beadex dlmo protein

BDP

Response to pheromone; mating behaviour

20

c98951_g1_i3

Pheromone and odorant

PO

Signal transduction; protein coupled receptor signalling pathway

1

c94000_g2_i1

Reticulon-4-like isoform x2

R4

Inter-male aggressive behaviour; olfactory behaviour

20

c76476_g2_i1

Probable ras gtpase-activating

PRGA

Inter-male aggressive behaviour

20

c91623_g1_i3

Lola protein isoform a

LP

Startle response; inter-male aggressive behaviour

20

c10298_g1_i1

Extramacrochaetae protein

EP

Startle response; inter-male aggressive behaviour; involved in compound eye morphogenesis; sex determination, chorion-containing eggshell pattern formation

18

Methodology

Sample collection

Tank experiment and sample collection for the gene expression study were conducted at the Marine Science Centre, Port Dickson, Malaysia. Three different tissues (eyestalk, hepatopancreas and testes) were dissected from each male morphotypes (BC, OC and SM) that had been exposed to different treatments to test their response to visual/chemical signals (Aziz et al., 2017). Dissected tissues from 10 individuals from each morph were immediately preserved in the RNAlater® Solution (Ambion, USA) to maintain stable and intact mRNA levels in the collected samples. Preserved tissues were brought back to the Central Analytical Research Facility (CARF)—Molecular Genetics Research Facility (MGRF) at the Queensland University of Technology for further analysis. Samples at MGRF were kept at − 80°C until further analysis.

RNA extraction, primer designing and qRT-PCR analysis

Total RNA from eyestalk tissues, hepatopancreas and testis were extracted using the Isolate II RNA Mini Kit (Bioline), according to the manufacturer’s instructions. The RNA extraction kit protocol contains an on column DNAse digestion step that provided DNA free total RNA samples. Concentration and quality (quantity and integrity) of each RNA sample was measured using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies) and Bioanalyzer (Agilent 2100, version 6). Thirteen candidate genes, plus the 18S rRNA (reference gene) were selected from our previous study (Aziz et al., 2017) based on functional roles of the genes to investigate the expression pattern (also for validating the roles of these selected genes) in GFP (Table 1). Genes were chosen based on their function in response to visual, olfactory and inter-male aggressive behaviour cues. Primers for the genes were designed using the PCR primer design tool Primer3 applying default parameters. Primer sequences are presented in Table 2.
Table 2

Details of primers designed for candidate genes and product size

Primer name

Sequence

Product size

18S rRNA-F

18S rRNA-R

GCGGTAATTCCAGCTCCA

AGCCTGCTTTGAGCACTCTC

200

VPR-F

TCTTGTGGTGGCCATGTTC

220

VPR-R

GACGAGGTACCGATCGAGAG

 

X-Linked-F

TGTTGACTGAGGATGGTGATG

186

X-Linked-R

GGATGACGATGGAAGACTTGA

 

Opsin-F

TATCTGGACCATGCTTTGGA

210

Opsin-R

GCTGTGGGAGAACTTATCATCA

 

UV-Opsin-F

CCTGGACACCCTATGTCACTC

202

UV-Opsin-R

GAAGCTGCTGATGGTTCACTC

 

LW-Opsin-F

TGTCATATTGGGATAATCCTGCT

196

LW-Opsin-R

ATTCCCATAACGACCATCCA

 

FAD-F

ACGCTCGACGAGGATTCTT

180

FAD-R

GCGACCATGAGAGCAGTCAC

 

STRPC-F

TGAATTTGCCAGCTGTTAAGAA

172

STRPC-R

TGGTGAGGCTGAGTCCTATG

 

BDP-F

TTTGCAAACGAGACTATCTCAGAC

249

BDP-R

CGGACGAATAGGACATGTTG

 

PO-F

TCAGTGCAGCTGCTGAAGAT

260

PO-R

GACAGGCCCTGCATTGTCTA

 

R4-F

TCATGCAGGCAATTCAGAAG

240

R4-R

ACCACGAGCCCAAGTATGTC

 

PRGA-F

GGTCAGGTCAACATCCCTGT

239

PRGA-R

AGGTTCCAGAACTTCGCAGA

 

LP-F

TCTATGTCCACCCCTTCGTC

245

LP-R

TCCTCTTCAATTTCTGCAGGT

 

EP-F

AGGCAGGAGCGACAAGAAAT

236

EP-R

AGAGCCTGCAAGCTGAAGAT

 

First-strand cDNA was synthesised using a SensiFAST cDNA Synthesis Kit (Bioline) according to the manufacturer’s instructions and the SensiFAST SYBR No-ROX Kit (Bioline) was used for real-time PCR. PCR mixtures contained 1 μL of diluted cDNA (corresponding with 1 ng of starting amount of RNA for all genes), 10 μL of 2 × SensiFAST SYBR No-ROX Kit (Bioline), and 400 nM of each gene-specific primer in a final volume of 20 μL. qRT-PCRs were performed in a Corbett Rotor Gene Real time PCR machine. All PCRs were performed under the following conditions: 2 min at 95°C, and 40 cycles of 5 s at 95°C and 10 s at 65°C in 96-well optical reaction plates. Specificity of amplicons was verified by melt curve analysis (60–95°C) after 40 cycles with the elongation step at 72°C for 20 s. Three biological replicates of each sample were used for qRT-PCR analysis and five technical replicates were run for each biological sample.

Gene expression stability analyses and statistics

The 2−ΔΔCT method (Schmittgen and Livak, 2008) was used as a relative quantification strategy for qRT-PCR data analysis. Expression stability of candidate genes was examined using qbase + (Hellemans et al., 2007) software that calculates for each gene, a measure of expression stability based on average pairwise variation between all genes tested. Quality filtering, data visualisation and correlation plots were also performed in this program.

The performance of potential reference genes was analysed utilising RefFinder (Kim et al., 2010), a web-based comprehensive tool that includes four commonly used algorithms: (i) geNorm (Vandesompele et al., 2002); (ii) NormFinder (Andersen et al., 2004); (iii) BestKeeper (Pfaffl et al., 2004); and (iv) the comparative ΔCT method (Peltier & Latham, 2008). These applications were used to comprehensively compare and rank candidate genes under consideration.

Statistical analysis of normalised CT values (ΔCT) was performed in SPSS 23.0 (IBM SPSS Statistics 23.0, IBM Corporation, Somers, NY, USA (George & Mallery, 2016). A three-way ANOVA analysis including male morphotype, tissue type and signal as factors were followed by multiple comparison post hoc Tukey’s test. Differences were considered significant at P < 0.05 (two-tailed test).

Results

Gene expression

Relative gene expression levels of individual genes varied among tissue types and among male morphotype comparisons (i.e. SM/OC, SM/BC, OC/BC) (Fig. 1). Table 3 presents overall up- and down- regulated gene expression patterns among adult male morphotypes.
Fig. 1

Relative gene expression, 2−ΔΔCt in a eyestalk, b hepatopancreatic tissue, and c testis for 12 candidate genes. The blue bars in each chart represent relative expression level in OC males as the fold change calculated against SM males, the red bars show the expression in BC males when compared with SM males, while the green bars show expression in BC males when compared with OC males

Table 3

Relative gene expression levels in three tissue types (eyestalk, hepatopancreas and testis) in male morphotypes

 

Eyestalk

Hepatopancreas

Testis

SM/OC

SM/BC

OC/BC

SM/OC

SM/BC

OC/BC

SM/OC

SM/BC

OC/BC

SM

OC

SM

BC

OC

BC

SM

OC

SM

BC

OC

BC

SM

OC

SM

BC

OC

BC

VPR

U

D

U

D

D

U

U

D

D

U

D

U

D

U

D

U

D

U

X-linked

U

D

U

D

U

D

D

U

D

U

D

U

U

D

D

U

D

U

OPSIN

U

D

U

D

D

U

D

U

U

D

U

D

U

D

U

D

D

U

LW OPSIN

U

D

U

D

D

U

U

D

D

U

D

U

U

D

U

D

D

U

FAD

U

D

U

D

D

U

D

U

D

U

D

U

U

D

D

U

D

U

STRPC

U

D

U

D

D

U

U

D

D

U

D

U

U

D

D

U

D

U

BDP

U

D

U

D

D

U

D

U

D

U

D

U

U

D

D

U

D

U

PO

U

D

U

D

D

U

D

U

D

U

D

U

U

D

D

U

D

U

R4

U

D

U

D

D

U

D

U

D

U

U

D

U

D

D

U

D

U

PRGA

U

D

U

D

D

U

U

D

D

U

D

U

U

D

D

U

D

U

LP

U

D

U

D

U

D

U

D

U

D

U

D

D

U

D

U

D

U

EP

U

D

U

D

D

U

U

D

D

D

D

U

U

D

D

U

D

U

U UPREGULATED; D  DOWNREGULATED

Fold change in the expression in the eyestalk (Fig. 1a) was substantially upregulated in dominant males (BC) compared to OC males for most genes, while it was marginally downregulated in subordinate SM male comparisons. Expression levels in BC individuals were generally upregulated, for visual, olfactory and inter-male aggressive behaviour genes, while upregulated genes in OC and SM males were associated only with visual and behavioural genes. STRPC was differentially expressed among male morphotypes and was upregulated in SM and BC males and downregulated in OC males. OPSIN, LW OPSIN genes and VPR (subgroup of opsin gene) were upregulated in SM and BC males and downregulated in OC males. Genes that were upregulated in the eyestalk in OC males included X-linked gene, and LP. BDP was significantly downregulated in eyestalk tissue in all three adult male morphotypes.

The level of candidate gene expression in the hepatopancreas (Fig. 1b) was, in general, downregulated in OC males and upregulated in both SM and BC males. Expression levels of VPR (a visual gene) and LP (an inter-male aggressive behaviour involved in startle response in prawns) in OC males were only upregulated in comparison with SM males but were still expressed at lower levels than in BC males (SM < OC < BC). Olfactory and inter-male aggressive behaviour genes, expressed in the hepatopancreas, were all upregulated but only in dominant male morphs. PRGA and LP, genes associated with aggressive behaviour were highly upregulated in hepatopancreas in dominant males, while visual genes (OPSIN and LW OPSIN) were upregulated in SM and BC males with expression levels higher in SM compared with BC individuals and downregulated in OC males. Genes that were upregulated in OC males and expressed in the hepatopancreas included VPR and LP which are genes involved in visual and inter-male aggressive behaviour.

Figure 1c shows the levels of candidate gene expression in the testis. Genes were mainly upregulated in BC males, with a few also upregulated in OC males. In general, olfactory and visual genes were generally upregulated in BC males, but behaviour genes were generally downregulated. We also observed that genes associated with olfaction (production of, or response to pheromones) were found to be highly upregulated in both SM and BC males. While for SM and OC males, genes associated with visual and inter-male aggressive behaviour were highly downregulated in these morphs and upregulated only in BC males. LP was downregulated in the testis in subordinate males and upregulated in dominant male morphs suggesting that this gene could play a part in social interactions among male prawns.

In general, levels of candidate gene expression between BC and SM males were similar and upregulated in particular, in SM eyestalk tissue, while in the testis and hepatopancreas for BC males. OPSIN and LW OPSIN visual genes showed consistent upregulation in the order OC < BC < SM in the hepatopancreas and the eyestalk but showed a different morph order in testis. Opsin in testis was expressed and upregulated in the order BC < SM < OC, while LW OPSIN showed the reverse pattern (OC < SM < BC). LW OPSIN a gene involved in colour intensity perception and colour vision was highly expressed in SM individuals in all tissues. All genes linked to pheromone production or response (FAD, STRPC, PO and BDP) were upregulated in the order of OC < SM < BC in the testis and hepatopancreas and OC < BC < SM in the eyestalk, respectively. The inter-male aggressive behaviour gene (PRGA), was highly expressed in all sampled tissues and mostly upregulated in BC males. PRGA was downregulated in all three tissues in OC males. The inter-male aggressive behaviour gene EP was highly expressed in subordinate males (OC and SM) and upregulated in eyestalk and testis in BC males.

Examination of fold change can provide meaningful insights regarding morph development and morphotype transition. Background noise in gene expression levels was largely excluded when only fold changes above 1.5 were compared (Table 4). As fold change level increased to ≥ 2, the number of genes showing significant differences between morphs decreased. Most of the fold changes ≥ 2 were seen in SM eyestalk, BC testis and BC hepatopancreas, respectively. Overall, levels of gene expression in OC males were the lowest across the three tissue types with a mean fold change of only 1.123. The highest mean fold change was observed in eyestalk tissue in SM males (2.9 fold).
Table 4

Relative expression value (2−∆CT) of candidate genes across tissues and male morphotypes

 

SH

ST

SE

OH

OT

OE

BH

BT

BE

VPR

1.043 ± 0.159

1.463 ± 0.608

1.628 ± 0.742

1.347 ± 0.511

1.124 ± 0.234

1.091 ± 0.222

1.401 ± 0.541

2.467 ± 2.062

1.448 ± 0.802

X-linked

1.056 ± 0.203

1.270 ± 0.386

2.148 ± 1.026

1.030 ± 0.134

1.301 ± 0.403

1.372 ± 0.508

1.222 ± 0.3856

2.082 ± 0.433

1.005 ± 0.070

OPSIN

1.629 ± 0.746

1.316 ± 0.392

2.686 ± 0.381

1.076 ± 0.178

1.317 ± 0.420

1.032 ± 2.304

1.241 ± 0.392

1.144 ± 0.447

1.211 ± 0.131

LW OPSIN

1.271 ± 0.475

1.354 ± 0.446

3.731 ± 3.400

1.045 ± 0.161

1.024 ± 0.134

1.085 ± 0.233

1.254 ± 0.463

1.437 ± 0.710

1.590 ± 0.848

FAD

1.194 ± 0.445

1.033 ± 0.126

1.781 ± 1.277

1.149 ± 0.359

1.072 ± 0.198

1.078 ± 0.202

1.234 ± 0.446

1.251 ± 0.533

1.396 ± 0.699

STRPC

1.060 ± 0.212

1.194 ± 0.364

8.591 ± 8.374

1.007 ± 0.059

1.176 ± 0.366

1.282 ± 0.430

1.353 ± 0.542

1.319 ± 0.716

1.325 ± 0.604

BDP

1.113 ± 0.314

1.059 ± 0.173

1.078 ± 0.291

1.004 ± 0.046

1.170 ± 0.334

1.015 ± 0.081

1.175 ± 0.318

1.921 ± 0.847

1.032 ± 0.181

PO

1.122 ± 0.260

1.070 ± 0.226

2.066 ± 1.625

1.028 ± 1.017

1.190 ± 0.362

1.022 ± 0.109

1.160 ± 0.312

1.204 ± 0.538

1.184 ± 0.510

R4

1.117 ± 0.325

1.062 ± 0.214

1.664 ± 1.163

1.028 ± 0.121

1.244 ± 0.387

1.089 ± 0.227

1.138 ± 0.345

1.233 ± 0.363

1.139 ± 0.403

PRGA

1.120 ± 0.322

1.252 ± 0.414

4.234 ± 5.755

1.060 ± 0.165

1.081 ± 0.228

1.065 ± 0.181

3.125 ± 2.755

2.190 ± 1.766

1.653 ± 1.316

LP

1.012 ± 0.084

1.475 ± 0.653

3.536 ± 3.202

1.029 ± 0.124

1.218 ± 0.356

1.203 ± 0.363

1.521 ± 0.590

1.045 ± 0.200

1.055 ± 0.248

EP

1.235 ± 0.464

1.327 ± 0.521

2.206 ± 1.760

1.031 ± 0.131

1.166 ± 0.274

1.163 ± 0.317

1.261 ± 0.380

1.188 ± 0.512

1.287 ± 0.670

SH SM hepatopancreas, ST SM testis, SE SM eyestalk, OH OC hepatopancreas, OT OC testis, OE OC eyestalk, BH BC hepatopancreas, BT BC testis, BE BC eyestalk

Tests of comparison of means for all signals (visual, olfactory and aggressive behaviour) and tissue types showed fold change was highest in eyestalk tissue with a mean fold change of 1.903 for olfactory genes, 1.669 for visual genes and 1.775 for aggressive behaviour genes, respectively. Differences between levels in general, however, were small and non-significant (P > 0.05).

Statistical analysis

A three-way ANOVA that compared means across morphotypes (SM, OC, BC), tissue type (hepatopancreas, testis, eyestalk) and signal (visual, olfactory, aggressive behaviour) revealed no significant difference between factors in gene expression level (P = 0.964). A similar result was also obtained for these comparisons that also were not significant (P > 0.05): (i) fold change response to signal (P = 0.979) (ii); fold change response to interaction between morphotype and signal (P = 0.960); and (iii) fold change response to interaction between the tissues type and signal (P = 0.861).

However, highly significant differences in gene expression levels among male morphotypes (P < 0.05) were observed for: (i) fold change response in different morphotypes (P = 0.002); (ii) fold change response to different tissue type (P = 0.007); and (iii) fold change response to interaction between morphotype and tissue (P < 0.0001).

Post hoc tests, while not significant, identified differences in groupings of tissue type, with testis and hepatopancreas forming one subset and eyestalk a second subset. PCR results show that expression level in eyestalk was generally higher than in testis but the result was not significant (1.782 fold, P > 0.05). Post hoc tests for morphotype were not significant but showed that OCs (1.1226 fold, P > 0.05) and BCs (1.4134 fold, P > 0.05) formed a single group while SM formed a second group (1.783 fold, P > 0.05). Post hoc tests to categorise group for signal showed no significant difference among groups.

Gene-stability measures and ranking of selected reference genes

A stability value for each candidate gene was estimated and genes that were more stable in expression are indicated by lower average expression stability values (Tables 5, 6, 7). Expression stability varied significantly among male morphotypes and among tissues. In the hepatopancreas, the gene that exhibited the most stable level of expression was X-linked with a comprehensive stability value of 1.68 in all software estimates (Table S1), BDP in the testis (2.89) (Table S2) and STRPC in the eyestalk (2.30) (Table S3). In general, the RefFinder analysis revealed that the genes with the lowest expression stability were LP expressed in the hepatopancreas and LW OPSIN in the testis. FAD in the eyestalk showed the highest stability level applying all four algorithms. BDP and STRPC emerged as the most stably expressed genes as they ranked in the top five in all three male morphotypes. This indicates that potentially they could be used as reference genes for social dominance assessments in GFP.
Table 5

RefFinder showing the ranking of candidate genes by relative expression stability in hepatopancreatic tissue by calculation using 4 algorithms

Method

1

2

3

4

5

6

7

8

9

10

11

12

Delta CT

STRPC

X-linked

BDP

OPSIN

FAD

PRGA

PO

LW

R4

EP

LP

VPR

BestKeeper

EP

BDP

VPR

X-linked

STRPC

PRGA

PO

LW

OPSIN

FAD

R4

LP

Normfinder

X-linked

STRPC

BDP

OPSIN

FAD

PRGA

PO

LW

EP

R4

LP

VPR

Genorm

X-linked | BDP

 

STRPC

OPSIN

FAD

PRGA

PO

R4

LW

EP

LP

VPR

Recommended comprehensive

ranking

X-linked

BDP

STRPC

OPSIN

EP

FAD

PRGA

PO

LW

VPR

R4

LP

Table 6

RefFinder showing the ranking of candidate genes by relative expression stability in testis by calculation using 4 algorithms

Method

1

2

3

4

5

6

7

8

9

10

11

12

Delta CT

R4

BDP

PRGA

PO

X-linked

STRPC

LP

VPR

OPSIN

EP

FAD

LW

BestKeeper

EP

STRPC

OPSIN

PO

BDP

R4

PRGA

LW

X-linked

VPR

LP

FAD

Normfinder

BDP

R4

PRGA

PO

STRPC

X-linked

OPSIN

EP

LP

VPR

FAD

LW

Genorm

VPR | LP

 

X-linked

FAD

PRGA

R4

BDP

PO

STRPC

OPSIN

EP

LW

Recommended comprehensive ranking

BDP

R4

PRGA

PO

STRPC

LP

VPR

X-linked

EP

OPSIN

FAD

LW

Table 7

RefFinder showing the ranking of candidate genes by relative expression stability in eyestalk tissue by calculation using 4 algorithms

Method

1

2

3

4

5

6

7

8

9

10

11

12

Delta CT

STRPC

BDP

OPSIN

VPR

PO

LP

PRGA

R4

LW

X-linked

EP

FAD

BestKeeper

EP

VPR

OPSIN

STRPC

PO

BDP

LP

X-linked

LW

PRGA

R4

FAD

Normfinder

STRPC

BDP

VPR

OPSIN

PO

PRGA

R4

LP

LW

X-linked

EP

FAD

Genorm

OPSIN | LP

 

LW

BDP

VPR

STRPC

R4

PRGA

PO

EP

X-linked

FAD

Recommended comprehensive ranking

STRPC

OPSIN

BDP

VPR

LP

PO

EP

LW

PRGA

R4

X-linked

FAD

Correlation plots

The qbase + software permits comparisons of expression profiles of different genes to be portrayed as correlation plots. Plots are presented in logarithmic scale, with correlation coefficients calculated based on log10 transformed results. As Spearman rank correlations are based on ranked results, correlation coefficients do not change as a function of axis scale. Gene expression in reference genes were compared with 18S rRNA expression, and the correlation results were plotted after log10 transformation. A positive correlation was observed for all genes except for VPR, X-linked, STRPC and BDP. This indicates that there was a positive relationship between all candidate genes and 18S rRNA in levels of gene expression, while the relationship was negative with the other four genes, respectively. Differences in expression level tested between all genes and the reference gene were mostly significant (P < 0.05). The low value of the coefficient (Table 8), however, suggests that level of gene expression for all candidate genes were fairly low when normalised to the reference gene that was highly expressed.
Table 8

Statistical analysis results comparing gene expression levels between candidate genes and a reference gene. r presents correlation coefficients with associated p-values

Gene vs 18S rRNA

Spearman correlation coefficients

18S rRNA

r = 1.000, P = 0.000

VPR

r = − 0.196, P = 0.201

X-linked

r = − 0.160, P = 0.305

OPSIN

r = 0.099, P = 0.519

LW OPSIN

r = 0.063, P = 0.682

FAD

r = 0.171, P = 0.278

STRPC

r = − 0.172, P = 0.275

BDP

r = − 0.103, P = 0.508

PO

r = 0.105, P = 0.495

R4

r = 3.300E−2, P = 0.833

PRGA

r = 1.519E−2, P = 0.927

LP

r = 0.080, P = 0.606

EP

r = 0.106, P = 0.497

Discussion

Tissues extracted in our study (eyestalk, testis and hepatopancreas) were carefully chosen based on functional differential gene expression associated with visual, olfactory and aggressive behaviour functions identified in earlier studies of other taxa (Pan et al., 2005; Leelatanawit et al., 2009; Maruska & Fernald, 2011). It is well known that crustacean eyestalk secretes an abundance of hormones associated with vision (sight), visual perception and the eyestalk is also the centre of the neurosecretory X-organ/sinus gland complex (Webster et al., 2012). Higher expression levels of the visual genes in the eyestalk tissue in this study, clearly indicate the important role of these genes in GFP for regulatory activities. Moreover, differences in expression levels of these genes among males clearly indicate the role of these genes in male morphotype formation.

Light of different wavelengths and bandwidths can have various stimulatory effects on a given photoreceptor, and the mismatch and combination of more than one visual pigment potentially may allow prawn individuals to discriminate between different spectral characteristics. Visual genes examined here were abundantly expressed in tissues according to the rank eyestalk > testis > hepatopancreas. OPSIN and VPR, both have a role in light detection while X-linked associated with night blindness and visual field constriction as a degenerative process that can culminate in complete loss of sight, at least in humans (Zito et al., 1999). LW OPSIN is believed to contribute to an intense night time increase in the sensitivity of the lateral eye to light (Barlow, 1977), and thus may be involved with searching for food in the dark/low light (Barlow, 1982). In response to ambient light levels, many lower vertebrates darken or lighten their body colouration by regulating dispersion or aggregation, respectively, of melanin granules (melanosomes) in the melanophore. This physiological reaction is mediated by photoreception by their eyes, and the melanophores themselves, depending on species and their relative developmental stage (Coohill et al., 1970). LW OPSIN is believed to play a specific and important role in colour vision in particular, in response to the colours red and blue/green (Donner et al., 2016). Gene expression levels of LW OPSIN expressed in eyestalk and hepatopancreas were high and upregulated in SMs > BCs > OCs. This suggests that SMs potentially may be very alert to visual displays provided by dominant (BC) and subdominant (OC) males that are blue and orange in colour, respectively. Perhaps when these signals from dominant individuals are absent or at low levels, SMs may respond and transform into the next morphotype stage. Thus, LW OPSIN could provide a good candidate for trialling gene silencing to potentially manipulate the ratio of adult male morphotypes in a farmed GFP population.

Visual genes (VPR, OPSIN, and LW OPSIN) expressed mostly in the eyestalk were highly upregulated in all SM males. This suggest that subordinate males that are non-territorial may monitor their surrounding environment actively, potentially to protect themselves from attacks by dominant males, and need also to be alert to increase their chances of mating with receptive females. SM males are fertile and practice a sneak mating strategy (Ra’anan & Sagi, 1985). VPR, OPSIN, and LW OPSIN genes in BCs were also upregulated but were expressed at lower relative levels compared with SMs. This may reflect their territorial behaviour; to be on the lookout for, and to guard, receptive females prior to mating. Diaz & Thiel (2004) observed a similar pattern in rock shrimp where they documented that subordinate males form a “tumult” (agitated accumulations) whenever they approach receptive females. These visual cues are easily detected by dominant rock shrimp males indicating a strong correlation between mating strategy (in which dominant males exploit receptive females) and sexual communication/signals. Earlier studies by Bruski & Dunham (1987) also reported that visual cues are important for efficient communication during crayfish agonistic encounters. Visual display of large and colourful claws (blue and orange) has been reported previously to help determine the social hierarchy between dominant and subordinates male adult GFP (Grafals et al., 2000).

Expression patterns of genes that are known to be associated with pheromone production or response (FAD, STRPC, PO and BDP) in other taxa. In the current study, these genes were upregulated in GFP males in the order of BC > SM > OC in both testis and hepatopancreas and SM > BC > OC in eyestalk. These results may imply that the genes likely play very similar functional roles in GFP as well. FAD showed different expression levels among male morphotypes in all tissues studied with testis showing the highest expression level compared with other tissues. This reflects a relatively stable fatty acid composition in the testis. FAD plays an important role during development in decapod crustaceans and has been suggested to play a key role in pheromone biosynthetic processes, sex discrimination and mating behaviour in male prawns (Jiang et al., 2016). Li et al. (2011) studied the effect of different dietary lipid sources on growth and gonadal maturation of pre-adult female freshwater crayfish Cherax quadricarinatus (Von Martens, 1868). During reproduction, a large amount of fatty acids is required to provide for essential needs during development of the gonad, with another fraction of basic fatty acids also crucial for gonad maturation and brood quality. This potentially could explain high expression of FAD in BC and SMs observed for GFP as both morphs are more sexually active compared with OC males. BDP and STRPC both showed high, stable expression in all three sampled tissue types and they could be considered among the top five genes for pheromone production and regulation in GFP and broadly in crustaceans. BDP was upregulated in both BC and OC and downregulated in SM males with a fold change approaching 2 for BDP expressed in the testis in BC males (1.921). This indicates that SMs have been suppressed by dominant males in response to the release of a pheromone that may control transition to the next morphotype stage. Apart from response to chemical cues, STRPC has also been associated with inter-male aggressiveness, territorial aggressiveness and mating in other species. This may be reflected in GFP as STRPC was more highly expressed in SM and BC males that are sexually active males with a very high fold change of expression level (8.591) in SMs (expressed in the eyestalk), while this gene was downregulated in OC males.

Products of biochemical processes commonly direct chemical communication between individuals in crustaceans. These cues that are commonly released in urine can carry reliable information regarding identification of an individual, sex, reproductive status, and condition. Christy & Rittschof (2010) speculated that subordinate males in species that possess a social dominance hierarchy with multiple male morphotypes may hide from dominant males by not releasing male odours or by mimicking odours produced by females to protect themselves. SM males in the current study, showed downregulation of olfactory genes (highly expressed in testis) that were mainly upregulated in dominant BC and OC individuals. This could reflect this phenomenon whereby inhibition of olfactory genes in SM individuals is mediated by stimuli released by higher ranking males. A study by Berry & Breithaupt (2008) reported that male freshwater crayfish can distinguish between conspecific male and female odours. Findings here differ from the results reported on studies of crayfish sex pheromones because the apparent effects seen in this study relate to male–male not male–female interactions (Dunham, 1978; Itagaki & Thorp, 1981; Stebbing et al., 2003).

Another interesting finding from the current study relates to the patterns of gene expression of genes involved with aggressive behaviour. Aggressive behaviour, or agonistic interactions, are common in many species, where they often play a crucial role in competition for space, shelter, and access to food and mates. Consequently, at the end of an agonistic encounter a social relationship may be formed resulting in dominant and subordinate individuals, effectively forming a social dominance hierarchy. Differences in expression levels of candidate genes involved with male aggression (i.e., BDP, STRPC, etc.) among different males and tissues of GFP, indicate important roles of these genes in social dominance hierarchy formation.

Behavioural responses to chemical cues have been demonstrated in a range of aquatic animals. A study by Berry & Breithaupt (2010) reported correlations between intraspecific chemical cues and aggressive behaviour in both sexes of a freshwater crayfish and suggested that urine release has evolved as an aggressive signal in both females and males. Hormones often play a functional role in social recognition among individuals in a population. Aggressive behaviour and fights are longer and prolonged with higher intensity over time in freshwater crayfish when urine cues are absent in the medium than when urine cues are present. In addition, a study by Schneider et al. (2001) stated that urine cue plays a role in social recognition; where in the absence of urine, male aggression and fights are longer and more intense. Palaoro et al. (2013) also demonstrated male aggression can be altered by the presence of female chemical cues, where in their study, male aggression was downregulated by female receptivity. Communication via urine can play an important role in agonistic interactions. Likewise, communication via visual signals often is related to aggressive, competitive and sexual interactions in many animals.

In the current study, genes involved with aggressive behaviour were highly expressed in eyestalk tissue (R4, PRGA, LP and EP) and in general, up regulated in BC and SM males while being down regulated in OC males. Aggressive behaviour in BC and SM males could be linked to mating strategies as these constitute the most reproductively active male GFP morphs. When SM males are exposed to an aggressive encounter initiated by a visual display (large size, colour), this likely excites sets of visual interneurons that may mediate a submissive behavioural response to protect individuals from dominant males (Kravitz & Huber, 2003). This probably results in avoidance or escape behaviour. Since OCs are not very sexually active, expression of this type of gene would likely be downregulated as observed here. LP, a behavioural gene involved with startle response and inter-male aggression, was upregulated in the hepatopancreas in dominant BC males and downregulated in both OC and SM males. So, if relative level of aggression is a primary function of this gene in males, it could potentially provide a candidate for trialling genome editing to disrupt gene expression patterns in BC males to reduce natural aggressive behaviour.

Our results show significant variation in the expression levels of 12 candidate genes. All candidate genes tested showed a higher fold change (up- and downregulation) in gene expression (− 2.5 to 3) compared with the reference gene (18S rRNA). Statistical analysis revealed that fold change interaction between signals (visual, olfactory and aggressive behaviours), morphotype and tissue were not significantly different and their mean differences showed that the factors did not affect the overall level of gene expression.

Fold change was independent of the concurrent signals, but was highly significant depending on tissue type and morphotype. This appears to represent overall multimodal signalling in which one signal provides a context that a perceiver can interpret and then respond accordingly. Levels of gene expression were higher, however, for visual and aggressive behaviour genes that were abundant in eyestalk tissue which suggests that visual cues influence transition of OC to BC male morph because they were expressed more highly compared with olfactory genes and in other tissues. A review by Salmon (1983) stated that when visual signals are used as cues in the aquatic environment, they are often accompanied by chemical cues providing a plausible explanation for the similar stimuli effects on fold change observed here. Further study and investigation are warranted to clarify this issue.

In general, a much larger number of genes (8 genes out of 12) screened here were highly upregulated in dominant BC individuals compared with downregulated genes. In particular, this pattern was evident for relevant eyestalk genes with the same genes mostly downregulated in OC males.

Development of male morphotype is obviously a complex process, and subtle changes in gene expression during development likely impact a cascade of signalling pathways that affect morphotype differentiation. Thus, in order to detect small but significant changes in gene expression pattern, normalisation using highly stable candidate genes is crucial. Moreover, application of modern genomic tools is also useful to characterise specific genes, detect functional roles and to precisely detect variation in expression levels. This can be achieved using recently developed modern gene-editing tools (knock-out) including Transcription activator-like effector nucleases (TALENs) (Gaj et al., 2013) or clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) systems (Cong et al., 2013) or via gene silencing (knock-down), e.g. RNA interference (RNAi). When genes are silenced, their expression levels are reduced significantly (Mocellin & Provenzano, 2004). In contrast, when genes are knocked out, they cannot be expressed as they are lost to the genome. Patterns of gene expression in targeted candidate genes in the current study provide a base to selectively target-specific genes to alter their functional expression levels in adult male GFP morphotypes. If successful, this approach could be used (at least in theory) to modify natural morphotype ratios in GFP culture stocks that, in turn, could change total harvestable biomass levels. Furthermore, results here provide a resource for targeted gene expression studies that investigate effects of visual and/or olfactory cues on the GFP adult male social dominance hierarchy and provide a foundation for developing a better understanding of gene expression patterns among male adult GFP morphotypes.

Conclusions

The current study represents the first large-scale gene expression study to investigate the expression levels and important functional roles for specific candidate genes involved in the formation of the male social dominance hierarchy in GFP. Findings reported here suggest that visual in addition to aggressive behaviour genes potentially play roles in mediating the social dominance hierarchy of GFP adult male morphotypes. Levels of gene expression were abundant and highest in the eyestalk, thus this tissue offers a major target for candidate genes involved in visual display and perception influencing transition of OC to BC male with high expression and upregulated evident in BC males and downregulation in OC males. Multimodal signalling information from olfactory genes (upregulation and higher expression in the testis) were also involved in response to visual cues in subordinate males leading to the suppression of morphotype formation in the OC compared to SMs. This process, however, was not considered to be a primary cue for transition to BC male. Reference genes identified here will enable more accurate normalisation and quantification of gene expression in GFP male morphotypes and be useful for designing primer pairs that target key visual, olfactory and behavioural genes in other crustacean species. More importantly, they indicate that changes in the social dominance hierarchy can be influenced potentially by modifying genetic coding content to optimise adult male morphotype bias in GFP.

Notes

Acknowledgements

The authors would like to gratefully acknowledge the support provided by Marie Curie International Research Staff exchange Scheme Fellowship within the 7th European Community Framework Programme (612296-DeNuGReC) and the help from Central Analytical Research Facility (CARF) at the Queensland University of Technology with the qRT-PCR labwork and analysis. We would also like to thank the staff of the Marine Science Center, Port Dickson in Malaysia for the help in the sample collection, and Vincent Chand for his assistance and technical support in QUT’s CARF-genomics lab. The manuscript has been greatly improved through helpful comments from two anonymous reviewers. This project was supported by an International Postgraduate Research Scholarship (Australia) and an Australia Postgraduate Award Grant awarded to Dania Aziz (N8724768).

Supplementary material

10750_2018_3721_MOESM1_ESM.pdf (46 kb)
Supplementary material 1 (PDF 46 kb)

References

  1. Andersen, C. L., J. L. Jensen & T. F. Ørntoft, 2004. Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Research 64: 5245–5250.CrossRefGoogle Scholar
  2. Atema, J. & R. Voigt, 1995. Behaviour and sensory biology. In Factor, J. R. (ed.), The Biology of the Lobster, Homarus americanus. Academic Press, New York: 313–348.CrossRefGoogle Scholar
  3. Aziz, D., T. V. Nguyen, M. L. Rahi, D. A. Hurwood & P. B. Mather, 2017. Identification of genes that potentially affect social dominance hierarchy in adult male giant freshwater prawns (Macrobrachium rosenbergii). Aquaculture 476: 168–184.CrossRefGoogle Scholar
  4. Barlow, G. W., 1977. Modal action patterns. In Sebeok, T. A. (ed.), How Animals Communicate. Indiana University Press, Indianapolis: 98–134.Google Scholar
  5. Barlow, H. B., 1982. What causes trichromacy? A theoretical analysis using comb-filtered spectra. Vision Research 22: 635–643.CrossRefGoogle Scholar
  6. Berens, A. J., J. H. Hunt & A. L. Toth, 2014. Comparative transcriptomics of convergent evolution: different genes but conserved pathways underlie case phenotype across lineages of eusocial insects. Molecular Biology and Evolution 32: 690–703.CrossRefGoogle Scholar
  7. Berry, F. & T. Breithaupt, 2008. Development of behavioural and physiological assays to assess discrimination of male and female odours in crayfish, Pacifastacus leniusculus. Behaviour 145: 1427–1446.CrossRefGoogle Scholar
  8. Berry, F. C. & T. Breithaupt, 2010. To signal or not to signal? Chemical communication by urine-borne signals mirrors sexual conflict in crayfish. BMC Biology 8: 25.CrossRefGoogle Scholar
  9. Bruski, C. A. & D. W. Dunham, 1987. The importance of vision in agonistic communication of the crayfish Orconectes rusticus. Behaviour 103: 83–107.CrossRefGoogle Scholar
  10. Bushmann, P. J., 1999. Concurrent signals and behavioural plasticity in blue crab (Callinectes sapidus Rathbun) courtship. The Biological Bulletin 197: 63–71.CrossRefGoogle Scholar
  11. Christy, J. H. & D. Rittschof, 2010. Deception in visual and chemical communication in crustaceans. Chemical Communication in Crustaceans. Springer, New York: 313–333.CrossRefGoogle Scholar
  12. Christy, J. H., P. R. Y. Backwell & U. Schober, 2003. Interspecific attractiveness of structures built by courting male fiddler crabs: experimental evidence of a sensory trap. Behavioral Ecology and Sociobiology 53: 84–91.Google Scholar
  13. Cong, L., F. A. Ran, D. Cox, S. Lin, R. Barretto, N. Habib, P. D. Hsu, X. Wu, W. Jiang, L. A. Marraffini & F. Zhang, 2013. Multiplex genome engineering using CRISPR/Cas systems. Science 339: 819–823.CrossRefGoogle Scholar
  14. Coohill, T. P., C. K. Bartell & M. Fingerman, 1970. Relative effectiveness of ultraviolet and visible light in eliciting pigment dispersion directly in melanophores of the fiddler crab, Uca pugilator. Physiological Zoology 43: 232–239.CrossRefGoogle Scholar
  15. Cowing, J. A., S. Poopalasundaram, S. E. Wilkie, P. R. Robinson, J. K. Bowmaker & D. M. Hunt, 2002. The molecular mechanism for the spectral shifts between vertebrate ultraviolet- and violet-sensitive cone visual pigments. Biochemical Journal 367: 129–135.CrossRefGoogle Scholar
  16. De Man, J. G., 1879. On some species of the genus Palaemon Fabr. with descriptions of two new forms. Notes from the Leyden Museum 41: 165–184.Google Scholar
  17. Diaz, E. R. & M. Thiel, 2004. Chemical and visual communication during mate searching in rock shrimp. The Biological Bulletin 206: 134–143.CrossRefGoogle Scholar
  18. Donner, K., P. Zak, M. Viljanen, M. Lindström, T. Feldman & M. Ostrovsky, 2016. Eye spectral sensitivity in fresh-and brackish-water populations of three glacial-relict Mysis species (Crustacea): physiology and genetics of differential tuning. Journal of Comparative Physiology A 202: 297–312.CrossRefGoogle Scholar
  19. Dunham, P. J., 1978. Sex pheromones in Crustacea. Biological Reviews 53: 555–583.CrossRefGoogle Scholar
  20. Gaj, T., C. A. Gersbach & C. F. Barbas, 2013. ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends in Biotechnology 31: 397–405.CrossRefGoogle Scholar
  21. George, D. & P. Mallery, 2016. IBM SPSS Statistics 23 Step by Step: A Simple Guide and Reference. Routledge, New York.CrossRefGoogle Scholar
  22. Grafals, M., M. A. Sosa, C. M. Hernandez & J. A. Inserni, 2000. Role of serotonin and octopamine in aggressive behavior in the freshwater prawn Macrobrachium rosenbergii. FASEB Journal 14: A546.Google Scholar
  23. Hellemans, J., G. Mortier, A. De Paepe, F. Speleman & J. Vandesompele, 2007. qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data. Genome Biology 8: R19.CrossRefGoogle Scholar
  24. Herberholz, J., M. M. Sen & D. H. Edwards, 2003. Parallel changes in agonistic and non-agonistic behaviours during dominance hierarchy formation in crayfish. Journal of Comparative Physiology A 189: 321–325.Google Scholar
  25. Henze, M. J. & T. H. Oakley, 2015. The dynamic evolutionary history of Pancrustacean eyes and opsins. Integrative and Comparative Biology 55: 830–842.CrossRefGoogle Scholar
  26. Hunt, D. M., J. A. Cowing, S. E. Wilkie, J. W. Parry, S. Poopalasundaram & J. K. Bowmaker, 2004. Divergent mechanisms for the tuning of shortwave sensitive visual pigments in vertebrates. Photochemical and Photobiological Sciences 3: 713–720.CrossRefGoogle Scholar
  27. Itagaki, H. & J. H. Thorp, 1981. Laboratory experiments to determine if crayfish can communicate chemically in a flow-through system. Journal of Chemical Ecology 7: 115–126.CrossRefGoogle Scholar
  28. Jiang, H., Z. Qian, W. Lu, H. Ding, H. Yu, H. Wang & J. Li, 2015. Identification and characterization of reference genes for normalizing expression data from red swamp crawfish Procambarus clarkii. International Journal of Molecular Sciences 16: 21591–21605.CrossRefGoogle Scholar
  29. Jiang, H., X. Li, Y. Sun, F. Hou, Y. Zhang, F. Li, Z. Gu & X. Liu, 2016. Insights into sexual precocity of female oriental river prawn Macrobrachium nipponense through transcriptome analysis. PloS ONE 11: e0157173.CrossRefGoogle Scholar
  30. Kim, M., M. Gee, A. Loh & N. Rachatasumrit, 2010. Ref-finder: A refactoring reconstruction tool based on logic query templates. In: Proceedings of the Eighteenth ACM SIGSOFT International Symposium on Foundations of Software Engineering, FSE 2010. ACM, New York: 371–372.Google Scholar
  31. Kravitz, E. A. & R. Huber, 2003. Aggression in invertebrates. Current opinion in neurobiology 13: 736–743.CrossRefGoogle Scholar
  32. Leelatanawit, R., K. Sittikankeaw, P. Yocawibun, S. Klinbunga, S. Roytrakul, T. Aoki, I. Hirono & P. Menasveta, 2009. Identification, characterization and expression of sex-related genes in testes of the giant tiger shrimp Penaeus monodon. Comparative Biochemistry and Physiology Part A: Molecular and Integrative Physiology 152: 66–76.CrossRefGoogle Scholar
  33. Leelatanawit, R., A. Klanchui, U. Uawisetwathana & N. Karoonuthaisiri, 2012. Validation of reference genes for real-time PCR of reproductive system in the black tiger shrimp. PLoS ONE 7: e52677.CrossRefGoogle Scholar
  34. Li, J. Y., Z. L. Guo, X. H. Gan, D. L. Wang, M. F. Zhang & Y. L. Zhao, 2011. Effect of different dietary lipid sources on growth and gonad maturation of pre-adult female Cherax quadricarinatus (von Martens). Aquaculture Nutrition 17: e853–e860.CrossRefGoogle Scholar
  35. Livak, K. J. & T. D. Schmittgen, 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-ΔΔC(T)) Method. In: Methods. San Diego, CA: 25: 402–408.Google Scholar
  36. Maroufi, A., E. Van Bockstaele & M. De Loose, 2010. Validation of reference genes for gene expression analysis in chicory (Cichorium intybus) using quantitative real-time PCR. BMC Molecular Biology 11: 15.CrossRefGoogle Scholar
  37. Maruska, K. P. & R. D. Fernald, 2011. Social regulation of gene expression in the hypothalamic-pituitary-gonadal axis. Physiology 26: 412–423.CrossRefGoogle Scholar
  38. Mocellin, S. & M. Provenzano, 2004. RNA interference: learning gene knock-down from cell physiology. Journal of Translational Medicine 2: 1–6.CrossRefGoogle Scholar
  39. New, M. B., 2009. History and global status of freshwater prawn farming. In: Freshwater Prawns: Biology and Farming. Blackwell Science, Oxford: 194: 16–40.Google Scholar
  40. New, M. B. & C. M. Nair, 2012. Global scale of freshwater prawn farming. Aquaculture Research 43: 960–969.CrossRefGoogle Scholar
  41. Palaoro, A. V., L. A. Peres & S. Santos, 2013. Modulation of male aggressiveness through different communication pathways. Behavioral Ecology and Sociobiology 67 (2): 283–292.CrossRefGoogle Scholar
  42. Pan, D., N. He, Z. Yang, H. Liu & X. Xu, 2005. Differential gene expression profile in hepatopancreas of WSSV-resistant shrimp (Penaeus japonicus) by suppression subtractive hybridization. Developmental and Comparative Immunology 29: 103–112.CrossRefGoogle Scholar
  43. Peltier, H. J. & G. J. Latham, 2008. Normalization of microRNA expression levels in quantitative RT-PCR assays: identification of suitable reference RNA targets in normal and cancerous human solid tissues. RNA 14: 844–852.CrossRefGoogle Scholar
  44. Pfaffl, M. W., A. Tichopad, C. Prgomet & T. P. Neuvians, 2004. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: bestKeeper–Excel-based tool using pair-wise correlations. Biotechnology Letters 26: 509–515.CrossRefGoogle Scholar
  45. Porter, M. L., D. I. Speiser, A. K. Zaharoff, R. L. Caldwell, T. W. Cronin & T. H. Oakley, 2013. The evolution of complexity in the visual systems of stomatopods: insights from transcriptomics. Integrative and Comparative Biology 53: 39–49.CrossRefGoogle Scholar
  46. Ra’anan, Z. & A. Sagi, 1985. Alternative mating strategies in male morphotypes of the freshwater prawn Macrobrachium rosenbergii (De Man). The Biological Bulletin 169: 592–601.CrossRefGoogle Scholar
  47. Rahi, M. L., 2017. Understanding the molecular basis of adaptation to freshwater environments by prawns in the genus Macrobrachium. PhD Thesis, Science and Engineering Faculty, Queensland University of Technology.  https://doi.org/10.5204/thesis.eprints.118051.
  48. Rahi, M. L., S. Amin, P. B. Mather & D. A. Hurwood, 2017. Candidate genes that have facilitated freshwater adaptation by palaemonid prawns in the genus Macrobrachium: identification and expression validation in a model species M. koombooloomba. PeerJ 5: e2977.CrossRefGoogle Scholar
  49. Salmon, M., 1983. Courtship mating system and sexual selection in decapods. In Rebach, S. & D. Dunham (eds), Studies in Adaptations. John Wiley and Sons, New York: 143–169.Google Scholar
  50. Schmittgen, T. D. & K. J. Livak, 2008. Analyzing real-time PCR data by the comparative CT method. Nature Protocols 3: 1101–1108.CrossRefGoogle Scholar
  51. Schneider, R. A., R. Huber & P. A. Moore, 2001. Individual and status recognition in the crayfish, Orconectes rusticus: the effects of urine release on fight dynamics. Behaviour 138: 137–153.CrossRefGoogle Scholar
  52. Stebbing, P. D., M. G. Bentley & G. J. Watson, 2003. Mating behaviour and evidence for a female released courtship pheromone in the signal crayfish Pacifastacus leniusculus. Journal of Chemical Ecology 29: 465–475.CrossRefGoogle Scholar
  53. Takahashi, Y. & T. G. Ebrey, 2003. Molecular basis of spectral tuning in the newt short wavelength sensitive visual pigment. Biochemistry 42: 6025–6034.CrossRefGoogle Scholar
  54. Vandesompele, J., K. De Preter, F. Pattyn, B. Poppe, N. Van Roy, A. De Paepe & F. Speleman, 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biology 3: 1–12.CrossRefGoogle Scholar
  55. Von Martens, E., 1868. Ueber einige neue Crustaceen und ueber die neuhollaendischen Suessvasserkrebse. Monatsbericte der Deutschen Akademie der Wissenschaften zu Berlin 1868: 608–619.Google Scholar
  56. Webster, S. G., R. Keller & H. Dircksen, 2012. The CHH-superfamily of multifunctional peptide hormones controlling crustacean metabolism, osmoregulation, moulting, and reproduction. General and Comparative Endocrinology 175: 217–233.CrossRefGoogle Scholar
  57. Wyatt, T. D., 2014. Pheromones and Animal Behaviour: Chemical Signals and Signatures, 2nd ed. Cambridge University Press, Cambridge: 419.Google Scholar
  58. Yang, Y. N., H. Ye, H. Huang, S. Li, X. Zeng, J. Gong & X. Huang, 2013. Characterization and expression of SpHsp60 in hemocytes after challenge to bacterial, osmotic and thermal stress from the mud crab Scylla paramamosain. Fish and Shellfish Immunology 35: 1185–1191.CrossRefGoogle Scholar
  59. Zito, I., D. L. Thiselton, M. B. Gorin, J. T. Stout, C. Plant, A. C. Bird, S. S. Bhattacharya & A. J. Hardcastle, 1999. Identification of novel RPGR (retinitis pigmentosa GTPase regulator) mutations in a subset of X-linked retinitis pigmentosa families segregating with the RP3 locus. Human Genetics 105: 57–62.CrossRefGoogle Scholar

Copyright information

© Springer Nature Switzerland AG 2018

Authors and Affiliations

  1. 1.Science and Engineering Faculty, School of Earth, Environmental and Biological SciencesQueensland University of TechnologyBrisbaneAustralia

Personalised recommendations