Advertisement

European Journal of Plant Pathology

, Volume 155, Issue 4, pp 1363–1366 | Cite as

Role of avian vectors in the spread of Phytophthora species in Poland

  • Tadeusz MalewskiEmail author
  • Barbara Brzezińska
  • Lassaad Belbahri
  • Tomasz Oszako
Open Access
Article
  • 865 Downloads

Abstract

Phytophthora is an important plant pathogen that can cause serious damage in a wide range of forest species. Understanding how this pathogen disseminates is fundamental to disease management. There is a continual need for improvement of Phytophthora species monitoring in natural ecosystems. However, currently there is little evidence for whether avian vectors may be transporting spores and contributing to the spread of the pathogen. This is the first survey of birds as vectors of Phytophthora species. Analysis of swabs from feathers from 112 birds belonging to seven species showed that most of them transmit P. cactorum and to a lesser extent P. plurivora. Pathogens of black alder − P. alni and P. multiformis were detected in the investigated area, but their frequency was low. This study showed that avian vectors are important in spreading Phytophthora. In addition, analysis of swabs from feathers can be sensitive method for detection of Phytophthora presence in ecosystems.

Keywords

Phytophthora Black alder Birds Ecology Real time PCR 

Black alder Alnus glutinosa (L.) Gaertn. is an important forest−forming species in Poland, comprising more than 5% of the species composition and is introduced into the habitat of boggy coniferous and broadleaved forests. Until recently, black alder was considered in Poland as a species with a very low level of susceptibility to pests and diseases. The situation changed at the turn of the century, when the deterioration of the health status of the alder stands began, which locally led to the mass dieback of the trees. The strongest deterioration of health condition of trees was observed in east of Poland (Piętka and Grzywacz 2018).

Among the plant pathogens potentially implicated in this dieback, Phytophthora stands out with a significant number of species proven to be aggressive agents that threaten ecosystems stability and plant productivity (Erwin and Ribeiro 1996; Rizzo et al. 2005). Phytophthora alni is especially aggressive to alder, but in Poland, a survey of Phytophthora associated with alder decline revealed that besides of P. alni some other species P. cactorum, P. cinnamoni, P. gonapodyides, P. lacustris, P. megasperma, P. plurivora, P. pseudosyringae and P. syringae were also isolated (Trzewik et al. 2015)). Among them P. cactorum and P. plurivora are the most widespread (Erwin and Ribeiro 1996; Schoebel et al. 2014).

Phytophthora spreads mainly through the movement of infested soil, water, and infected plant material (Cahill et al. 2008), although there are species that are transmitted aerially (Goodwin 1997). Avian vectors may also play an important role in transport of Phytophthora, however, there have been very few studies carried out to examine these possibilities (Hubálek 1974; Keast and Walsh 1979). The aim of this study is to determine significance of birds in the dispersal of Phytophthora species.

Swabs from feathers on the throat and belly area were collected during the bird ringing in east of Poland at the Siemianówka reservoir (52.909710 N, 23.849740 E) and in Gruszki (Browsk Forest District 52,825,370 N, 23,796,180 E) during January–February 2017. The Siemianówka reservoir is an important refuge for breeding birds, as well as the place of their stopping and feeding during seasonal migrations. Gruszki is situated at the border of Białowieża Forest. Genomic DNA was extracted from the samples using PureLink Microbiome DNA Purification Kit (ThermoFisher Scientific, Waltham, MA, USA) following the manufacturer’s instructions. Amplification of the internal transcribed spacer 1 region was performed as described previously in P. cactorum and P. plurivora (Nowakowska et al., 2017) and in P. multiformis (Nowakowska et al. 2016). Primers and probe used for identification of P. alni was designed at this study: forward primer - ctgtcgatgtcaaagttg, reverse – atgggtttaaaagataaggg, probe - acccaaacgctcgccatgata. As positive controls were used DNA isolated from DNA extracted from mycelial cultures of Phytophthora (Nowakowska et al. 2017). Briefly, qPCR reaction was performed in a 20 μl volume containing 1 μM each primer (forward and reverse), 10 μl 2x qPCR probe Master Mix (Sigma-Aldrich, Milwaukee, WI, USA) and 2 μl of genomic DNA as template. Thermocycling conditions consisted of initial denaturation at 95 °C for 3 min, and 40 cycles at 95 °C for 30 s, at 55 °C for 30 s and at 72 °C for 30 s. Amplifications were performed using a RotorGene 6000 (Qiagen, Hilden, Germany) following the manufacturer’s instructions. Ct values less than 40 were considered a positive detection response.

Swabs from feathers on the throat and belly area collected from 112 birds belonged to seven species: Chloris chloris (n = 22), Carduelis spinus (n = 18), Parus ater (n = 6), Parus caeruleus (n = 31), Parus major (n = 28), Parus montanus (n = 7) and Parus palustris (n = 3). Pathogens of black alder were detected in investigated area at low frequency. P. alni was found in two samples from Parus major and one from Parus caeruleus; P. multiformis in one sample from Parus major and one from Parus caeruleus. Frequency of Phytophthora transmission by different bird species are presented in Fig. 1.
Fig. 1

Frequency of P. cactorum and P. plurivora transmission by different bird species

In contrast species known to be pathogenic on alder, P. cactorum and P. plurivora were frequently detected. Out of 112 analyzed specimens 95 (84.8%) carried P. cactorum and 35 (31.2%) P. plurivora. The highest transmission rate was detected in Eurasian siskin (Carduelis spinus), European greenfinch (Chloris chloris) and blue tit (Parus caeruleus). 90.9% of Ch. chloris, 94.4% of C. spinus and 90.3% of Parus caeruleus transferred P. cactorum. The lowest frequency of transmission of P. cactorum was observed in Parus ater (50%) and Parus montanus (57.1%). The frequency of P. plurivora transferring by Parus ater and Parus montanus was similar to P. cactorum, while the transfer by other bird species was 3–4 fold lower.

Our experiment clearly demonstrated that birds can transmit Phytophthora and that frequency of transmission was dependent on bird species. The European greenfinch is found in woodland edges, farmland hedges and gardens. The Eurasian siskin is found in forested areas, both coniferous and mixed woodland, where it feeds on seeds of all kinds. The Eurasian siskin has an unusual migration pattern, as every few years in winter it migrates southwards in large numbers. Alder and spruce seeds are their natural food supplies through the winter and when this food diminish through the winter, siskins make their way into gardens to find food (Clement 1999). Being birds feeding on predominantly seed goldfinches do need to drink more than most other species so the availability of water is essential to their life success. This may explain very high transmission rate of Phytophthora by these bird species. The coal tit (P. ater) and the willow tit (P. montanus) are confined to coniferous forest, which is their preferred habitat (Ekman 1979). The coal and willow tits are all−year residents making only local movements in response to particularly severe weather. The great tit (P. major), the marsh tit (P. palustris) and the blue tit (P. caeruleus) are bound to deciduous forests. In coniferous forests P. montanus forages in the inner canopy, while P. ater forages in the outer parts of tree crowns. Because of their different habitat requirements, there is little interference between the two groups of species. These species are separated ecologically mainly by their different foraging zones in trees (Alatalo et al. 1985; Alatalo and Moreno 1987). At present time we do not know why Phytophthora plurivora, which is the most common species in Poland, was generally found 2-fold less frequently than Phytophthora cactorum. Two bird species were revealed as an exception from this rule: P. ater and P. montanus, sharing equal frequency of aforementioned pathogenic species.

Detection of DNA does not determine if the pathogen is able to cause infection or not. Chlamydospores of Phytophthora cinnamomi can survive within the intestinal tract of golden whistler (Pachycephala pectoralis) and a rufus whistler (P. rufiventris) (Keast and Walsh 1979), however there are no reports about survival of other Phytophthora species. Investigation of viability of the spores will be important step in investigation of Phytophthora transmission by birds.

Notes

Acknowledgements

We are grateful the National Centre for Research and Development (NCBiR), the grant No 240 327 for its financial support.

Compliance with ethical standards

Conflict of interest

All authors declare no conflict of interest.

Human and animals rights

No human and/or animal participants were involved in this research.

Informed consent

All authors consent to this submission.

References

  1. Alatalo, R. V., & Moreno, J. (1987). Body size, interspecific interactions, and use of foraging sites in tits (Paridae). Ecology, 68, 1773–1777.CrossRefGoogle Scholar
  2. Alatalo, R.V., Gustafsson, L., Linden, M., & Lundberg A. (1985). Interspecific competition and niche shifts in tits and the goldcrest: an experiment. Journal of Animal Ecology, 54, 977–984.Google Scholar
  3. Cahill, D.M., Rookes, J.E., Wilson, B. A, Gibson, L., & McDougall, K.L. (2008). Phytophthora cinnamomi and Australia’s biodiversity: impacts, predictions and progress towards control. Australian Journal of Botany, 56, 279–310.Google Scholar
  4. Clement, P. (1999). Finches and sparrows. Princeton: Princeton University Press.Google Scholar
  5. Ekman, J. (1979). Coherence, composition and territories of winter social groups of the Willow Tit Parus montanus and the crested tit P. cristatus. Ornis Scandinavica 10, 56–68.CrossRefGoogle Scholar
  6. Erwin, D. C., & Ribeiro, O. K. (1996). Phytophthora disease worldwide. St. Paul: American Phytopathological Society Press.Google Scholar
  7. Goodwin, S. B. (1997). Population genetics of Phytophthora. Phytopathology, 87, 462–473.CrossRefGoogle Scholar
  8. Hubálek, Z. (1974). Fungi associated with free−living birds in Czechoslovakia and Yugoslavia. Acta Scientiarum Nataralium Academiae Scientiarum Bohemoslovacae (Brno) 8, 1974. Nova Series, 3, 1–71.Google Scholar
  9. Keast, D., & Walsh, L. G. (1979). Passage and survival of chlamydospores of Phytophthora cinnamomi Rands, the causal agent of forest dieback disease, through the gastrointestinal tracts of termites and wild birds. Applied and Environmental Microbiology, 37(3), 661–664.PubMedPubMedCentralGoogle Scholar
  10. Nowakowska, J. A., Malewski, T., Tereba, A., Borys, M., & Oszako, T. (2016). Molecular diagnostic of Phytophthora pathogens as a tool for integrated Pest management. Sylwan, 160(5), 365–370.Google Scholar
  11. Nowakowska, J. A., Malewski, T., Tereba, A., Borys, M., & Oszako, T. (2017). Rapid diagnosis of pathogenic Phytophthora species in soil by real−time PCR. Forest Pathology, 47(2), e12303.CrossRefGoogle Scholar
  12. Piętka, J., & Grzywacz, A. (2018). Macrofungi found on black alder Alnus glutinosa (L.) Gaertn. In alder stands showing signs of a dieback. Sylwan, 162(1), 22–31.Google Scholar
  13. Rizzo, D. M., Garbelotto, M., & Hansen, E. M. (2005). Phytophthora ramorum: Integrative research and management of an emerging pathogen in California and Oregon forests. Annual Review of Phytopathology, 43, 309–335.CrossRefGoogle Scholar
  14. Schoebel, C. N., Stewart, J., Gruenwald, N. J., Rigling, D., & Prospero, S. (2014). Population history and pathways of spread of the plant pathogen Phytophthora plurivora. PLoS One, 9(1), e85368.CrossRefGoogle Scholar
  15. Trzewik, A., Orlikowski, L. B., Oszako, T., Nowakowska, J. A., & Orlikowska, T. (2015). The characterization of Phytophthora isolates obtained from diseased Alnus glutinosa in Poland. Baltic Forestry, 21(1), 44–−50.Google Scholar

Copyright information

© The Author(s) 2019

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.

Authors and Affiliations

  1. 1.Department of Molecular and Biometric Techniques, Museum and Institute of ZoologyPolish Academy of SciencesWarsawPoland
  2. 2.Forest FacultyUniversity of Technology in BiałystokHajnówkaPoland
  3. 3.Laboratory of Soil BiologyUniversity of NeuchatelNeuchatelSwitzerland
  4. 4.Department of Forest ProtectionForest Research Institute in Sękocin StaryRaszynPoland

Personalised recommendations