Advertisement

Experimental and Applied Acarology

, Volume 77, Issue 1, pp 73–81 | Cite as

Molecular detection of spotted fever group rickettsiae in ticks parasitizing pet dogs in Shihezi City, northwestern China

  • Wurelihazi Hazihan
  • Zhihui Dong
  • Liping Guo
  • Kadyken Rizabek
  • Dzhunysov Askar
  • Kulmanova Gulzhan
  • Mahanov Kudaibergen
  • Akishev Nurlan Kenjebaevich
  • Tolegen Talgat
  • Kenesbay Kairullayev
  • Yuanzhi WangEmail author
Open Access
Article
  • 323 Downloads

Abstract

A total of 178 adult ticks were collected from 32 pet dogs from five veterinary clinics in Shihezi City, Xinjiang Uygur Autonomous Region (XUAR), northwestern China. All the ticks were identified by comprehensive morphological and genetic analyses, and rickettsiae were detected by seven Rickettsia-specific genetic markers in the ticks. The ticks collected were identified as Rhipicephalus sanguineus sensu lato. Twenty-one of the 178 samples (11.8%) were positive for rickettsiae. Among these, in 13 (61.9%) samples Candidatus R. barbariae were identified, in five (23.8%) samples R. massiliae, and in three (14.3%) samples R. conorii. This study indicates that more attention should be paid to rickettsial infection in pet dogs and their ticks, because the latter may pose an epidemiological risk for tick-borne transmission of rickettsiae to human beings.

Keywords

Rhipicephalus sanguineus sensu lato Spotted fever group rickettsiae Pet dogs Northwestern China 

Introduction

Ticks are among the most common ectoparasites of dogs, also involved in the transmission of a number of major diseases in both dogs and humans (Chomel 2011; Dantas-Torres and Otranto 2016). Tick-borne rickettsioses are caused by the spotted fever group rickettsiae (SFGR) of the genus Rickettsia, which contains approximately 20 species, and many of which are established or emerging human pathogens (Wood et al. 2012). Besides, more and more new SFGR species have been found across the world, as a result of range expansion of tick populations, changes in landscape and climate, and more accurate diagnostic testing (Trotta et al. 2012; Yunik et al. 2015).

Due to the emerging and re-emerging nature of tick-borne diseases in humans, increasing focus has been placed on research of ticks parasitizing domestic animals (Hiraoka et al. 2005). As in many other countries, in China the dog has become a bonded family member. Regardless the benefits of having pet dogs, pathogens carried by ticks are potentially transmissible to humans, which may represent a health risk, especially to children, elderly people and immunocompromised individuals (Dantas-Torres and Otranto 2014). To date, at least three protozoan (Theileria, Babesia and Hepatozoon) and five bacterial (Anaplasma, Ehrlichia, Rickettsia, Coxiella and Bartonella) tick-borne genera have been reported in domestic dogs around the globe (Beck et al. 2009; Brown et al. 2006; Buhariwalla et al. 1996; Camacho et al. 2001; Conrad et al. 1991; Kaewkong et al. 2014; Kamani et al. 2013; Levin et al.2012; Mokhtar et al. 2013; Yabsley et al. 2008). In Jiangxi Province, mid-eastern China, Babesia canis vogeli and Babesia gibsoni were molecularly detected in 780 dog ticks (749 Rhipicephalus sanguineus, 16 Haemaphysalis campaulata and 15 Haemaphysalis verticalis), while all sampled dog ticks were negative for rickettsial agents (Zheng et al. 2017). In Xinjiang Uygur Autonomous Region (XUAR), northwestern China, rickettsial agents were prevalent in ticks infesting both domestic animals and wildlife (Guo et al. 2015, 2016). However, there is limited knowledge on the species of ticks infesting dogs. Here a molecular investigation was carried out for rickettsial agents in pet dog ticks.

Materials and methods

Collection and identification of ticks

In 2016–2017, ticks were sampled from 32 pet dogs presented at five veterinary clinics with symptoms of depression, weight loss and anorexia in Shihezi City (483 m above sea level, at 44°268129ʹN 86°0627148ʹE), the northwestern China. The ticks were placed in tubes with 75% ethanol and stored at − 80 °C. All of the ticks were identified morphologically according to previous reports (Filippova 1997; Dantas-Torres et al. 2013a, b). Twenty-nine representative ticks, with 4–6 ticks at each veterinary clinic, were used to analyze tick species and genetic diversity based on partial mitochondrial 16S rRNA (460 bp), 12S rRNA (400 bp) and coxI (889 bp) gene sequences (Szabó et al. 2005; Chen et al. 2014).

DNA extraction and molecular detection

After detailed morphological analysis, genomic DNA was extracted from each individual tick using the TIANamp Genomic DNA Kit (TianGen, Beijing, China). The ticks were mechanically crushed twice in sterile water for 15 min and then dried on sterile paper, suspended in 200 µl tissue lysis buffer and 40 µl proteinase K (100 µg/ml), and incubated overnight at 56 °C. The final elution volume was 60 µl. Subsequently, the polymerase chain reaction (PCR) technology was used to detect rickettsial agents with seven genetic markers for DNA fragments [434-, 1332-, 1060-, 488-, 920-, 491-, and 812-bp products of the genes encoding the 17 kilodalton antigen (17-kDa), 16S rRNA(rrs), citrate synthase (gltA), surface cell antigen 1 (sca1), PS120-protein-encoding gene (gene D), and outer membrane proteins A and B (ompA and ompB)] (Anstead and Chilton 2013; Chilton 2013; Sekeyova et al. 2001; Wei et al. 2015). (Table 1). Rickettsia aeschlimannii from Rh. turanicus and double-distilled water were used, respectively, as positive and negative controls (Wei et al. 2015). The PCR products were purified using the TIANgel Midi Purification Kit (TIANGEN, Beijing, China), and then subjected to sequencing (BGI, Shenzhen, China). Phylogenetic analyses were conducted used MEGA version 6.0 based on the 17 kDa-rrs-gltA-ompA-ompB-gene D concatenated sequence data of the rickettsiae by Maximum Likelihood (ML) and Neighbor-Joining (NJ) methods (Tamura et al. 2013).

Table 1

Primers used in this study for amplifying tick mitochondrial genes and Rickettsia spp. in ticks from pet dogs, in Shihezi City, northwestern China

Target

Gen

Primer (reference)

Sequences (5′–3′)

Fragment length (bp)

Tick

16S rRNA

T-16S(F)

T-16S(R) (Chen et al. 2014)

CTGCTCAATGATTTTTTAAATTGCTGTGG

CCGGTCTGAACTCAGATCAAGT

460

12S rRNA

12S(F)

12S(R) (Szabó et al. 2005)

AAACTAGGATTAGATACCCTATTATTTTAG

CTATGTAACGACTTATCTTAATAAAGAGTG

400

coxI

TY-J-1,449

C1-N-2,312 (Chen et al. 2014)

AATTTACAGTTTATCGCCT

CATACAATAAAGCCTAATA

889

Rickettsia spp.

rrs

R-16S(F)

R-16S(R) (Anstead and Chilton 2013)

ATCAGTACGGAATAACTTTTA

TGCCTCTTGCGTTAGCTCAC

1284

17-kDa

17-kDa(5F)

17-kDa(3R)

17-kDa(1F)

17-kDa(2R) (Anstead and Chilton 2013)

GCTTTACAAAATTCTAAAAACCATATA

TGTCTATCAATTCACAACTTGCCGTT

GCTCTTGCAACTTCTATGTT

CATTGTTCGTCAGGTTGGCG

434

gltA

gltA(F)

gltA(R) (Anstead and Chilton 2013)

ATGACCAATGAAAATAATAAT

ATTGCAAAAAGTACAGTGAACA

1078

sca1

sca1(F)

sca1(R) (Anstead and Chilton 2013)

GGTGATGAAGAAGAGTCTC

CTCTTTAAAATTATGTTCTAC

657

gene D

gene D(F)

gene D(R)

(Sekeyova et al. 2001; Wei et al. 2015)

CGGTAACCTAGATACAAGTGA

TATAAGCTATTGCGTCATCTC

920

ompA

ompA(F)

ompA(R) (Anstead and Chilton 2013)

ATGGCGAATATTTCTCCAAAA

AGTGCAGCATTCGCTCCCCCT

530

ompB

ompB(F)

OmpB(R) (Anstead and Chilton 2013)

TACTTCCGGTTACAGCAAAGT

AAACAATAATCAAGGTACTGT

812

Results

A total of 178 adult ticks (76 males and 102 females) were collected and morphologically identified as Rh. sanguineus sensu lato. (Fig. 1). The sequencing data from the 29 representative ticks confirmed the morphological results based on Basic Local Alignment Search Tool (BLAST) analyses of 16S rRNA, 12S rRNA and cox1. Rhipicephalus sanguineus s.l. in this study had 93.3–93.8% pairwise nucleotide sequence identity to genome sequences of the reference strains Rh. sanguineus (GenBank: JX416325) for three genes analyzed. Our data were deposited in the GenBank database (16SrRNA: KY069269, 12S rRNA: KY069270, and cox1: KY069271).

Fig. 1

Morphological analysis of Rhipicephalus sanguineus sensu lato collected from pet dogs. a Male, dorsal; b male, ventral; c female, dorsal; d female, ventral

Twenty-one of the 178 samples (11.8%) were positive for SFG rickettsiae. Of which, thirteen (61.9%) were identified as Candidatus R. barbariae, five (23.8%) as R. massiliae, and three (14.3%) as R. conorii subsp. indica. (Additional Table 2; Fig. 2). Rickettsia massiliae and R. conorii subsp. indica had 99.8–100% and 99.3–100% pairwise nucleotide sequence identities to the corresponding sequences of the reference strains R. massiliae MTU5 (GenBank: CP000683) and R. conorii str. Malish 7 (GenBank: AE006914) for seven genetic markers, respectively. Candidatus R. barbariae in dog ticks showed 100% pairwise nucleotide sequence identity to the corresponding sequences of Candidatus R. barbariae in the flea Vermipsylla alakurt (according to the seven genetic markers, in GenBank: KT284715, KU645283, KT284716, KU645284, KT284717, KT284718, KU645286, respectively). Detailed similarities of the sequences in this study are shown in Additional Table 1. All the sequences of Rickettsia spp. obtained in this study were deposited in GenBank [17 kDa: KY069262–KY069264; rrs: KY069266–KY069268; gltA: KY069259–KY069261; sca1: KY069254–KY069255, KY069265; ompA: KY069256–KY069258; ompB: KY069248–KY069250; gene D: KY069251–KY069253].

Fig. 2

Phylogenetic relationships of Rickettsia spp. inferred from 17 kDa-rrs-gltA-ompA-ompB-gene D using the Maximum-Likelihood method (left) and Neighbor-Joining method (right). The bootstrap consensus tree inferred from 1000 replicates and bootstrap replicates with value less than 50% were collapsed. Phylogenetic analyses were conducted in MEGA6.0. Rickettsiae obtained in this study were marked as “▲”, and sequences for rickettsia species retrieved from the GenBank database, Rickettsia bellii was used as the outgroup (see Additional Table 2).The scale bar represents the inferred substitutions per nucleotide site

Discussion

In the present study, ticks collected from pet dogs were used to identify rickettsial agents in Shihezi City, northwestern China. Candidatus R. barbariae, R. conorii subsp. indica and R. massiliae were molecularly detected. Importantly, these rickettsial agents were shown to be present both in pet dog ticks (reported here) and in sheep ticks (Guo et al 2016), which data raise both veterinary and public health concerns in northwestern China.

Candidatus R. barbariae was originally reported from Rhipicephalus bursa ticks in Portugal (de Sousa et al. 2006), and later confirmed and characterized by five genetic markers (gltA, ompA, ompB, sca4 and rrs) from Rh. turanicus in Italy (Mura et al. 2008). Subsequently, Candidatus R. barbariae was also detected in Rh. turanicus from Cyprus and in Rh. sanguineus from Israel (Chochlakis et al. 2012; Waner et al. 2014). In 2016, our investigation revealed that Candidatus R. barbariae is present in Vermipsylla alakurt fleas and Rh. turanicus ticks from grazing sheep (Guo et al. 2016; Zhao et al. 2016). Here, molecular evidence of Candidatus R. barbariae is provided in pet dog ticks (Rh. sanguineus s.l.).

The other two Rickettsia species, R. conorii subsp. indica and R. massiliae, had lower rates of positivity [1.7% (3/178) and 2.8% (5/178), respectively] compared to the data from grazing sheep (Wei et al. 2015; Guo et al. 2016), which might be explained by differences in tick numbers per host, as well as by varying susceptibility to rickettsiae among host species. To the best of our knowledge, however, the clinical cases were caused by R. conorii subsp. indica and R. massiliae (Cavagnaro et al. 2008; Vitale et al. 2006). Although there is no documented clinical case of rickettsia infection from pet dog ticks in China to date, more measures should be carried out to prevent its risk to dog owners, taking into account the synanthropic nature of Rh. sanguineus s.l. A diversity of tick-borne pathogens, including Anaplasma, Babesia, Borrelia, Ehrlichia and Theileriai spp. has recently been molecularly detected in Russia (Livanova et al. 2018). This, together with the present findings, draw the attention to not-yet known risks associated with tick-borne rickettsiae in several regions of Asia.

Conclusions

Three SFGR members, the R. conorii subsp. indica, Candidatus R. barbariae and R. massiliae, were molecularly detected in Rh. sanguineus s.l. ticks from pet dogs in Shihezi City, northwestern China. The study expands the range of tick-borne pathogens in pet dog ticks in Central Asia. Effective measures should be taken into consideration to prevent tick-borne transmission of rickettsiae to human beings.

Notes

Acknowledgements

We would like to thank Pro. Renfu Shao, Xingquan Zhu and Sándor Hornok revising the manuscript.

Author contributions

YZW conceived and designed the study. LPG and KR critically revised the manuscript. HZ and ZHD analyzed the data and drafted the manuscript. DA and KG conducted the morphological test of dog ticks. MK, ANK, TT and KK conducted molecular analyses. All authors read and approved the final manuscript.

Funding

This research was supported in part by the National Key Research & Development Program of China (2018ZX10101002-002-007), the National Natural Science Foundation of China (Grant Nos. 81560338 and U1503283), and the International Cooperation Projects of Xinjiang BINGTUAN (No. 2016AH001).

Compliance with ethical standards

Conflict of interest

The authors declare that they have no competing interests.

Ethical approval

This study was approved by the Animal Ethics Committee of Shihezi University (Approval No. AECSU2015-22).

Informed consent

Informed consent was obtained from all the owners.

Availability of data and material

The datasets supporting the conclusions of this article are included within the article and the newly-generated sequences were deposited in the GenBank database.

Supplementary material

10493_2018_337_MOESM1_ESM.docx (29 kb)
Supplementary material 1 (DOCX 29 KB)
10493_2018_337_MOESM2_ESM.doc (72 kb)
Supplementary material 2 (DOC 72 KB)

References

  1. Anstead CA, Chilton NB (2013) A novel Rickettsia species detected in vole ticks (Ixodes angustus) from Western Canada. Appl Environ Microbiol 79(24):7583–7589CrossRefGoogle Scholar
  2. Beck R, Vojta L, Mrljak V, Marinculić A, Beck A, Živičnjak T, Cacciò SM (2009) Diversity of Babesia and Theileria species in symptomatic and asymptomatic dogs in Croatia. Int J Parasitol 39(7):843–848CrossRefGoogle Scholar
  3. Brown GK, Canfield PJ, Dunstan RH, Roberts TK, Martin AR, Brown CS, Irving R (2006) Detection of Anaplasma platys and Babesia canis vogeli and their impact on platelet numbers in free-roaming dogs associated with remote Aboriginal communities in Australia. Aust Vet J 84(9):321–325CrossRefGoogle Scholar
  4. Buhariwalla F, Cann B, Marrie TJ (1996) A Dog-Related Outbreak of Q Fever. Clin Infect Dis 23(4):753–755CrossRefGoogle Scholar
  5. Camacho AT, Pallas E, Gestal JJ, Guitián FJ, Olmeda AS, Goethert HK, Telford SR (2001) Infection of dogs in north-west Spain with a Babesia microti-like agent. Vet Rec 149:552–555CrossRefGoogle Scholar
  6. Cavagnaro CS, Brady KA, Siegel C (2008) Fever After International Travel. Clin Pediatr Emerg Med 9(4):250–257CrossRefGoogle Scholar
  7. Chen Z, Li Y, Ren Q, Luo J, Liu Z, Zhou X, Liu G, Luo J, Luo J, Yin Het (2014) Dermacentor everestianus Hirst, 1926 (Acari: Ixodidae): phylogenetic status inferred from molecular characteristics. Parasitol Res 113(10):3773–3779CrossRefGoogle Scholar
  8. Chilton CAANB (2013) A novel rickettsia species detected in vole ticks (Ixodes angustus) from western Canada. Appl Environ Microbiol 79(24):7583–7589CrossRefGoogle Scholar
  9. Chochlakis D, Ioannou I, Sandalakis V, Dimitriou T, Kassinis N, Papadopoulos B, Tselentis Y, Psaroulaki A (2012) Spotted fever group rickettsiae in ticks in cyprus. Microb Ecol 63(2):314–323CrossRefGoogle Scholar
  10. Chomel B (2011) Tick-borne infections in dogs—An emerging infectious threat. Vet Parasitol 179:294–301CrossRefGoogle Scholar
  11. Conrad P, Thomford J, Yamane I, Whiting J, Bosma L, Uno T, Holshuh HJ, Shelly S (1991) Hemolytic anemia caused by Babesia gibsoni infection in dogs. J Am Vet Med Assoc 199:601–605Google Scholar
  12. Dantas-Torres F, Otranto D (2014) Dogs, cats, parasites, and humans in Brazil: opening the black box. Parasit Vectors 7:22CrossRefGoogle Scholar
  13. Dantas-Torres F, Otranto D (2016) Best practices for preventing vector-borne diseases in dogs and humans. Trends Parasitol 31(1):43–55CrossRefGoogle Scholar
  14. Dantas-Torres F, Latrofa MS, Annoscia G, Giannelli A, Parisi A, Otranto D (2013a) Morphological and genetic diversity of Rhipicephalus sanguineus sensu lato from the new and old worlds. Parasit Vectors 6(1):213–213CrossRefGoogle Scholar
  15. Dantas-Torres F, Capelli G, Giannelli A, Ramos RAN, Lia RP, Cantacessi C, de Caperariis D, De Tommasi AS, Latrofa MS, Lacasella V, et al (2013b) Efficacy of an imidacloprid/flumethrin collar against fleas, ticks and tick-borne pathogens in dogs. Parasite Vectors 6(1):245–245CrossRefGoogle Scholar
  16. de Sousa R, Barata C, Vitorino L, Santos-Silva M, Carrapato C, Torgal J, Walker D, Bacellar F (2006) Rickettsia sibirica isolation from a patient and detection in ticks, Portugal. Emerg Infect Dis 12(7):1103–1108CrossRefGoogle Scholar
  17. Filippova NA (1997) Fauna of russia and neighbouring countries. Ixodid ticks of subfamily amblyomminae. Nauka Publishing House, Moscow (ISBN: 5-02-026081-9)Google Scholar
  18. Guo LP, Mu LM, Xu J, Jiang SH, Wang AD, Chen CF, Guo G, Zhang WJ, Wang YZ (2015) Rickettsia raoultii in Haemaphysalis erinacei from marbled polecats, China-Kazakhstan border. Parasit Vectors 8:461.  https://doi.org/10.1186/s13071-015-1065-1 CrossRefGoogle Scholar
  19. Guo LP, Jiang SH, Liu D, Wang sw, Chen CF, Wang YZ (2016) Emerging spotted fever group rickettsiae in Ticks, northwestern China. Ticks Tick Borne Dis 7(6):1146–1150CrossRefGoogle Scholar
  20. Hiraoka H, Shimada Y, Sakata Y, Watanabe M, Itamoto K, Okuda M, Inokuma H (2005) Detection of rickettsial DNA in ixodid ticks recovered from dogs and cats in Japan. J Vet Med Sci 67(12):1217–1222CrossRefGoogle Scholar
  21. Kaewkong W, Intapan PM, Sanpool O, Janwan P, Thanchomnang T, Kongklieng A, Tantrawatpan C, Boonmars T, Lulitanond V, Taweethavonsawat P, Chungpivat S, Maleewong W (2014) High throughput pyrosequencing technology for molecular differential detection of Babesia vogeli. Hepatozoon canis, Ehrlichia canis and Anaplasma platys in canine blood samples. Ticks Tick Borne Dis 5:381–385CrossRefGoogle Scholar
  22. Kamani J, Baneth G, Mumcuoglu KY, Waziri NE, Eyal O, Guthmann Y, Harrus S (2013) Molecular detection and characterization of tick-borne pathogens in dogs and ticks from Nigeria. PLoS Negl Trop Dis 7:e2108CrossRefGoogle Scholar
  23. Levin ML, Killmaster LF, Zemtsova GE (2012) Domestic dogs (Canis familiaris) as reservoir hosts for Rickettsia conorii. Vector Borne Zoonotic Dis 12:28–33CrossRefGoogle Scholar
  24. Livanova NN, Fomenko NV, Akimov IA, Ivanov MJ, Tikunova NV, Armstrong R, Konyaev SV (2018) Dog survey in Russian veterinary hospitals: tick identification and molecular detection of tick-borne pathogens. Parasit Vectors Nov 14(1):591 11(CrossRefGoogle Scholar
  25. Mokhtar AS, Lim SF, Tay ST (2013) Molecular detection of Anaplasma platys and Babesia gibsoni in dogs in Malaysia. Trop Biomed 30:345–348Google Scholar
  26. Mura A, Masala G, Tola S, Satta G, Fois F, Pirns P, Rolain J-M, Raoult D, Parola P (2008) First direct detection of rickettsial pathogens and a new rickettsia, ‘Candidatus R. barbariae’, in ticks from Sardinia, Italy. Clin Microbiol Infect 14(11):1028–1033CrossRefGoogle Scholar
  27. Sekeyova Z, Roux V, Raoult D (2001) Phylogeny of Rickettsia spp. inferred by comparing sequences of ‘gene D’, which encodes an intracytoplasmic protein. Int J Syst Evol Microbiol 51:1353–1360CrossRefGoogle Scholar
  28. Szabó MP, Mangold AJ, João CF, Bechara GH, Guglielmone AA (2005) Biological and DNA evidence of two dissimilar populations of the Rhipicephalus sanguineus tick group (Acari: Ixodidae) in South America. Vet Parasitol 130(1–2):131–140CrossRefGoogle Scholar
  29. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol Biol Evol 30(12):2725–2729CrossRefGoogle Scholar
  30. Trotta M, Nicetto M, Fogliazza A, Montarsi F, Caldin M, Furlanello T, Solano-Gallego L (2012) Detection of Leishmania infantum, Babesia canis, and rickettsiae in ticks removed from dogs living in Italy. Ticks Tick Borne Dis 3(5–6):294–297CrossRefGoogle Scholar
  31. Vitale G, Mansuelo S, Rolain JM, Raoult D (2006) Rickettsia massiliae human isolation. Emerg Infect Dis 12(1):174CrossRefGoogle Scholar
  32. Waner T, Keysary A, Eremeeva ME, Din AB, Mumcuoglu KY, King R, Atiya-Nasaqi Y (2014) Rickettsia africae and Candidatus Rickettsia barbariae in ticks in Israel. Am J Trop Med Hyg 90(5):920–922CrossRefGoogle Scholar
  33. Wei QQ, Guo LP, Wang AD, Mu LM, Zhang K, Chen CF, Zhang WJ, Wang YZ (2015) The first detection of Rickettsia aeschlimannii. and Rickettsia massiliae in Rhipicephalus turanicus ticks, in northwest China. Parasit Vectors 8(1):1–4CrossRefGoogle Scholar
  34. Wood H, Artsob H (2012) Spotted fever group rickettsiae: a brief review and a Canadian perspective. Zoonoses Public Health 59(S2):65–79CrossRefGoogle Scholar
  35. Yabsley MJ, McKibben J, Macpherson CN, Cattan PF, Cherry NA, Hegarty BC, Breitschwerdt EB, O’Connor T, Chandrashekar R, Paterson T, Perea ML, Ball G, Friesen S, Goedde J, Henderson B, Sylvester W (2008) Prevalence of Ehrlichia canis, Anaplasma platys. Babesia canis vogeli, Hepatozoon canis, Bartonella vinsonii berkhoffii, and Rickettsia spp. in dogs from Grenada. Vet Parasitol 151:279–285CrossRefGoogle Scholar
  36. Yunik ME, Galloway TD, Lindsay LR (2015) Assessment of prevalence and distribution of spotted fever group rickettsiae in Manitoba, Canada, in the American Dog Tick. Dermacentor variabilis (Acari: Ixodidae). Vector Borne Zoonotic Dis 15(2):103–108CrossRefGoogle Scholar
  37. Zhao SS, Li HY, Yin XP, Liu ZQ, Chen CF, Wang YZ (2016) First detection of ‘Candidatus R. barbariae’, in the flea Vermipsylla alakurt, from north-western China. Parasit Vectors 9(1):325CrossRefGoogle Scholar
  38. Zheng W, Liu M, Moumouni PF, Liu X, Efstratiou A, Liu Z, Efstratiou A, Liu Z, Liu Y, Tao H, Guo H, Wang G, Gao Y, Li Z, Ringo AE, Jirapattharasate C, Chen H, Xuan X (2017) First molecular detection of tick-borne pathogens in dogs from Jiangxi, China. J Vet Med Sci 79(2):248–254CrossRefGoogle Scholar

Copyright information

© The Author(s) 2019

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.

Authors and Affiliations

  • Wurelihazi Hazihan
    • 1
  • Zhihui Dong
    • 2
  • Liping Guo
    • 3
  • Kadyken Rizabek
    • 4
  • Dzhunysov Askar
    • 4
  • Kulmanova Gulzhan
    • 4
  • Mahanov Kudaibergen
    • 4
  • Akishev Nurlan Kenjebaevich
    • 4
  • Tolegen Talgat
    • 4
  • Kenesbay Kairullayev
    • 4
  • Yuanzhi Wang
    • 2
    Email author
  1. 1.School of Animal Science and TechnologyShihezi UniversityShiheziChina
  2. 2.School of MedicineShihezi University, Xinjiang Uygur Autonomous RegionShiheziChina
  3. 3.School of MedicineSun yat-sen universityGuangzhouChina
  4. 4.Department of Food EngineeringKazakh National Agrarian UniversityAlmatyKazakhstan

Personalised recommendations