Advertisement

Regulator ThnR and the ThnDE ABC transporter proteins confer autoimmunity to thurincin H in Bacillus thuringiensis

  • Luz E. Casados-Vázquez
  • Dennis K. Bideshi
  • José E. Barboza-Corona
ORIGINAL PAPER

Abstract

The structural gene that encodes thurincin H, a bacteriocin produced by Bacillus thuringiensis, is harboured in a genetic cluster (thnP, E, D, R, A1, A2, A3, B, T, I) that controls its synthesis, modification, secretion and autoimmunity. The specific genes in the cassette that confer immunity in B. thuringiensis to thurincin H are unknown. To identify these immunity determinants, we generated constructs that were used to transform a natural thurincin H-sensitive B. thuringiensis strain (i.e. Btk 404), and resistance or susceptibility to the bacteriocin in resultant recombinants was evaluated. When Btk 404/pHT3101-ThnARDEP and Btk 404/pHT3101-ThnABTI were exposed to thurincin H, immunity was demonstrated by the former only, indicating that ThnI does not play a role in resistance to the bacteriocin as previously proposed. Furthermore, we generated different sub-cassettes under the control of divergent promoters pThnR and pThur of the thurincin H locus, and pChi, and using the green fluorescent protein gene as reporter, which demonstrated that all promoters were recognised by ThnR, except pChi. We show for the first time that the small operon composed of thnR, thnD and thnE is required for immunity of B. thuringiensis to thurincin H, and thnI is not necessary for this response.

Keywords

Bacillus thuringiensis Immunity Thurincin H Antimicrobial activity 

Introduction

Bacillus thuringiensis is a Gram-positive bacterium widely used in biological control of insects. Its toxicity is due to insecticidal crystal proteins (i.e. Cry, Cyt) that, together with spores, constitute active ingredients of commercial products (Estruch et al. 1996; Schnepf et al. 1998; Jouzani et al. 2017). In addition to Cry and Cyt proteins, B. thuringiensis synthesises other metabolites that have gained interest mainly because of their potential applied use. These include bacteriocins which are small peptides with antimicrobial activity (de la Fuente-Salcido et al. 2013; Salazar-Marroquín et al. 2016). Although approximately 20 bacteriocins of B. thuringiensis have been reported, only the genetic clusters involved in synthesis and transport of thurincin H, thurincin CD and thusin, have been described (Lee et al. 2009; Rea et al. 2010; Xin et al. 2016; Casados-Vázquez et al. 2017). In particular, thurincin H is synthesised as pre-peptides coded by three tandem copies of thnA genes (A1, A2 A3). Upstream of the structural thnA gene are located thnR, thnD, thnE and thnP, which codes for a transcriptional regulator, an ATP-binding domain protein, an ABC transporter permease, and a leader peptide-processing serine protease, respectively (Lee et al. 2009; Casados-Vázquez et al. 2017). Downstream of the structural thurincin H genes (thnA1, A2, A3) are found thnB, thnT and thnI, which code for a radical S-adenosylmethionine (SAM) enzyme, ABC secretion and immunity proteins, respectively (Lee et al. 2009). It should be noted that the putative roles of most of these gene products are based on in silico analyses, and only the functions of thnA, thnB, and thnR have been elucidated experimentally (Wieckowski et al. 2015; Casados-Vázquez et al. 2017). In particular, using complementation assays, it was demonstrated that thnR is a negative transcriptional regulator of thurincin H synthesis, and is a member of the YtrA subfamily in the GntR superfamily of transcriptional regulators (Casados-Vázquez et al. 2017).

Bacteria that produce bacteriocins encode immunity factors that protect them from their own antimicrobial peptides. For example, NisFEG and NisI protect Lactococcus lactis from nisin by transporting nisin from the membrane into the extracellular space, essentially functioning as nisin-intercepting proteins (Engelke et al. 1994; Siegers and Entian 1995; AlKhatib et al. 2014). Other reports show that ABC transporters are implicated in autoimmunity. For example, SpaFEG and SpaI protect Bacillus subtilis ATCC6633 against its own subtilin (Stein et al. 2005; Halami et al. 2010), EriFEG and EriI defend B. subtilis A1/3 against ericin, and LtnFE and LtnI of L. lactis MG1363 circumvent the lethal effect of lacticin 3147 (Stein et al. 2002; Martin et al. 2004; Draper et al. 2009; Christ et al. 2012; Hacker et al. 2015).

In contrast, very little is known about autoimmune mechanisms against bacteriocins produced by B. thuringiensis. In this regard, Mathur et al. (2014) demonstrated the role of trnFG and trnI in immunity against thurincin CD, and Wang et al. (2014) showed that immunity factors are coded by genes in the thurincin H cluster as a thurincin H-sensitive B. thuringiensis transformed with the cluster survived exposure to the bacteriocin. However, the specific determinants in the cluster are unknown. Here, our objective was to identify the genes in the thurincin H cluster that confer immunity to B. thuringiensis against the bacteriocin. Based on a previous report, thnD and thnE that code for putative ABC transport proteins were targeted for study, and several constructs with these genes and others in the thurincin H cluster were included. We demonstrate for the first time that thnD and thnE, together with the thnR transcription regulator, confer immunity against thurincin H in B. thuringiensis.

Materials and methods

Strains and culture conditions

Bacillus thuringiensis subsp. morrisoni LBIT 269 (Btm 269), B. thuringiensis subsp. kenyae LBIT 404 (Btk 404) and Bacillus cereus 183 were obtained from a bacterial stock collection at CINVESTAV, Irapuato, Mexico, donated by Dr. Jorge E. Ibarra. Bacteria were grown at 28 °C in Tryptic soy broth (TSB) or Tryptic soy agar (TSA) (Becton–Dickinson, Cuautitlán Izcalli, Estado de México, México). Recombinant plasmids were propagated in Escherichia coli TOP10 (Invitrogen, Carlsbad CA, USA) at 37 °C in Luria–Bertani (LB) broth (Invitrogen, Carlsbad CA, USA).

Cloning different constructs and generation of deletional mutants

General molecular biology techniques (Sambrook et al. 1989) were used to create different constructs using the ThnARDEP cassette that contained the thnP, thnE, thnD, thnR, thnA1, thnA2 and thnA3 genes as a template (Fig. 1). This genetic cluster was used to amplify genes integrated into the twelve constructs used in this study (Fig. 2). The oligonucleotides used in PCR are shown in Table 1. Promoter regions (pThnR, pThur, pChiA) and the transcription terminator were amplified and cloned into the vector, respectively, upstream and downstream of coding frames (Fig. 1). PCR amplification was performed using Phusion high fidelity DNA polymerase (Thermo Scientific, MA, USA) under the following conditions: 94 °C for 2 min, followed by 30 cycles of 30 s at 94 °C, and 30 s at 55 °C, and the time for the amplification at 72 °C varying depending on amplicon length, with a final extension of 72 °C for 5 min. Amplicons were digested with different restriction enzymes and ligated to corresponding sites in pHT3101, a E. coli-B. thuringiensis shuttle vector (Arantes and Lereclus 1991). Recombinant plasmids were propagated in E. coli Top10 cells and plasmids were purified as previously described (Del Sal et al. 1988).
Fig. 1

Genes present in the cluster ThnARDEP are involved in the immunity of B. thuringiensis to the thurincin H. a ThnARDEP harbours the genes thnP, thnE, thnD, thnR and thnA. b ThnABTI harbours the genes thnA, thnB, thnT and ThnI. c Btk 404 was transformed with pHT3101-ThnARDEP and pHT3101-ThnABTI and tested against thurincin H produced by Btm 269 (wells a, b, c), secreted proteins of Btk 404 d and phosphate buffer 50 mM, pH 7.0 e which were added to the wells. The effect on susceptibility or resistance was evaluated respectively, by the presence or absence of inhibition halos. a Btk 404 wild type, b Btk 404/pHT31010-ThnABTI, c Btk404-ThnARDEP, d Btk 404 wild type; e Btk 404 wild type. d Purification of thurincin H. Left panel, chromatogram of purification by size-exclusion chromatography using Superdex 30 Hi Load 16/600 (GE Healthcare life) column. Vertical arrow shows the position of the fraction with inhibitory activity against B. cereus used for the immunity assays. Central panel, SDS-PAGE. Lane 1, fraction sieving using membrane with cut-off 10 and 3 kDa; lane 2, diluted sample used in lane 1; lane 3, peak fraction with inhibitory activity detected in the chromatogram. Horizontal arrows indicate the position of thurincin H. Right panel, direct detection of antibacterial activity of thurincin H produced by Btm 269 against B. cereus 183

Fig. 2

Schematic illustration of different genetic sub-cassettes constructed to determine what genes are involved in the immunity of B. thuringiensis against the thurincin H. Each sub-cassette was cloned into the shuttle vector pHT3101 and used to transform Btk 404. Constructs were used to test the putative role of thnP, thnE, thnD and thnR in the immunity to thurincin H. The three copies of the structural gene (thnA1, thnA2, and thnA3) coding for thurincin H are indicated by black arrows. Constructs were under the control of different promoters: pThur (bent black arrow), pThnR (bent red arrow) and pChi (bent blue arrow). Lollipop indicates the transcriptional terminator sequence. (Color figure online)

Table 1

Oligonucleotides used to generate different constructs

Name

Sequence 5′ to 3′

Construct

UpsSAM-Rv/PstI

CAAAACTGCAGCGTTTTCGATAAATTTATAGG

ThnARDE, ThnARD, ThnAR

ThnR/PstI-ATG

CAAAACTGCAGATGAAAATAGTCTTAAGTAATGTATC

ThnRDEP

ThnR

ThnP/PstI-TAA

CAAAACTGCAGTTATTGGGAAATCGCTTTATAGAC

ThnRDEP

ThnP

ThnEFw/PstI

CAAAACTGCAGTTATAAATCTTTTTTTGCATATACTTTCAG

ThnARDE

ThnDE

ThnD-Fw/EcoRI

CCGGAATTCGTTAATTAACATGGATGTTCCC

ThnARD

ThnRFw/EcoRI

CCGGAATTCTCATTTTTCATTCTCCTCCTC

ThnAR

ThnDRv/PstI

CAAAACTGCAGATGTTGTGTTAGAAGTAAATAATTTAAATAAATC

ThnDE

ThnP/Pst-ATG

CAAAACTGCAGATGAAAAAAATAATTAAATTCCTTTTG

ThnP

ThnRFw/PstI

CAAAACTGCAGTCATTTTTCATTCTCCTCCTC

ThnR

PromAFw/KpnI

CGGGGTACCTAAACAACCTCTCTATCGATGAGTG

pThur

PromARv/PstI

AAAACTGCAGTTGACCTACCCCCTTTTCTGTATTG

pThur

PromRFw/KpnI

CGGGGTACCCCCTTTTCTGTATTGTGTGGTGC

pThnR

PromRRv/PstI

AAAACTGCAGTAAACAACCTCTCTATCGATGAGTG

pThnR

PromChiFw/ERI

GCCGGAATTCTTTAATATATCTTTTTGTAGTTCC

pChi

PromChiRv/PstI

CAAAACTGCAGTTCTCCTTTCAAAATAAAAGATATATTTAAAG

pChi

TermFw/SphI

ACATGCATGCACGTAATATCCATTAATTACTTCACTAAAG

Term

TermRv/SphI

ACATGCATGCCGAAAGCCTTTCCCTAACAGG

Term

DeltaED/Rv

TTTAAATTTGAAATCATAGTAATGAGTAATTAAATAC

DelED

Delta ED/Fw

TCATTTTTCATTCTCCTCCTCTAAAATTAAATC

DelED

DeltaR/Fw

TAAACAACCTCTCTATCGATGAGTGTTATGTTATG

DelR

DeltaR/Rv

ATGAATGTTGTGTTAGAAGTAAATAATTTAAATAAATC

DelR

SinThur/Rv

GACCTACCCCCTTTTCTGTA

DelThur

SinThur/Fw

GTGAGAGTGTTTATGGTGAAATTA

DelThur

The genetic cluster of thurincin H was cloned into the vector pHT3101, this construct harboured thnP, thnD, thnE, thnR, thnA1A2A3, thnB, thnP and thnI genes. Three pairs of oligonucleotide were design to delete the thnED, thnR and thnA1A2A3 genes. The mix for PCR contained 10 ng of DNA, 0.5 µM of each phosphorylated oligonucleotide, 0.2 mM dNTP mix, 1X Phusion HF buffer, 2.5 mM MgCl2 and 0.02 U/µL of Phusion high fidelity DNA polymerase (Thermo Scientific, MA, USA). PCR amplification was performed as follows: 98 °C for 30 s, followed by 30 cycles at 98 °C for 30 s, 30 s at 55 °C, and 4 min at 72 °C, with a final extension of 72 °C for 5 min. Recombinant plasmids were propagated in E. coli Top10 cells, and transformants harbouring each construct were confirmed by PCR using appropriate primer pairs.

Effect of ThnR on the activation of promoters pThur, pThnR and pChi

The green fluorescent protein (gfp) reporter gene was inserted downstream of the pThnR, pThur and pChi promoters. Constructs (pThnR-gfp; pThur-gfp and pChi-gfp) were ligated into pSB1C3 and were used to transform E. coli Top 10. To show if promoters were recognised by the transcriptional factor ThnR, those recombinants were transformed with pThnR-ThnR/pHT3101, using chloramphenicol and ampicillin as resistance markers, and GFP was quantified. E. coli harbouring each individual construct was used as controls. Cultures were monitored at 4, 8, 12 and 18 h. Samples of 10 ml were collected and centrifuged at 6000 ×g for 10 min; supernatants were discarded, and pellets were resuspended in 500 µl of lysis buffer (50 mM tris–HCl pH 7.5, 150 mM NaCl). Suspensions were sonicated two times, 20 s each, at an amplitude of 40 Hz, using a 20 kHz ultrasonic processor (Sonic and Materials, Inc., Newtown, CT). Afterward, the lysates were clarified by centrifugation at 11,000 ×g for 15 min, and the protein concentrations were quantified by the Bradford method (BioRad, Hercules CA, USA). Samples were adjusted to the same protein concentration and fluorescence of 150 µl was measured using a Synergy HTX Biotek (Winooski, VT) with excitation at 360/40 nm and emission at 528/20 nm. Expression levels were determined at different time (4, 8, 12 y 18 h) by measuring GFP fluorescence. To quantify the amount of GFP expressed, a standard curve was constructed using purified recombinant GFP.

Transformation of Btk 404

Electrocompetent cells were prepared as described by Cordeiro et al. (2011), with minor modifications. Briefly, Btk 404 was grown in 3 ml of tryptic soy broth (TSB) at 28 °C, 200 rpm for 16 h. Then 1 ml of the culture was used to inoculate 100 ml of TSB. The culture was incubated at 37 °C, 200 rpm to reach an absorbance at 600 nm of 0.4., then it was centrifuged at 5000 ×g for 10 min at 4 °C and the supernatant was discarded. The pellet was washed four times with 10 ml of electroporation buffer (250 mM sucrose, 1 mM of MgCl2, 1 mM of Hepes, 10% (v/v) glycerol, pH 7.0, cold and sterilised by filtration). After the fourth wash, cells were resuspended in 2 ml of the cold electroporation buffer and aliquots of 100 μl were placed into 1.5 ml tubes on ice. Approximately 200 ng of non-methylated recombinant plasmid produced in E. coli ET12567 was mixed with 100 μl of electrocompetent cell suspension, followed by electroporation using a BTX ECM630 Electrocell Manipulator (San Diego CA, USA) set at 2.0 kV, 300 Ω, and 25 μF. After the pulse, 1 ml of BHI medium was added and the mixture was incubated at 200 rpm for 2 h at 37 °C. Transformants were selected on TSA supplemented with erythromycin (25 μg/mL) at 37 °C overnight.

Purification of thurincin H

Btm 269 was cultivated at 28 °C, 24 h in 500 ml TSB, and supernatant containing active thurincin H was obtained by centrifugation (13,000 ×g for 30 min) at 4 °C. Solid ammonium sulfate was slowly added to the supernatant to ~ 40% saturation at room temperature, and proteins were concentrated by centrifugation at 13,000 ×g for 30 min at 4 °C. Precipitated proteins were resuspended in 5 ml of 50 mM phosphate buffer (pH 6.8) and dialysed in the same buffer for 16 h at 4 °C. Protein extracts were then sieved using membranes with of 30, 10 and 3 kDa cut-off. Proteins between 10 and 3 kDa were separated by gel filtration using a Superdex 30 Hi Load 16/600 (GE Healthcare life) column. Fractions with antibacterial activity were concentrated and monitored by SDS-PAGE, and finally assayed by the well diffusion test for thurincin H activity using B. cereus 183 as the indicator (susceptible) bacterium (De la Fuente-Salcido et al. 2008). In addition, to estimate purity of thurincin H, samples were fractionated in two 16% polyacrylamide gels by electrophoresis (SDS-PAGE) using Tris-tricine buffer (Schägger 2006). Molecular mass protein markers ranging from 6 to 180 kDa (Invitrogen, Carlsbad CA, USA) were used as standards. One gel was silver-stained and the other gel was assayed for direct inhibitory detection using the gel-screening assay. Briefly, the gel was fixed with 20% (vol/vol) isopropanol and 10% (vol/vol) acetic acid for 60 min, then the gel was washed six times with double-distilled water, 10 min each wash. Immediately after the last wash, the gel was equilibrated for 20 min in 50 mM phosphate buffer (pH 6.8), aseptically transferred to a sterile petri dish and overlaid with 15 ml of soft TSA medium containing ~ 1 × 109 cell/ml of the indicator strain. Finally, the culture was incubated at 28 °C for 24 h and the inhibition zones was recorded as previously described (Barboza-Corona et al. 2007).

Immunity assay of Btk 404 recombinants

Btk 404 was transformed with the different constructs, and with the pHT310 as a control. Recombinants were grown in 5 ml of TSB supplemented with erythromycin (25 μg/ml) for 16 h at 28 °C. Five milliliters of TSB was inoculated with 0.5 ml of overnight culture and incubated for 2 h at 28 °C with shaking at 200 rpm. Immunity assays were performed using the well diffusion method. Twenty milliliters of culture medium (from 500 ml stock containing 0.75 g of TSB and 6 g of bacteriological agar) was mixed with 140 μL of fresh culture of each transformed strain (~ 1 × 109 cell/ml) and poured on petri dishes. Wells, 8 mm in diameter, were dug into the agar and 90 μl of partially purified thurincin H at 20 µg/ml was added to each well. The plate was incubated for 16 h at 4 °C to allow diffusion of the samples. Finally, cultures were incubated at 28 °C for 1 day after which the diameters of zones of inhibition were measured and specific activity calculated.

In silico analyses

In silico analysis of the ThnR, ThnD and ThnE protein sequences was performed with NCBI BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi). ThnE was identified as a putative permease of an ABC-2 transporter system. To predict the membrane topology of proteins the HMMTOP (Tusnady and Simon 2001), TMHMM (Krogh et al. 2001), MemBrain (Yin et al. 2018) and PredictProtein (Rost et al. 2004) programs were used and a model of the 3D structure was predicted using PHYRE2 (Kelley et al. 2015). As ThnD was predicted to contain an ATP-binding domain, alignments were made to localise the ATP-binding site, Walker A/P-loop, Walker B, D-loop and H-loop using MUSCLE Multiple Alignment Sequence (https://www.ebi.ac.uk/Tools/msa/muscle/). Alignments with other ATP binding domains were performed using the MUSCLE (https://www.ebi.ac.uk/Tools/msa/muscle/) and Multalin (http://multalin.toulouse.inra.fr) programs. Finally, ThnR was identified as a putative member of the GntR superfamily transcription factor (TF), and its protein sequence was aligned with other TF of this family to identify DNA binding motifs.

Results

Identification of putative genes involved in autoimmunity to thurincin H

To identify genes in the thurincin H cluster that are involved in autoimmunity to the bacteriocin, we transformed Btk 404 with two constructs harbouring different gene combinations. Constructs pHT3101-ThnARDEP and pHT3101-ThnABTI harboured thnP, thnE, thnD, thnR, thnA and thnA, thnB, thnT, thnI genes, respectively (Fig. 1a, b). Wild type Btk 404 produces the bacteriocin kenyacin 404 and is sensitive to thurincin H of Btm 269 (Barboza-Corona et al. 2007; Casados-Vázquez et al. 2017). When Btk 404/pHT3101-ThnARDEP and Btk 404/pHT3101-ThnABTI were tested against thurincin H (Fig. 1c, d) by the well diffusion assay, only Btk 404/pHT3101-ThnARDEP was immune to the bacteriocin as detected by the absence of an inhibition halo. Btk 404/pHT3101-ThnABTI and control Btk 404 were susceptible to thurincin H (Fig. 1c). Additionally, with the well-diffusion assay we also corroborated, indirectly, that Btk 404 wild type and recombinants did not produce thurincin H (Fig. 1c, immunity assay). The susceptibility of the bacterium to thurincin H (observed by the presence of an inhibition halo) suggested that Btk 404 did not produce thurincin H (Fig. 1c, well A, Btk 404 wild type), nor did it possess the essential immunity proteins (Fig. 1c, well B, Btk 404/pHT31010-ThnABTI). In contrast, the recombinant bacterium harbouring the immunity genes was resistant to thurincin H (noted by the absence of inhibition halo) (Fig. 1c, well C, Btk404-ThnARDEP).

ThnE, ThnD and ThnR are responsible for the immunity to thurincin H

Once we demonstrated that thnP, thnE, thnD and thnR were implicated in autoimmunity, we focused on the essential elements required for this phenomenon. Recently, we showed that thnR gene acts as a repressor of thurincin H synthesis (Casados-Vázquez et al. 2017), and also by in silico analyses we deduced that thnP, thnE and thnD encode a leader peptide-processing serine protease, an ABC-2 transporter permease and ATP binding protein, respectively (Lee et al. 2009; Casados-Vázquez et al. 2017). Previous studies have linked ABC transporters to autoimmune mechanisms against antibiotics and bacteriocins (Gebhard 2012). As such, we hypothesised that thnE and thnD could potentially play a role in immunity to thurincin H. Toward this end we engineered the following constructs in pHT3101: ThnARDE, ThnARD, ThnAR, ThnRDEP, pThnR-RDE, pThnR-DE, pThur-RDE, pThur-DE, pChi-RDE, pChi-DE, ThnP and ThnR (Fig. 2) and used these to transform Btk 404. The recombinant strains were assayed for susceptibility or resistance to the thurincin H. We observed that Btk 404/pHT3101-ThnP and Btk 404/pHT3101-ThnR did not confer immunity against thurincin H at concentrations of, respectively, ~ 250,000 U/mg and ~ 250,000 U/mg. In contrast, all recombinant strains harbouring the thnD, thnE and thnR in the same construct were immune to thurincin H, i.e. strains Btk 404/pHT3101-ThnARDEP, Btk 404/pHT3101-ThnARDE, Btk 404/pHT3101-ThnRDEP and Btk 404/pHT3101-ThnRDE. These data indicated that thnD, thnE and thnR are essential for immunity to thurincin H. Additionally, as expected, Btm 269 was immune to thuricin H as it naturally produces this bacteriocin, whereas Btk 404 wild type, Btk 404/pHT3101 (EV) and B. cereus were susceptible (Fig. 3a).
Fig. 3

Assay to detect the immunity of B. thuringiensis against thurincin H using the well-diffusion assay. a All constructs from Fig. 2 were used to transform wild type B. thuringiensis subsp. kenyae (Bt kenyae, Btk 404) to acquired immunity. B. thuringiensis subsp. morrisoni (Bt morrisoni or Btm 269) was used as the control because it produces thurincin H and is immune to its own bacteriocin. B. cereus (B. cereus) was include in the assay because it is susceptible to the thurincin H. Empty vector (EV), i.e. pHT3101, was used to transform Btk 404 and was used as control. One unit (U) was defined as 1 mm2 of the zone of inhibition observed as inhibition halos. The higher U/mg, the higher susceptibility. The lower U/mg, the higher resistance, which means that bacteria shows immunity to thurincin H. b Mutants lacking thnED, thnR and thnA1,A2,A3 genes. Btk 404 was transformed with four constructs. The recombinant Bt containing the biosynthetic thurincin H cluster (Btk Cluster Thur) was immune to thurincin H. Btk Cluster DelED, Btk Cluster DelR and Btk Cluster DelThur lack the genes thnED, thnR and thnA1A2A3, respectively. Btk 404 (TH) was assayed with thurincin H, while Bt kenyae (NTH) was used as a negative control and no thurincin H was added to its culture

In summary, Btk 404 is naturally sensitive to thurincin H, but when this strain is transformed with the biosynthetic cluster for thurincin H, it acquires the capability of produce thurincin H and also become immune (Fig. 3b). When immunity genes are absent the strain loses the immunity phenotype completely and it behaves as the wilt type strain (Fig. 3b).

Effect of native or heterologous promoters driving expression thnRDE on autoimmunity

Once it was shown that thnD, thnE and thnR are required for the immunity, we determined whether the use of the pThur or other promoters not present in the cluster had any effect in the development of the immunity in B. thuringiensis against thurincin H (Fig. 2). We engineered constructs regulated by promoters: pThnR, pThur, and pChi. pThnR and pThur are divergent promoters, located within a region of ~ 300 bp, that control the expression of, respectively, thnP, thnE, thnD, thnR, and thnA, thnB, thnT, thnI in the thurincin H cluster (Lee et al. 2009; Casados-Vázquez et al. 2017). Promoter pChiA controls the expression of the chitinase gene (chiA74) in B. thuringiensis (Barboza-Corona et al. 2014). Btk 404 transformed with ThnDE, under the control of different promoters (Btk 404/pHT3101-pThnR-ThnDE, Btk 404/pHT3101-pThur-ThnDE, Btk 404/pHT3101-pChi-ThnDE), but lacking thnR, were susceptible to thurincin H showing values of inhibition between ~ 150,000 and 200,000 U/mg. On the other hand, Btk 404/pHT3101-pThnR-ThnRDE, Btk 404/pHT3101-pThur-ThnRDE, Btk 404/pHT3101-pChi-ThnRDE acquired immunity to the thurincin H. However, a reduced level of immunity acquired by Btk 404 expressing thnRDE under the control of pChiA was observed in comparison to constructs regulated by the pThnR and pThur promoters (Fig. 3).

To test the functionality of each promoter the gfp gene was used as reporter and constructs were transformed into E. coli TOP10. Cells transformed with pThur-gfp, pThnR-gfp and pChi-gfp showed a basal level of GFP expression (Fig. 4), with the highest level occurring at ~ 4 h. In contrast, a marked increase in the level of fluorescence was observed when the transcriptional regulator gene was present. In particular, respectively, 20-fold and sixfold enhancements in expression using promoters pThur and pThnR were observed when ThnR was present; ThnR had no effect on expression regulated by pChi promoter (Fig. 4).
Fig. 4

Effect of ThnR on activation of different promoters. E. coli TOP10 was transformed with reporter plasmids pThur-gfp, pThnR-gfp and pChi-gfp, or pThur-gfp/ThnR, pThnR-gfp/ThnR and pChi-gfp/ThnR and synthesis of reporter GFP was monitored periodically (4–18 h)

In silico analyses of ThnE, ThnD and ThnR

The genes thnE and thnD were predicted by in silico analysis to encode ABC transporter proteins. The thnE is predicted to encode an ABC-2 transporter permease composed of six transmembrane helices with the N-terminal and the C-terminal oriented intracellularly. A 3D model of the structure shows that the N- and C-termini could be implicated in the ATPase interaction. The PHYRE2 program (Kelley et al. 2015) predicted a model using the chain D transmembrane domain of an ABC transporter of Aquifex aeolicus (Supplementary Fig. 1). The alignment of our model with chain D of A. aeolicus suggests that the N and C-terminals are oriented similarly as chain D, and in that position chain D is joined to ATPase domain, indicating that this region could be involved in the interaction with ThnD. The thnD gene encoded a protein with homology to the family of ATP-binding proteins of multi-subunit transporters involved in drug resistance, nodulation, lipid transport, and lantibiotic immunity. ThnD contains signature motifs of ATP-binding proteins (Supplementary Fig. 2). These include (1) a Walker A/P-loop consensus GxxGxGKST which forms a loop that binds to alpha and beta phosphates of di- and tri-nucleotides (Walker et al. 1982; Saraste et al. 1990); (2) a Walker C motif or linker peptide involved in ATP hydrolysis and which also functions as a gamma phosphate sensor and/or as a signal peptide to membrane spanning domains, which contains an SxG signature (Suppl. Figure 2) (Matsuo et al. 2002); (3) a Walker B motif thought to coordinate Mg2+ and to polarize the attack of a water molecule in ATP hydrolysis (Suppl. Figure 2); and (4) a D-loop containing a conserved Asp at position 161 in ThnD (Diederichs et al. 2000). Finally, we identified a H-loop/switch region with its conserved His (position 188 in ThnD) that is thought to polarize the attack of a water molecule during ATP hydrolysis (Gaudet and Wiley 2001) (Suppl. Figure 2). ThnD shows 39.7% identity with trnF, an ATP binding protein involved in immunity to thurincin CD, and also 28.1 and 27.7% identity with, respectively, HycC and AlbC, both of which are ATP-binding proteins reported as members of bacteriocin biosynthetic clusters.

Additionally, ThnR is a transcriptional regulator belonging to GntR family, YtrA subfamily (Rigali et al. 2002) that controls the transcription of ABC transporters (Hillerich and Westpheling 2006) that function in carbon uptake and is also implicated in autoimmunity (Majchrzykiewicz et al. 2010). We have characterised ThnR in a previous report (Casados-Vázquez et al. 2017). Cumulatively, our data suggest that ThnR regulates the expression of the thnDE and thnA genes, and also of its own transcription. In order to find the putative binding site of the ThnR transcription factor, we searched for a regulon sequence using RegPrecise 3.0 (Novichkov et al. 2013). A region of 30 bases that covers nucleotides -47 to -17 showed identity with regulons of the GntR family of regulators in Firmicutes (Fig. 5). These regulons are recognised by GntR proteins and regulate small operons including transcriptional regulators, GntR family members, ABC-type multidrug transport system, ATPase component and ABC-type multidrug transport systems, and permease components.
Fig. 5

Alignment of manually curated regulory sequences for GntR transcription factor. promR is a sequence predicted as a regulon found at position − 47 to − 17. BC2903_Pos = − 228 and BC2904_Pos = − 50 are from B. cereus ATCC 14579; ABC0622_Pos = − 89 and ABC3409_Pos = − 52 from Bacillus clausii KSM-K16; BH3492_Pos = − 39 from Bacillus halodurans C-125; OB0429_Pos = − 62 and OB00885_Pos = − 46 from Oceanobacillus iheyensis HTE831 and Pjdr2_5967_Pos = − 58 from Paenibacillus sp. JDR-2. Bars on top indicate consensus sequence

Discussion

At present, only few on bacteriocins belonging to the sactibiotic subclass have been reported, and these are limited to four bacteriocins, i.e., thurincin H and thuricin CD from B. thuringiensis, subtilosin A from B. subtilis and hyicin from Staphylococcus hyicus (Babasaki et al. 1985; Stein et al. 2004; Lee et al. 2009; Rea et al. 2010; Casados-Vázquez et al. 2017; Duarte et al. 2018; Fagundes et al. 2017). With regard to thurincin H, no data have been provided on genes involved in autoimmunity of B. thuringiensis to this bacteriocin, although it was suggested that thnI might play a role in this process (Lee et al. 2009). Previous studies implicate ABC transporters in immunity mechanisms against antibiotics and bacteriocins. Many of these transporters are composed of two transmembrane domains that can be formed by one or two polypeptide chains. The system works by dimerising the domains and forming a channel in the membrane, where the dimer can be formed by the same protein (homodimer) or by different proteins (heterodimers) (Lubelski et al. 2004). These include TrnIFG in immunity to thurincin CD; TrnG is an integral membrane component and TrnF is an ATP binding protein, while TrnI is a transmembrane protein (Mathur et al. 2014). It is important to note that ThnD and ThnE of the thurincin H genetic cassette share significant levels of identity with, respectively, TrnF and ThrG of the thurincin CD cluster. Additionally, ThnE and TrnG have six transmembrane helices and their amino and carboxy termini are predicted to be oriented intracellularly. The thuricin CD and thurincin H clusters each harbours a determinant that encodes a transmembrane protein, whereas the nisin and subtilisin clusters encode two different transmembrane proteins (Stein et al. 2003, 2005). Additionally, we found that the putative ABC transporter of Btm 269 might be formed by two separate polypeptide chains, ThnE and ThnD, that could function as transmembrane and ATP binding domains, respectively. As only one polypeptide of each domain is required for immunity, we hypothesise that the ABC transporter of thurincin H (and also of thuricin CD) acts as a homodimer, unlike the heterodimeric system reported for nisin and subtilisin (Stein et al. 2003, 2005). As ATP-binding proteins TrnF and ThnD share ~ 40% identity and harbour conserved Walker motifs, we hypothesised that thnD and thnE, but not thnI, were involved in immunity to thurincin H. Indeed, recombinant Btk 404 harbouring thnI, thnT, thnB or thnI remained sensitive the bacteriocin, demonstrating the thnI is not required for autoimmunity, whereas the strain harbouring thnD, thnE, thnR, thnP and thnA was immune to the deleterious effect of thurincin H (Figs. 1, 2, 3).

Although the specific mechanism involved in the repression of thurincin H synthesis remains unknown, we previously demonstrated that thnR downregulated thurincin H synthesis (Casados-Vázquez et al. 2017). In addition to the previous finding, in this study we demonstrated that thnD and thnE alone did not confer immunity to the thurincin H and requires the presence of the transcriptional regulator thnR (Casados-Vázquez et al. 2017) to confer autoimmunity in B. thuringiensis. This was confirmed using different constructs harbouring thnD, thnE alone or with thnR, under the regulation of different promoters used for expressed in Btk 404 (Figs. 2, 3). This is the first report showing that a sactibiotic requires the presence of a transcriptional regulator to control expression of an ABC transporter. It is possible that the ThnR transcription regulator is sequestrated by the ABC transporter, and when thurincin H is recognised, the regulator disengages and subsequently activates the thnRDE operon, as has been observed with other ABC transporter systems (Görke 2012). In contrast, in the thurincin CD clusters, TrnF and TrnG or TrnI are required for the immunity (Mathur et al. 2014), and they do not require a transcriptional regulator homologue.

In conclusion, the small operon composed of thnR, thnD and thnE is indispensable for immunity of B. thuringiensis to thurincin H and thnI is not necessary for this response.

Notes

Acknowledgements

Luz E. Casados-Vázquez is a Young Associate Research supported by “Consejo Nacional de Ciencia y Tecnología (CONACYT), México (Grant 269). This study was partially supported by Grant SEP-CONACyT (258220) to J.E. Barboza-Corona. We appreciate the technical assistance of Dr. Rubén Salcedo-Hernández from the Universidad de Guanajuato, México.

Conflict of interest

The authors declare no conflicts of interest.

Supplementary material

10482_2018_1124_MOESM1_ESM.docx (458 kb)
Supplementary material 1 (DOCX 459 kb)

References

  1. AlKhatib Z, Lagedroste M, Zaschke J, Wagner M, Abts A, Fey I, Kleinschrodt D, Smits SH (2014) The C-terminus of nisin is important for the ABC transporter NisFEG to confer immunity in Lactococcus lactis. Microbiologyopen 3:752–763CrossRefPubMedPubMedCentralGoogle Scholar
  2. Arantes O, Lereclus D (1991) Construction of cloning vectors for Bacillus thuringiensis. Gene 108:115–119CrossRefPubMedGoogle Scholar
  3. Babasaki K, Takao T, Shimonishi Y, Kurahashi K (1985) Subtilosin A, a new antibiotic peptide produced by Bacillus subtilis 168: isolation, structural analysis, and biogenesis. J Biochem 98:585–603CrossRefPubMedGoogle Scholar
  4. Barboza-Corona JE, Vázquez-Acosta H, Bideshi DK, Salcedo-Hernández R (2007) Bacteriocin-like inhibitor substances produced by Mexican strains of Bacillus thuringiensis. Arch Microbiol 187:117–126CrossRefPubMedGoogle Scholar
  5. Barboza-Corona JE, Delgadillo-Ángeles JL, Castañeda-Ramírez JC, Barboza-Pérez UE, Casados-Vázquez LE, Bideshi DK, del Rincón-Castro MC (2014) Bacillus thuringiensis subsp. kurstaki HD1 as a factory to synthesize alkali-labile ChiA74∆sp chitinase inclusions, Cry crystals and spores for applied use. Microb Cell Fact 13:15.  https://doi.org/10.1186/1475-2859-13-15 CrossRefPubMedPubMedCentralGoogle Scholar
  6. Casados-Vázquez LE, Bideshi DK, Barboza-Corona JE (2017) The thnR gene is a negative transcription regulator of the thurincin H genetic cassette in Bacillus thuringiensis subsp. morrisoni. Arch Microbiol 199:385–390CrossRefPubMedGoogle Scholar
  7. Christ NA, Bochmann S, Gottstein D, Duchardt-Ferner E, Hellmich UA, D¨sterhus S, Kötter P, Güntert P, Entian K-D, Wöhnert J (2012) The first structure of a lantibiotic immunity protein, SpaI from Bacillus subtilis, reveals a novel fold. J Biol Chem 287:35286–35298CrossRefPubMedPubMedCentralGoogle Scholar
  8. Cordeiro JX, Laia ML, Goncalves JF, Bergamasco VB, Lemos MVF (2011) Bacillus thuringiensis mutant increase activity against Spodoptera frugiperda larvae. Aust J Basic Appl Sci 5:521–531Google Scholar
  9. De la Fuente-Salcido N, Alanís-Guzmán MG, Bideshi DK, Salcedo-Hernández R, Bautista-Justo M, Barboza-Corona JE (2008) Enhanced synthesis and antimicrobial activities of bacteriocins produced by Mexican strains of Bacillus thuringiensis. Arch Microbiol 190:633–640CrossRefPubMedGoogle Scholar
  10. De la Fuente-Salcido NM, Casados-Vázquez LE, Barboza-Corona JE (2013) Bacteriocins of Bacillus thuringiensis can expand the potential of this bacterium to other areas rather than limit its use only as microbial insecticide. Can J Microbiol 59:515–522CrossRefPubMedGoogle Scholar
  11. Del Sal G, Manfioletti G, Schneider C (1988) A one-tube plasmid DNA mini-preparation suitable for sequencing. Nucleic Acids Res 16:9878CrossRefPubMedPubMedCentralGoogle Scholar
  12. Diederichs K, Diez J, Greller G, Müller C, Breed J, Schnell C, Vonrhein C, Boos W, Welte W (2000) Crystal structure of MalK, the ATPase subunit of the trehalose/maltose ABC transporter of the archaeon Thermococcus litoralis. EMBO J 19:5951–5961CrossRefPubMedPubMedCentralGoogle Scholar
  13. Draper LA, Grainger K, Deegan LH, Cotter PD, Hill C, Ross RP (2009) Cross-immunity and immune mimicry as mechanism of resistance to the lantibiotic lacticin 3147. Mol Microbiol 71:1043–1054CrossRefPubMedGoogle Scholar
  14. Duarte AFS, Ceotto-Vigoder H, Barrias ES, Souto-Padrón TCBS, Nes IF, Bastos MDCF (2018) Hyicin 4244, the first sactibiotic described in staphylococci, exhibits an anti-staphylococcal biofilm activity. Int J Antimicrob Agents.  https://doi.org/10.1016/j.ijantimicag.2017.06.025 Google Scholar
  15. Engelke G, Gutowski-Eckel Z, Kiesau P, Siegers K, Hammelmann M, Entian K-D (1994) regulation of nisin biosynthesis and immunity in Lactococcus lactis. Appl Environ Microbiol 60:814–825PubMedPubMedCentralGoogle Scholar
  16. Estruch JJ, Warren GW, Mullins MA, Nye GJ, Craig JA, Koziel MG (1996) Vip3A, a novel Bacillus thuringiensis vegetative insecticidal protein with a wide spectrum of activities against lepidopteran insects. Proc Nat Acad Sci USA 93:5389–5394CrossRefPubMedGoogle Scholar
  17. Fagundes PC, Ceotto H, Potter A, de Paiva Vasconcelon, Brito MA, Bredem D, Nes IF, Bastos Mdo C (2017) Hyicin 3682, a bioactive peptide produced by Staphylococcus hyicus 3682 with potential applications for food preservation. Res Microbiol 162:1052–1059CrossRefGoogle Scholar
  18. Gaudet R, Wiley DC (2001) Structure of the ABC ATPase domain of human TAP1, the transporter associated with antigen processing. EMBO J 20:4964–4972CrossRefPubMedPubMedCentralGoogle Scholar
  19. Gebhard S (2012) ABC transporters of antimicrobial peptides in Firmicutes bacteria–phylogeny, function and regulation. Mol Microbiol 86:1295–1317CrossRefPubMedGoogle Scholar
  20. Görke B (2012) Killing two birds with one stone: an ABC transporter regulates gene expression through sequestration of a transcriptional regulator at the membrane. Mol Microbiol 85:597–601CrossRefPubMedGoogle Scholar
  21. Hacker C, Christ NA, Duchardt-Ferner E, Korn S, Göbl C, Bernirger L, Düsterhus S, Hellmich UA, Madl T, Kötter P, Entian K-D, Wöhnert J (2015) The solution structure of the lantibiotic immunity protein NisI and its interaction with nisin. J Biol Chem 290:28869–28886CrossRefPubMedPubMedCentralGoogle Scholar
  22. Halami PM, Stein T, Chandrashekar A, Entian K-D (2010) Maturation and processing of SpaI, the lipoprotein involved in subtilin immunity in Bacillus subtilis ATCC 6633. Microbiol Res 165:183–189CrossRefPubMedGoogle Scholar
  23. Hillerich B, Westpheling J (2006) A new GntR family transcriptional regulator in Streptomyces coelicolor is required for morphogenesis and antibiotic production and controls transcription of an ABC transporter in response to carbon source. J Bacterio. 188:7477–7487CrossRefGoogle Scholar
  24. Jouzani GS, Valijanian E, Sharafi R (2017) Bacillus thuringiensis: a successful insecticide with new environmental features and tidings. Appl Microbiol Biotechnol 101:2691–2711CrossRefPubMedGoogle Scholar
  25. Kelley LA, Mezulis S, Yates CM, Wass MN, Sternberg MJ (2015) The Phyre web portal for protein modeling, prediction and analysis. Nat Protoc 10(6):845CrossRefPubMedPubMedCentralGoogle Scholar
  26. Krogh A, Larsson B, Von Heijne G, Sonnhammer EL (2001) Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. J Mol Biol 305:567–580CrossRefPubMedGoogle Scholar
  27. Lee H, Churey JJ, Worobo RW (2009) Biosynthesis and transcriptional analysis of thurincin H, a tandem repeated bacteriocin genetic locus, produced by Bacillus thuringiensis SF361. FEMS Microbiol Lett 299:205–213CrossRefPubMedGoogle Scholar
  28. Lubelski J, Mazurkiewicz P, van Merkerk R, Konings WN, Driessen AJM (2004) ydaG and ydbA of Lactococcus lactis encode a heterodimeric ATP-binding cassette-type multidrug transporter. J Biol Chem 279:34449–34455CrossRefPubMedGoogle Scholar
  29. Majchrzykiewicz JA, Kuipers OP, Bijlsma JJ (2010) Generic and specific adaptive responses of Streptococcus pneumoniae to challenge with three distinct antimicrobial peptides, bacitracin, LL-37, and nisin. Antimicrob Agents Chemother 54:440–451CrossRefPubMedGoogle Scholar
  30. Martin NI, Sprules T, Carpenter MR, Cotter PD, Hill C, Ross RP, Vederas JC (2004) Structural characterization of lacticin 3147, a two-peptide lantibiotic with synergistic activity. Biochem 43:3049–3056CrossRefGoogle Scholar
  31. Mathur H, O’Connor PM, Cotter PD, Hill C, Ross RP (2014) Heterologous expression of thuricin CD immunity genes in Listeria monocytogenes. Antimicrob Agents Chemother 58:3421–3428CrossRefPubMedPubMedCentralGoogle Scholar
  32. Matsuo M, Dabrowski M, Ueda K, Ashcroft FM (2002) Mutations in the linker domain of NBD2 of SUR inhibit transduction but not nucleotide binding. EMBO J 21:4250–4258CrossRefPubMedPubMedCentralGoogle Scholar
  33. Novichkov PS, Kazakov AE, Ravcheev DA, Leyn SA, Kovaleva GY, Sutormin RA, Rodionov DA (2010) Thuricin CD, a posttranslationally modified bacteriocin with a narrow spectrum of activity against Clostridium difficile. Proc Nat Acad Sci USA 107:9352–9357CrossRefGoogle Scholar
  34. Rea MC, Sit CS, Clayton E, O’Connor PM, Whittal RM, Zheng J, Veredas JC, Ross P, Hill C (2010) Thuricin CD, a posttranslationally modified bacteriocin with a narrow spectrum of activity against Clostridium difficile. Proc Nat Acad Sci USA 107:9352–9357CrossRefPubMedGoogle Scholar
  35. Rigali S, Derouaux A, Giannotta F, Dusart J (2002) Subdivision of the helix-turn-helix GntR family of bacterial regulators in the FadR, HutC, MocR, and YtrA subfamilies. J Biol Chem 277:12507–12515CrossRefPubMedGoogle Scholar
  36. Rost B, Yachdav G, Liu J (2004) The predictprotein server. Nucleic Acids Res 32((suppl_2)):W321–W326CrossRefPubMedPubMedCentralGoogle Scholar
  37. Salazar-Marroquín EL, Galán-Wong LJ, Moreno-Medina VR, Reyes-López MÁ, Pereyra-Alférez B (2016) Bacteriocins synthesized by Bacillus thuringiensis: generalities and potential applications. Rev Med Microbiol 27:95–101CrossRefPubMedPubMedCentralGoogle Scholar
  38. Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a laboratory manual, 2nd edn. CSHL Press, New YorkGoogle Scholar
  39. Saraste M, Sibbald PR, Wittinghofer A (1990) 9 The P-loop—a common motif in ATP-and GTP-binding proteins. Trends Biochem Sci 15:430–434CrossRefPubMedGoogle Scholar
  40. Schägger H (2006) Tricine-sds-page. Nat Protoc 1:16CrossRefPubMedGoogle Scholar
  41. Schnepf E, Crickmore N, Van Rie J, Lereclus D, Baum J, Feitelson J, Zeigler DR, Dean DH (1998) Bacillus thuringiensis and its pesticidal crystal proteins. Microbiol Mol Biol Rev 62:775–806PubMedPubMedCentralGoogle Scholar
  42. Siegers K, Entian K-D (1995) Genes involved in immunity to the lantibiotic nisin produced by Lactococcus lactis 6F3. Appl Environ Microbiol 61:1082–1089PubMedPubMedCentralGoogle Scholar
  43. Stein T, Borchert S, Conrad B, Feesche J, Hofemeister B, Hofemeister J, Entian K-D (2002) Two different lantibiotic-like peptides originate from the ericin gene cluster of Bacillus subtilis A1/3. J Bacteriol 184:1703–1711CrossRefPubMedPubMedCentralGoogle Scholar
  44. Stein T, Heinzmann S, Solovieva I, Entian KD (2003) Function of Lactococcus lactis nisin immunity genes nisI and nisFEG after coordinated expression in the surrogate host Bacillus subtilis. J Biol Chem 278:89–94CrossRefPubMedGoogle Scholar
  45. Stein T, Düsterhus S, Stroh A, Entian K-D (2004) Subtilosin production by two Bacillus subtilis subspecies and variance of the sbo-alb cluster. Appl Environ Microbiol 70:2349–2353CrossRefPubMedPubMedCentralGoogle Scholar
  46. Stein T, Heinzmann S, Düsterhus S, Borchert S, Entian KD (2005) Expression and functional analysis of the subtilin immunity genes spaIFEG in the subtilin-sensitive host Bacillus subtilis MO1099. J Bacteriol 187:822–828CrossRefPubMedPubMedCentralGoogle Scholar
  47. Tusnady GE, Simon I (2001) The HMMTOP transmembrane topology prediction server. Bioinfomatics 17:849–850CrossRefGoogle Scholar
  48. Walker JE, Saraste M, Runswick MJ, Gay NJ (1982) Distantly related sequences in the alpha-and beta-subunits of ATP synthase, myosin, kinases and other ATP-requiring enzymes and a common nucleotide binding fold. EMBO J 1:945–951PubMedPubMedCentralGoogle Scholar
  49. Wang G, Manns DC, Churey JJ, Worobo RW (2014) Naturally sensitive Bacillus thuringiensis EG10368 produces thurincin H and acquires immunity after heterologous expression of the one-step-amplified thurincin H gene cluster. J Dairy Sci 97:4115–4119CrossRefPubMedGoogle Scholar
  50. Wieckowski BM, Hegemann JD, Mielcarek A, Boss L, Burghaus O, Marahiel MA (2015) The PqqD homologous domain of the radical SAM enzyme ThnB is required for thioether bond formation during thurincin H maturation. FEBS Lett 589:1802–1806CrossRefPubMedGoogle Scholar
  51. Xin B, Zheng J, Liu H, Junhua L, Ruan L, Peng D, Sajid M, Sun M (2016) Thusin, a novel two-component lantibiotic with potent antimicrobial activity against several gram-positive pathogens. Front Microbiol 7:1–12CrossRefGoogle Scholar
  52. Yin X, Yang J, Xiao F, Yang Y, Shen HB (2018) MemBrain: an easy-to-use online webserver for transmembrane protein structure prediction. Nano Micro Lett 10:2.  https://doi.org/10.1007/s40820-017-0156-2 CrossRefGoogle Scholar

Copyright information

© Springer Nature Switzerland AG 2018

Authors and Affiliations

  1. 1.Life Science Division, Graduate Program in BiosciencesUniversity of Guanajuato Campus Irapuato-SalamancaIrapuatoMexico
  2. 2.Life Science Division Food DepartmentUniversity of Guanajuato Campus Irapuato-SalamancaIrapuatoMexico
  3. 3.Department of Biological SciencesCalifornia Baptist UniversityRiversideUSA
  4. 4.Department of EntomologyUniversity of CaliforniaRiversideUSA

Personalised recommendations