Advertisement

Acta Biotheoretica

, Volume 66, Issue 3, pp 251–253 | Cite as

Correction to: Graphical Representation and Similarity Analysis of DNA Sequences Based on Trigonometric Functions

  • Guo-Sen Xie
  • Xiao-Bo Jin
  • Chunlei Yang
  • Jiexin Pu
  • Zhongxi Mo
Correction

1 Correction to: Acta Biotheor (2018) 66:113–133  https://doi.org/10.1007/s10441-018-9324-0

In the original publication of the article, the y axis labels present in Figs. 1a and 2a are incorrect. The correct Figs. 1a and 2a are provided here.
Fig. 1

a The assignment of the sequence S = ATGGTGCACCTGACTCCTGA to four sinusoidal functions. b Four-Base-related curve of the sequence S. c A-related curve, G-related curve, T-related curve and C-related curve of the sequence S

Fig. 2

a The assignment of the sequence S = ATGGTGCACCTGACTCCTGA to four tangent functions. b Four-Base-related curve of the sequence S. c A-related curve, G-related curve, T-related curve and C-related curve of the sequence S

Copyright information

© Springer Science+Business Media B.V., part of Springer Nature 2018

Authors and Affiliations

  1. 1.Information Engineering CollegeHenan University of Science and TechnologyLuoyangChina
  2. 2.Henan Joint International Research Laboratory of Image Processing and Intelligent DetectionHenan University of Science and TechnologyLuoyangChina
  3. 3.School of Information Science and EngineeringHenan University of TechnologyZhengzhouChina
  4. 4.School of Mathematics and StatisticsWuhan UniversityWuhanChina

Personalised recommendations