Advertisement

Correction to: Molecular characterization of Globodera pallida found in Japan using ribosomal DNA and mitochondrial cytochrome b gene sequences

  • T. OhkiEmail author
  • T. Narabu
  • A. Kushida
  • K. Onodera
  • T. Fujimoto
  • K. Itou
  • T. Maoka
Correction
  • 61 Downloads

Correction to: Journal of General Plant Pathology (2018) 84:230–236  https://doi.org/10.1007/s10327-018-0776-5

The authors would like to correct the errors in the publication of the original article.

The first eight sentences under the subheading “PCR, cloning, and sequencing” in the “Materials and methods” section contained errors in the primer sequences and in the one of the reference citations.

The sentences should read as:

“The ribosomal DNA sequences (rDNA) including two ITS and 5.8S ribosomal RNA were amplified using the primers of Ferris et al. (1993): forward (CGTAACAAGGTAGCTGTAG) and reverse (TCCTCCGCTAAATGATATG). Partial sequences of the mitochondrial cytochrome b gene (cytb) were amplified using primers INRAcytbL (GGGTGTGGCCTTGTTATTTC) and INRAcytbR (ACCAGCTAAAACCCCATCCT) (Picard et al. 2007).”

The below reference should be included in the reference list.

Notes

Reference

  1. Ferris VR, Ferris JM, Faghihi J (1993) Variation in spacer ribosomal DNA in some cyst-forming species of plant parasitic nematodes. Fundam Appl Nematol 16:177–184Google Scholar

Copyright information

© The Phytopathological Society of Japan and Springer Japan KK, part of Springer Nature 2019

Authors and Affiliations

  1. 1.Division of Agro-environmental Research, Hokkaido Agricultural Research CenterNational Agriculture and Food Research OrganizationSapporoJapan
  2. 2.Agricultural Production Environment Group, Kitami Agricultural Experiment StationHokkaido Research OrganizationKunneppuJapan

Personalised recommendations