Advertisement

Planta

, Volume 249, Issue 1, pp 257–270 | Cite as

Transcriptomic changes triggered by carotenoid biosynthesis inhibitors and role of Citrus sinensis phosphate transporter 4;2 (CsPHT4;2) in enhancing carotenoid accumulation

  • Pengjun Lu
  • Shasha Wang
  • Don Grierson
  • Changjie XuEmail author
Original Article
  • 487 Downloads
Part of the following topical collections:
  1. Terpenes and Isoprenoids

Abstract

Main conclusion

Carotenoid accumulation and chromoplast development in orange were perturbed by carotenoid inhibitors, and candidate genes were identified via transcriptomic analysis. The role of CsPHT4;2 in enhancing carotenoid accumulation was revealed.

Carotenoids are important plant pigments and their accumulation can be affected by biosynthesis inhibitors, but the genes involved were largely unknown. Here, application of norflurazon (NFZ), 2-(4-chlorophenylthio)-triethylamine hydrochloride (CPTA) and clomazone for 30 days to in vitro cultured sweet orange juice vesicles caused over-accumulation of phytoene (over 1000-fold), lycopene (2.92 μg g−1 FW, none in control), and deficiency in total carotenoids (reduced to 22%), respectively. Increased carotenoids were associated with bigger chromoplasts with enlarged plastoglobules or a differently crystalline structure in NFZ, and CPTA-treated juice vesicles, respectively. Global transcriptomic changes following inhibitor treatments were profiled. Induced expression of 1-deoxy-d-xylulose 5-phosphate synthase 1 by CPTA, hydroxymethylbutenyl 4-diphosphate reductase by both NFZ and CPTA, and reduced expression of chromoplast-specific lycopene β-cyclase by CPTA, as well as several downstream genes by at least one of the three inhibitors were observed. Expression of fibrillin 11 (CsFBN11) was induced following both NFZ and CPTA treatments. Using weighted correlation network analysis, a plastid-type phosphate transporter 4;2 (CsPHT4;2) was identified as closely correlated with high-lycopene accumulation induced by CPTA. Transient over-expression of CsPHT4;2 significantly enhanced carotenoid accumulation over tenfold in ‘Cara Cara’ sweet orange juice vesicle-derived callus. The study provides a valuable overview of the underlying mechanisms for altered carotenoid accumulation and chromoplast development following carotenoid inhibitor treatments and sheds light on the relationship between carotenoid accumulation and chromoplast development.

Keywords

Chromoplast Fibrillin (FBN) Lycopene Orange Weighted correlation network analysis (WGCNA) 

Abbreviations

CHRC

Chromoplast-specific carotenoid-associated protein

CLO

Clomazone

CPTA

2-(4-Chlorophenylthio)-triethylamine hydrochloride

CYCB

Chromoplast-specific lycopene β-cyclase

DXS

1-Deoxy-d-xylulose 5-phosphate synthase

FBN

Fibrillin

FPKM

Fragments per kilobase of transcript sequence per millions base pair

GO

Gene ontology

KEGG

Kyoto encyclopedia of genes and genomes

kME

Eigengene-based connectivity

HDR

Hydroxymethylbutenyl 4-diphosphate reductase

hp

High pigment

NFZ

Norflurazon

Or

Orange

PAP

Plastid lipid-associated protein

PHT

Phosphate transporter

PSY

Phytoene synthase

TEM

Transmission electron microscopy

TO

Topological overlap

WGCNA

Weighted correlation network analysis

Introduction

Carotenoids are a class of 40-carbon isoprenoid compounds with yellow, red, or orange colors. Some are present in plant chloroplasts, where they function as photoprotectants in photosynthesis and others in chromoplasts, where they attract animals and thus facilitate pollination and seed dispersal. They also provide precursors for biosynthesis of hormones such as abscisic acid (ABA), strigolactones, and some volatiles involved in other interactions between plants and animals (Zhu et al. 2010; Walter and Strack 2011; Nisar et al. 2015). Carotenoids are also of importance for human health by protecting humans from carcinogenesis, cardiovascular diseases, neurodegenerative diseases, metabolic syndrome, and degenerative diseases like cataracts (Fraser and Bramley 2004; Chiu and Taylor 2007; Lu et al. 2010; Ford and Erdman 2012; Liu et al. 2015).

The carotenoid metabolic pathway involves over 20 enzymes, utilizing pyruvate and glyceraldehyde 3-phosphate from the glycolysis pathway, with 1-deoxy-d-xylulose 5-phosphate synthase (DXS) being an important control point. Phytoene synthase (PSY) is a key enzyme for production of the first carotenoid molecule, phytoene, by the head-to-head condensation of two geranylgeranyls. After serial steps of desaturation by phytoene desaturase (PDS) and ζ-carotene desaturase (ZDS) as well as isomerization by 15-cis-ζ-carotene isomerase (ZISO) and carotene isomerase (CRTISO), phytoene is converted into lycopene. The pathway branches at cyclization of lycopene, which is a unique linear molecule with 11 carbon–carbon double bonds, and the cyclization of an ε-ring and a β-ring creates the α, β branch of carotenoids, while two β-rings creates the β, β branch (Chen et al. 2010; Neuman et al. 2014; Nisar et al. 2015) (Fig. 1). Many mutants or cultivars with altered carotenoid accumulation have been reported in tomato, citrus, carrot, pepper, peach, and loquat (Xu et al. 2006; Fu et al. 2012; Liu et al. 2015; Nisar et al. 2015; Yuan et al. 2015).
Fig. 1

Carotenoid metabolic pathway in higher plants. Inhibited sites by CLO, CPTA, and NFZ are in black bold italic. Enzymes catalysing upstream (MEP pathway), central (carotenoid biosynthesis and conversion), and downstream (degradation) pathways are in green, blue, and red, respectively. Colored carotenoids are marked with yellow background. BCH β-carotene hydroxylase, CCD carotenoid cleavage dioxygenase, CLO clomazone, CMK 4-(cytidine 5-diphospho)-2-C-methyl-d-erythritol kinase, CMS 4-(cytidine 5-diphospho)-2-C-methyl-d-erythritol synthase, CPTA 2-(4-chlorophenylthio)-triethylamine hydrochloride, CRTISO carotene isomerase, CYCB chromoplast-specific lycopene β-cyclase, DXR 1-deoxy-d-xylulose 5-phosphate reductoisomerase, DXS 1-deoxy-d-xylulose 5-phosphate synthase, GGPP geranylgeranyl diphosphate, GGPS geranylgeranyl diphosphate synthase, GGR geranylgeranyl reductase, HDR hydroxymethylbutenyl 4-diphosphate reductase, HDS hydroxymethylbutenyl 4-diphosphate synthase, IDI isopentenyl-diphosphate isomerase, LCYB lycopene β-cyclase, LCYE lycopene ε-cyclase, MCS 2-C-methyl-d-erythritol 2,4-cyclodiphosphate synthase, MEP 2-C-methyl-d-erythritol 4-phosphate, NCED nine-cis-epoxycarotenoid dioxygenase, NFZ norflurazon, NSY neoxanthin synthase, PDS phytoene desaturase, PSY phytoene synthase, VDE violaxanthin de-epoxidase, ZDS ζ-carotene desaturase, ZEP zeaxanthin epoxidase, ZISO 15-cis-ζ-carotene isomerase

The effects of gene mutation on carotenoid accumulation can be simulated by application of various biosynthesis inhibitors. These chemicals are of great value for carotenoid studies, especially in those plants, where reverse genetics is difficult or not possible and mutants are not available. Accumulation of lycopene can be induced following application of lycopene cyclase inhibitor 2-(4-chlorophenylthio)-triethylamine hydrochloride (CPTA) in several plants including daffodil (Narcissus pseudonarcissus) flowers (Al-Babili et al. 1999), barley seedlings (Hordeum vulgare) (La Rocca et al. 2007), and citrus pericarp (Coggins et al. 1970). Photobleaching of green leaves has been reported following application of DXS inhibitor clomazone (CLO) and PDS inhibitor norflurazon (NFZ) (Lange et al. 2001; Rodríguez-Villalón et al. 2009).

Several genome modification strategies involving carotenogenic genes have been applied to manipulate carotenoid accumulation. In tomato, over-expressing Arabidopsis PDS and tobacco LCYB as well as bacterial carotenogenic genes such as CrtE (bacterial geranylgeranyl diphosphate synthase), CrtB (bacterial phytoene synthase), and CrtI (bacterial phytoene desaturase) led to significant changes in carotenoid content (Enfissi et al. 2017; McQuinn et al. 2018; Nogueira et al. 2013; Ralley et al.2016). Virus-induced gene silencing (VIGS) has also been applied to silence several carotenogenic genes in tomato fruit and altered carotenoid profiles (Fantini et al. 2013). Genome modifications of the carotenoid pathway have also been achieved in other plants and algae (Maass et al. 2009; Srinivasan et al. 2017; Zhou et al. 2015).

Apart from direct regulation of the biosynthetic pathway, the accumulation of carotenoids is also related to the development of plastids themselves. Mutants with increased chromoplast number and size, such as high pigment (hp) tomatoes and the Orange (Or) cauliflower, also possess a higher content of carotenoids (Mustilli et al. 1999; Lieberman et al. 2004; Paolillo et al. 2004; Lu et al. 2006; Galpaz et al. 2008). Fibrillin (FBN), also referred as plastid lipid-associated protein (PAP) or chromoplast-specific carotenoid-associated protein (CHRC), is reported to be closely related to carotenoid accumulation and chromoplast structure (Rey et al. 2000; Leitner-Dagan et al. 2006; Singh et al. 2010). It is reported that FBN increases the sequestration sink capacity in the tomato hp mutant (Kilambi et al. 2013), and over-expression of FBN can influence plastid ultrastructure and carotenoid accumulation in tobacco leaf and flower as well as tomato fruit (Rey et al. 2000; Simkin et al. 2007).

Previously, we demonstrated that several inhibitors are effective in causing the accumulation of specific carotenoids and changes in chromoplast development in a citrus juice vesicle culture system (Lu et al. 2017). Here, we report an analysis of alterations in expression of genes associated with the changes in carotenoid accumulation, chromoplast development and identify the role of phosphate transporter 4;2 (CsPHT4;2) in accumulation of carotenoids in sweet orange chromoplasts. PHT4;2 is involved in various physiological and biochemical processes (Guo et al. 2008a, b), and has been reported to influence starch accumulation and leaf size in Arabidopsis (Irigoyen et al. 2011). Recently, PHT4;2 was also found to be related with flesh color of watermelon fruit (Zhang et al. 2017), and here, we show that transient over-expression of CsPHT4;2 enhanced carotenoid accumulation over tenfold in ‘Cara Cara’ sweet orange callus-derived juice vesicles.

Materials and methods

Plant materials

All samples of ‘Newhall’ (yellow-fleshed) and ‘Cara Cara’ (red-fleshed) oranges (Citrus sinensis L. Osbeck) were collected from an orchard in Linhai, Zhejiang, China.

For inhibitor experiments, fruit of ‘Newhall’ were collected at color turning stage. Fruit were surface-sterilized as described (Zhang et al. 2012). An in vitro juice vesicle culture system was established, as described in our previous work (Lu et al. 2017). Briefly, juice segments were cut from fruit, placed with the endocarp side uppermost on Murashige and Skoog (MS) medium supplemented with 10% (w/v) sucrose and 1% (w/v) agar, pH 5.8, and cultured in darkness at 25 °C. CPTA, NFZ, and CLO were dissolved in a small amount (20 mL for 1 L medium) of 50% ethanol and added to the culture media to a final concentration of 7.14, 0.10, and 0.05 mM, respectively, with the same amount of 50% ethanol added to the control media. CLO and NFZ are purchased from Sigma-Aldrich (USA) and CPTA was synthesized by TCI Development Co., Ltd (China). At 30 days after treatments, the juice vesicles were separated from segments, immediately frozen in liquid nitrogen, and stored at − 70 °C for further analysis. For each sampling, nine segments were taken and separated into three biological replicates with vesicles from three segments in each replicate.

For juice vesicle-derived callus induction, fruitlets around 4 cm in diameter were collected, surface-sterilized as described (Zhang et al. 2012), cut longitudinally into six pieces, and then peel tissue removed. The fruit pieces were placed on Murashige and Tucker medium (Murashige and Tucker 1969) with the endocarp side uppermost, and cultured in darkness at 25 °C for 3 months. The induced juice vesicle-derived calli were used in transient expression experiments, as described below.

Carotenoid extraction and HPLC analysis

Extraction, HPLC separation, and quantification of carotenoids were carried out as described in our previous study (Xu et al. 2006). In brief, 0.4 g of fresh tissues were ground in liquid nitrogen and extracted with chloroform/methanol/Tris pH 7.5, and after centrifugation, and the chloroform phases were collected and dried under nitrogen gas. The residue was dissolved and saponified with 6% KOH in methanol at 60 °C for 0.5 h. Water and chloroform were added to the saponified mixtures and after centrifugation, the chloroform phases were collected and dried under nitrogen gas. HPLC analysis was conducted using a Waters Alliance 2695 system (Waters Corporation, USA) equipped with a YMC reverse-phase C30 column.

Transmission electron microscopy (TEM)

Sample preparation and transmission electron microscopy were conducted, as described in our previous study (Lu et al. 2017). Briefly, juice vesicles were fixed in 2.5% glutaraldehyde in 0.1 M phosphate buffer (pH 7.0) overnight, post-fixed with 1% OsO4 in 0.1 M phosphate buffer (pH 7.0) for 1–2 h, and dehydrated by a linear gradient ethanol series. Samples were infiltrated by absolute acetone for 20 min and followed by resin gradually. The embedded samples were heated at 70 °C for 9 h, stained with uranyl acetate and alkaline lead citrate for 15 min each, and observed in a TEM using a Hitachi JEM-1230 (Japan).

Isolation of RNA and RNA-seq analysis

Total RNA was extracted as described in our previous work (Fu et al. 2012). RNA integrity was electrophoretically verified and genomic DNA was eliminate by DNase I (RNase-free) (Fermentas MBI). The purity and integrity analysis were determined with a Bioanalyzer 2100 system (Agilent Technologies, Santa Clara, CA, USA). High-quality total RNA, with RNA integrity value over seven, was used for RNA-seq analysis which was performed by staff at Novogene Bioinformatics Technology Co. Ltd. (Beijing, China) with an Illumina HiSeq PE150 platform. The analysis was carried out with control and the three inhibitor treatments, with three biological replicates for each treatment.

Raw data (raw reads) in FASTQ format were filtered by discarding reads containing adapters, reads containing N (the percentage of nucleotides in the reads that could not be sequenced) over 10% and low-quality reads (those containing over 20% nucleotides in reads with Q value below 10). Q20, Q30, and GC contents were estimated to ensure clean reads with high quality for further analysis. Clean reads were mapped to the citrus genome database (http://citrus.hzau.edu.cn/orange/) using the HISAT software.

RNA-seq data analysis

Gene expression level was normalized by calculating FPKM (expected number of fragments per kilobase of transcript sequence per millions base pair) with DESeq R package. Compared to the control group, genes with log2(fold change) ≥ 2 and P ≤ 0.05 were considered significantly differentially expressed. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment were conducted on differentially expressed genes by the GOseq R packages and KOBAS software.

Phylogenetic analysis

Deduced nucleotide and amino acid sequences were aligned with the ClustalX and optimized in GeneDoc. The phylogenetic tree was constructed after alignment with MEGA4 using the neighbor-joining method with the threshold of 1000 bootstrap replicates.

Weighted correlation network analysis (WGCNA)

Differentially expressed genes were used to perform weighted correlation network analysis (WGCNA), also known as gene co-expression analysis, with R-package WGCNA (Langfelder and Horvath, 2008). The co-expression adjacency matrix was formed based on correlation between each gene (genes having FPKM < 1 not included in this analysis), and converted to a topological overlap (TO) matrix. Modules were clustered based on TO similarity and dynamic tree cut was generated using hierarchical clustering to identify similar modules (small modules were merged until each module containing over 20 genes). kME (eigengene-based connectivity, with values range from zero to one; a higher value means a higher similarity between expression pattern of a specific gene and that of a module) were used to determine whether the gene belongs to a specific module and minimum height for merging modules was set as default. To make modules more specific, only genes having a kME value over 0.7 were retained in each module. The analysis was performed on Biocloud (https://www.biocloud.net/). Co-expression networks were visualized using the Cytoscape software to display genes putatively interacting in each module. Transcription factor genes were predicted using iTAK (http://itak.feilab.net/cgi-bin/itak/index.cgi).

Full-length gene cloning and sequencing

The sequence of Citrus sinensis PHT4;2 (CsPHT4;2, Cs6g07670) was obtained by BLASTing Citrus sinensis database in Phytozome (https://phytozome.jgi.doe.gov/pz/portal.html) with Arabidopsis thaliana PHT4;2 (At2g38060). Primers for full-length cloning of PHT4;2 were designed with Primer Premier 5. The sequences are 5′ CGGGATCCATGTCCGTTGC 3′ (forward primer) and 5′ GGGGTACCCTAGAAGACTCGTTCTC 3′ (reverse primer). BamHI and KpnI sites were included in forward and reverse primers, respectively. PCR was performed using High-Fidelity PCR Master kit (Roche, Switzerland) and general cloning procedures were followed. Sequences for both alleles were obtained by sequencing at least ten recombinant plasmids for each gene. Nucleotide and amino acid sequences were aligned with the ClustalX.

Transient over-expression in citrus juice vesicle-derived calli

Full-length CsPHT4;2 was cloned into PGreenII-SK to generate PGreenII-SK-PHT4;2 and transformed into Agrobacterium GV1301. Juice vesicle-derived calli were cut into 1 cm3 cubes, soaked in Agrobacterium at a concentration of A600 = 0.75, vacuumed for 20 min, briefly dried on sterilized filter paper, and transferred to Murashige and Tucker medium (Murashige and Tucker 1969) supplemented with 10% (w/v) sucrose, 1% (w/v) agar, and 100 μM acetosyringone. The calli were then incubated in darkness at 22 °C for 60 h and then frozen in liquid nitrogen and stored at − 70 °C for further analysis. Three biological replicates were designed with every eight cubes serving as a replicate.

Results

Biosynthesis inhibitors altered carotenoid composition in in vitro cultured ‘Newhall’ flesh tissues

Three carotenoid biosynthesis inhibitors, DXS inhibitor CLO, PDS inhibitor NFZ, and cyclase inhibitor CPTA, were applied to in vitro cultured ‘Newhall’ flesh tissues, which generated tissues with deficiency in total carotenoids, over-accumulation of phytoene, and over-accumulation of lycopene, respectively. The sites of action of these inhibitors are indicated in Fig. 1.

After culture for 30 days, an albino phenotype was observed in NFZ-treated tissues, and to a lesser extent, in tissues treated with CLO. In contrast, the CPTA-treated tissues became deep red (Fig. 2a). The colors of tissues following treatments with the three inhibitors matched the measurements of colored carotenoids they contained, rather than total carotenoids. Lycopene accounted for 66% of total carotenoids in CPTA-treated tissues, producing a deep red color (Fig. 2a, b). NFZ-treated tissues accumulated around 50 times more carotenoids than the control; however, colored carotenoids were barely detected, accounting for less than 1% of total carotenoids (Fig. 2b). Both total carotenoids and colored ones were reduced following CLO treatment, to 22 and 12%, respectively, which resulted in a pale yellow color (Fig. 2a, b). All three inhibitors, to different extents, reduced the accumulation of xanthophylls, especially cis-violaxanthin and violaxanthin which were the predominant carotenoids in control tissue (Fig. 2b).
Fig. 2

Effects of carotenoid biosynthesis inhibitor treatments. a Appearance of ‘Newhall’ juice vesicles at 30 days. b Carotenoid content of ‘Newhall’ juice vesicles at 30 days. The bars represent SE of three biological replicates. Data marked with asterisk indicate P < 0.05. CLO clomazone, CPTA 2-(4-chlorophenylthio)-triethylamine hydrochloride, NFZ norflurazon

Biosynthesis inhibitors affected chromoplast ultrastructure in in vitro cultured ‘Newhall’ flesh tissues

The ultrastructure of chromoplasts was differentially altered following 30 day culture of ‘Newhall’ flesh tissues in the medium containing three different biosynthesis inhibitors. Larger chromoplasts with bigger plastoglobules were observed under TEM in NFZ-treated (colored carotenoid-deficient) juice vesicles (Fig. 3), while the chromoplasts were similar in size to controls in CLO treated (total carotenoids reduced) tissues. Chromoplasts around four times the size of those from the control were observed in CPTA-treated (higher lycopene) tissues and these chromoplasts had a different shape, crystalline shape with undulating internal membrane system normally associated with the deposition of crystalline lycopene rather than the globular shape of the control (Fig. 3).
Fig. 3

Ultrastructure of chromoplasts in ‘Newhall’ juice vesicle at 30 days following carotenoid biosynthesis inhibitor treatments. CLO clomazone, CPTA 2-(4-chlorophenylthio)-triethylamine hydrochloride, NFZ norflurazon, PG plastoglobules, UM undulating membrane

Overview of transcriptome analysis

Transcriptome analysis was carried out with control and the three inhibitor treatments, with three biological replicates for each treatment, to gain information about the underlying changes in gene expression related to the observed alterations in carotenoid accumulation and chromoplast development. A total of 12 cDNA libraries were constructed and over 7 G clean bases were generated from high-throughput sequencing (Suppl. Table S1). The Q30 percentages were over 88% and over 80% of total reads were perfectly mapped to the reference genome sequence (Suppl. Table S1), indicating that the quality of the expression data is sufficient for further analysis.

Expression of carotenogenic genes affected by inhibitor treatments

Expression profiling of carotenogenic genes, including those involved in the upstream 2-C-methyl-d-erythritol 4-phosphate (MEP) pathway, the central biosynthetic pathway, and the downstream degradation pathway, showed that transcript levels of some carotenogenic genes were affected by inhibitor treatments (Table 1). Expression of 1-deoxy-d-xylulose 5-phosphate synthase 1 (DXS1), the main DXS member expressed in citrus fruit, was up-regulated 1.51-fold following CPTA treatment, but was not affected following NFZ treatment. The expression of hydroxymethylbutenyl 4-diphosphate reductase (HDR) was quite low as compared with other carotenogenic genes, but significantly up-regulated, by 1.27- and 1.68-fold, respectively, following NFZ and CPTA treatments, which was associated with increased amounts of total carotenoids (Table 1). However, expression of PSY1, the main PSY member expressed in fruit, was not affected by any of three inhibitors. Interestingly, the expression of chromoplast-specific lycopene β-cyclase (CYCB), the main expressed cyclase gene which is responsible for lycopene cyclization, was reduced following the application of the cyclization inhibitor CPTA, whereas its expression was unaffected by the other two inhibitors. Expression of some downstream genes, including zeaxanthin epoxidase (ZEP), neoxanthin synthase (NSY), and nine-cis-epoxycarotenoid dioxygenase/carotenoid cleavage dioxygenase (NCED/CCDs), was also reduced following the application of inhibitors (Table 1).
Table 1

Expression profiles of carotenoid metabolic genes in in vitro cultured ‘Newhall’ juice vesicles treated by carotenoid biosynthesis inhibitors. The values are means of three biological replicates from RNA-Seq. Genes with FPKM below one are not listed

Gene

FPKM

log2(fold change)

CLO

NFZ

CPTA

CsDXS1

50.23

0.42

0.00

1.33

CsDXS2

6.95

0.20

− 0.64

− 0.87

CsDXS3

14.02

0.40

− 0.09

0.43

CsDXR

124.03

0.09

0.08

0.80

CsDXR-like

2.67

− 0.04

− 0.86

− 0.28

CsCMS

11.42

0.32

− 0.38

0.23

CsCMK

34.50

0.08

0.09

− 0.17

CsMCS

58.56

− 0.07

− 0.01

0.06

CsHDS

297.02

0.17

0.43

− 0.10

CsHDR

3.48

− 0.43

1.18

1.42

CsIDI

255.22

0.23

− 0.14

0.16

CsGGPS

35.82

− 0.02

0.04

− 0.94

CsGGR

34.74

0.03

0.08

− 0.17

CsPSY1

84.33

− 0.13

− 0.49

− 0.39

CsPSY2

2.13

− 0.35

0.13

0.74

CsPDS

36.84

0.18

0.23

− 0.73

CsZISO

13.66

0.38

0.08

− 0.25

CsZDS

48.54

0.56

− 0.06

− 0.70

CsCrtISO

14.60

0.39

0.09

− 0.35

CsLCYE

2.75

0.03

0.14

0.25

CsCYP97A3

16.28

− 0.05

− 0.10

− 0.81

CsCYP97C1

13.87

0.05

− 0.45

− 0.27

CsCYCB

192.28

− 0.30

− 0.14

− 1.36

CsLCYB

5.24

0.23

− 0.46

− 0.08

CsBCH

630.01

− 0.31

− 0.39

− 0.78

CsZEP

60.99

− 0.15

− 0.37

− 1.02

CsNSY

79.44

− 0.72

0.01

− 2.46

CsVDE

2.83

0.50

− 0.19

0.60

CsCCD1

123.36

0.24

0.06

− 0.18

CsNCED3

5.24

− 1.12

− 1.19

− 0.05

CsNCED2/NCED5

108.50

0.62

− 1.88

− 1.46

CsCCD4a

9.10

0.24

− 0.15

− 1.16

CsCCD4b1

17.04

− 1.60

− 4.13

− 4.32

The FPKM values for control sample are listed in first column. Gene expression in inhibitor-treated samples was compared to control sample and indicated with the value of log2(foldchange). The threshold is set at one. The values in bold represent for up- or down-regulated genes. The abbreviations are same as listed in caption of Fig. 1

Expression of chromoplast development-associated genes affected by inhibitor treatments

Since the carotenoid inhibitors affected chromoplast development, their effects on the expression of some plastid development-associated genes were evaluated using the RNA-seq data. Expression of sweet orange high pigment (hp) and orange (Or) homologous to tomato high pigment 1 (hp1), high pigment 2 (hp2), and cauliflower orange (Or) was examined, but no difference was observed in their transcripts between three inhibitor treatments and the control (Table 2). The enzyme encoded by the high pigment 3 mutation in tomato is ZEP (Galpaz et al. 2008). As described before, expression of sweet orange ZEP was down-regulated (to 49%) by CPTA treatment (Tables 1, 2).
Table 2

Expression profiles of plastid development-associated genes in in vitro cultured ‘Newhall’ juice vesicles treated by carotenoid biosynthesis inhibitors

Gene

FPKM

log2(foldchange)

CLO

NFZ

CPTA

CsFBN1

359.74

0.03

0.33

0.02

CsFBN2

10.49

0.18

− 0.01

− 0.38

CsFBN3a

22.12

− 0.29

0.02

− 1.33

CsFBN3b

9.10

− 0.01

− 0.48

− 0.74

CsFBN4

33.50

− 0.12

− 0.08

− 0.58

CsFBN5

3.19

0.13

− 0.45

− 1.60

CsFBN6

26.89

− 0.38

− 0.80

− 0.94

CsFBN7a

60.09

0.11

0.30

− 0.53

CsFBN8

3.90

0.46

− 0.51

0.07

CsFBN9

4.67

0.22

0.78

− 0.81

CsFBN10

0.80

0.10

− 0.07

− 0.87

CsFBN11

6.39

0.16

2.20

1.67

CsFBN-like

2.39

− 0.32

− 0.82

− 0.63

CsHP1

28.89

0.28

0.03

− 0.04

CsHP2

10.59

0.03

− 0.03

− 0.25

CsHP3(ZEP)

60.99

− 0.15

− 0.37

− 1.02

CsOR

69.79

− 0.01

− 0.05

− 0.33

The values are means of three biological replicates from RNA-seq. Genes with FPKM below one are not listed. The FPKM values for control sample are listed in first column. Gene expression in inhibitor-treated samples was compared to control sample and indicated with the value of log2(foldchange). The threshold is set at one. The values in bold represent for up- or down-regulated genes

CLO clomazone, CPTA 2-(4-chlorophenylthio)-triethylamine hydrochloride, FBN fibrillin, FPKM fragments per kilobase of transcript sequence per millions base pairs, NFZ norflurazon

Fibrillin (FBN), also referred as PAP or CHRC, is widely reported to be related to carotenoid sequestration. FBNs are encoded by a gene family in plants and 14 members have been reported in Arabidopsis (van Wijk and Kessler 2017). BLASTing with these Arabidopsis FBNs, 13 FBN members were identified in sweet orange, with FBN1 and FBN2 sequences most closely clustered with carotenoid sequestration-associated FBNs from other plants (Suppl. Fig. S1). However, expression of these two FBNs was not significantly affected by inhibitors (Table 2), while transcripts of FBN11 were increased 3.59 and 2.18-fold by NFZ and CPTA treatments, respectively (Table 2). The Citrus sinensis FBN11 (CsFBN11) is not in the clade with previously recognized carotenoid sequestration-associated FBNs, and the function of the highest homologous member in Arabidopsis, AtFBN11, is not clear. However, AtFBN11 has been reported as encoding a protein with the highest molecular mass among all FBN members (76 kDa vs. 25–45 kDa) (van Wijk and Kessler 2017). Similarly, the CsFBN11 detected here has the longest coding sequence of all FBN members (666 amino acids vs. 222–400 amino acids) (Suppl. Table S2).

Weighted correlation network analysis (WGCNA)

To explore additional novel genes involved in modulation of carotenoid accumulation by inhibitors, weighted correlation network analysis (WGCNA), also known as weighted gene co-expression network analysis, was carried out. A co-expression network was constructed with 15 modules, and genes within each module possessed a similar expression pattern and had a high correlation coefficient with each other. Several representative modules were selected for further analysis of the module–trait relationship.

Of these modules, the Green module had the highest correlation coefficient (0.49) with CPTA treatment characterized as high-lycopene accumulation (Fig. 4). A total of 150 genes were included in this module, and the number of genes was reduced to 20 after setting a threshold of average expression at 1000 readcounts and that of FPKM at 15 in control group (Suppl. Table S3). Among these, an anion transporter gene was identified as homologous to ClPHT4;2, a chromoplast phosphate transporter required for watermelon flesh coloring (Citrullus lanatus) (Zhang et al. 2017). This gene was named Citrus sinensis phosphate transporter 4;2 (CsPHT4;2). In Arabidopsis, PHT4;2 is one of the six members of PHT4 family (Guo et al. 2008b). BLASTing with these Arabidopsis PHT4 s, six PHT4 members were identified in sweet orange (Suppl. Fig. S2). Among them, the transcript level of CsPHT4;2 increased 1.18-fold after CPTA treatment, decreased by 49% in NFZ treatment, and was not significantly affected by CLO treatment (Table 3).
Fig. 4

WGCNA of RNA-seq data from in vitro cultured ‘Newhall’ juice vesicles treated by carotenoid biosynthesis inhibitors. a Hierarchical cluster tree showing 15 modules of co-expressed genes. b Heatmap of correlations to each module representing relevance from module to treatment. The color scale on the top shows module–trait correlations from low (green) to high (red). CLO clomazone, CPTA 2-(4-chlorophenylthio)-triethylamine hydrochloride, NFZ norflurazon, WGCNA weighted correlation network analysis

Table 3

Expression of sweet orange PHT4 family members in in vitro cultured ‘Newhall’ juice vesicles treated by carotenoid biosynthesis inhibitors

Gene

FPKM

log2(foldchange)

CLO

NFZ

CPTA

CsPHT4;1

5.05

0.00

− 0.51

− 0.25

CsPHT4;2

25.75

0.21

− 0.99

1.13

CsPHT4;3

15.38

0.36

0.04

0.49

CsPHT4;4

1.65

0.03

− 0.76

− 0.66

CsPHT4;5

5.09

0.54

− 0.11

− 0.42

CsPHT4;6

6.42

− 0.03

0.27

− 0.02

The values are means of three biological replicates from RNA-seq. Genes with FPKM below one are not listed. The FPKM values for control sample are listed in first column. Gene expression in inhibitor-treated samples was compared to control sample and indicated with the value of log2(foldchange). The threshold is set at one. The underlined values in bold represent for up-regulated genes

CLO clomazone, CPTA 2-(4-chlorophenylthio)-triethylamine hydrochloride, FPKM fragments per kilobase of transcript sequence per millions base pairs, NFZ norflurazon, PHT phosphate transporter

For exploring putative transcription factors regulating CsPHT4;2 expression, genes in the Green module were ordered by degree value (genes with a higher degree value indicates a higher possibility of being a regulatory gene in scale-free network) from high to low (Suppl. Table S4), and then further analyzed using iTAK. As a result, seven transcription factors genes directly interacting with CsPHT4;2 were identified (Fig. 5, Suppl. Table S4). Five of them, i.e., WRKY, TRANSPARENT TESTA, heat shock transcription factor, and two NAC-like, had a higher degree than that of CsPHT4;2 and were predicted as putative modulators of CsPHT4;2 expression (Fig. 5, Suppl. Table S4).
Fig. 5

Co-expression network in Green module, where CsPHT4;2 presented. Co-expression network was visualized by the Cytoscape software with parameters setting as below: degree value was represented by nod size; clustering coefficient value was represented by nod color with orange indicating high value and blue indicating low value; weight value was represented by line thickness between nods. Genes directly interacted with CsPHT4;2 were in red square frame. Predicted transcription factors were in black oval frame. PHT phosphate transporter

Transient over-expression of CsPHT4;2 significantly enhanced carotenoid accumulation in citrus juice vesicle-derived calli

To test its role in enhancing carotenoid expression, full-length cDNAs of CsPHT4;2 were amplified from ‘Newhall’. Two alleles with nine nucleotide sequence differences and three amino acid sequence differences were observed (Suppl. Fig. S3). Transient over-expression of both CsPHT4;2 alleles in ‘Newhall’ juice vesicle-derived calli enhanced accumulation of total carotenoids, by around 80%, predominantly by increasing violaxanthin and cis-violaxanthin (Fig. 6a, b; CsPHT4;2-N samples). This suggests that both alleles are functional with similar efficiency. Lycopene was not detected in over-expressing ‘Newhall’ calli. The effects of transient over-expression of CsPHT4;2 were much more significant when the assay was carried out with juice vesicle-derived calli from a high-lycopene orange mutant ‘Cara Cara’, where the total carotenoids accumulated to an over tenfold higher concentration than in the control infected with empty vector (Fig. 6b; CsPHT4;2-C samples). The carotenoids accumulated were mainly colorless phytoene and phytofluene. However, lycopene, accounting for around 2–3% of total carotenoids was also observed in transient over-expressing ‘Cara Cara’ calli but not in control (Fig. 6b).
Fig. 6

Overview of transient over-expressing CsPHT4;2 alleles in juice vesicle-derived calli of ‘Newhall’ and ‘Cara Cara’. a Picture of ‘Newhall’ and ‘Cara Cara’ calli after infection for 60 h. b Carotenoid content in ‘Newhall’ and ‘Cara Cara’ calli transiently over-expressing CsPHT4;2. The bars represent SE of three biological replicates. Data marked with asterisk indicate P < 0.05. N and C stands for Newhall and Cara Cara, respectively. PHT phosphate transporter

Discussion

Altered expression of carotenogenic genes in response to blocking carotenoid biosynthetic pathway

CLO, NFZ, and CPTA are common carotenoid biosynthesis inhibitors applied both in industry as herbicides and in fundamental plant biological studies. Changes in carotenoid composition in response to their application have been reported frequently and the enzymic targets have been identified (Al-Babili et al. 1999; Mueller et al. 2000; Breitenbach et al. 2001). However, there is very little information about whether the expression of genes in the carotenoid pathway is also affected and contributes to these carotenoid changes in citrus juice vesicles. In this study with in vitro cultured citrus juice vesicles, it was observed that application of NFZ and CPTA disturbed the expression of several genes in either upstream or downstream sections of the pathway, including induced expression of CsDXS1 by CPTA and CsHDR by both NFZ and CPTA, as well as reduced expression of CsCYCB, CsZEP, CsNSY by CPTA and reductions in several NCED/CCDs by all three inhibitors (Table 1). In other plants, it has been reported that DXS and HDR play key roles in production of isoprenoid precursors as well as carotenoids (Lois et al. 2000; Botella-Pavía et al. 2004). Therefore, the induced expression of CsDXS1 and CsHDR might be responsible for the high accumulation of carotenoids following CPTA and NFZ treatments.

PSY catalyzes the first committed step in the carotenoid biosynthetic pathway and is recognized as the rate-limiting enzyme for plant carotenoid biosynthesis (Nisar et al. 2015). However, in the present study, no significant change in CsPSY1 expression was observed following all three inhibitor treatments, and no enhanced expression of any other PSY member was detected. This is different from the data reported in daffodil flowers, where CPTA-induced expression of PSY was observed (Al-Babili et al. 1999). Similarly, in Arabidopsis, when the PDS step was blocked in the pds3 mutant, expression of both downstream genes including ZDS and lycopene cyclase and also several upstream ones such as DXS, IDI, GGPS, and PSY were affected (Qin et al. 2007). In tomato, silencing of PDS via VIGS remarkably induced the expression of ZISO (Fantini et al. 2013), but in citrus in the present study, of all upstream genes, only expression of CsHDR was affected. Thus, the effects of blocking a specific step in the pathway, either chemically by biosynthetic inhibitors or biologically via mutation or genetic transformation, on carotenogenic gene expression vary in different cases, possibly because of the different plant species or tissues used.

Altered expression of other carotenogenic genes has also been demonstrated as a result of stimulating expression of a particular gene in the pathway and such alteration is also related to genetic background and tissue type. Over-expression of CrtI, a bacterial gene encoding phytoene desaturase, increased the expression of lycopene cyclases, which led to increased accumulation of β-carotene and lutein in tomato fruit (Enfissi et al. 2017). Interestingly, the individual cyclase gene affected varied among different genetic backgrounds, e.g., expression of CYCB was stimulated following over-expression of CrtI in tangerine mutant (t3183), but LCYB was the one affected in AC and Ogc tomatoes (Enfissi et al. 2017). Over-expression of Arabidopsis PDS in tomato stimulated expression of other carotenogenic genes and the individual gene(s) affected varied among different tissues (McQuinn et al. 2018). The expression of DXS, PSY, LCYB1 and BCH1 was stimulated in leaf, but in flower, only expression of ZISO was stimulated, and the expression of LCYB1 was even slightly reduced (McQuinn et al. 2018).

In summary, expression of some other carotenogenic genes can be perturbed when a specific biosynthesis step in the pathway is blocked or stimulated, either chemically by inhibitors or biologically via natural mutation or genetic transformation, but the individual genes whose expression is affected vary in different species and plant tissues. The precise mechanism(s) responsible for such perturbations are unknown, and there is a possibility that disturbing production of some downstream products may have a feedback or feedforward effect. This assumption can be supported by the fact that blocking carotene cyclization by CPTA resulted in accumulation of not only lycopene but upstream intermediates phytofluene and phytoene as well (Fig. 2). Moreover, the potential role of carotenoid oxygenation products and other MEP intermediates was postulated (Enfissi et al. 2017) and it was reported recently that cis-carotenoid metabolites produced in the tangerine tomato mutant possess an ability to regulate PSY1 expression by feedback (Kachanovsky et al. 2012).

Altered chromoplast development as an adaptation to changed carotenoid production

The relationship between plastid differentiation and carotenoid accumulation has long been studied using mutants and transgenic lines. Several key genes related to chromoplast development have been identified, such as UV-damaged DNA binding protein 1 (DDB1, mutated in hp1) and Deetiolated1 (DET1, mutated in hp2) for tomato. It is also well-established that stimulated chromoplast development can promote carotenoid accumulation (Cookson et al. 2003; Kolotilin et al. 2007).

On the other hand, more and more evidence is accumulating suggesting that altered carotenoid accumulation can affect chromoplast development as well. Over-expressing PSY1 in tomato promoted plastid differentiation which resulted in chromoplast-like structures arising at a premature stage (Fraser et al. 2007). Similarly, over-expression of CrtB, a bacterial PSY, promoted formation of carotenoid crystal in Arabidopsis and carrot roots (Maass et al. 2009). Promoting accumulation of non-endogenous ketocarotenoids in transgenic Nicotiana glauca leaf resulted in significant changes in ultrastructure of plastids, such as increased number but reduced size of plastoglobules (Mortimer et al. 2017). There are also some evidences from mutant studies, for example, the hp3 tomato mutant shows increased plastid number, and the mutated gene, ZEP, is a carotenogenic gene, and not directly involved in plastid division. Interestingly, the Orange (Or) gene responsible for high β-carotene accumulation and occurrence of chromoplasts with unique flattened sheets in a cauliflower mutant was previously predicted to encode a protein involved in plastid development (Lu et al. 2006); however, it was recently become clear that Or functions as a post-transcriptional regulator for enhancing stability and enzymatical activity of PSY protein (Welsch et al. 2018). In the present study, altered carotenoid accumulation in citrus affected chromoplast development as well, since inhibitors resulted in accumulation of specific carotenoids which led to specific changes in chromoplast structure (Figs. 2, 3). Therefore, chromoplast development can be regulated as part of the adaption to altered carotenoid production in various plants.

The genes involved in chromoplast development in response to altered accumulation of specific carotenoids are unknown. It has been reported that high carotenoid accumulation is accompanied by high abundance of FBN protein in high pigment (hp) tomatoes and CrtB + CrtI overexpressed tomato (Kilambi et al. 2013; Nogueira et al. 2013) and low FBN protein abundance is found in green-fruited tomatoes (Solanum habrochaites) with low total carotenoid contents (Kilambi et al. 2017). It has been suggested that FBNs may assist in the sequestration and stabilization of carotenoids (Kilambi et al. 2013). In the present work, when the expression of CsFBNs following inhibitor treatments was analyzed, it was found that CsFBN11 is the only member in the family with expression up-regulated in both NFZ- and CPTA-treated juice vesicle tissues containing high amount of total carotenoids (Table 2). It is unclear whether the specific function of CsFBN11 is related to its unique higher molecular mass and further investigation is required to answer this question.

Role of a candidate regulator: CsPHT4;2 in elevated accumulation of carotenoids

Inorganic phosphate is an important nutrient for plant growth and development, and phosphate transport between cells and cell compartments are implemented by carriers called phosphate transporters (PHTs). Plant PHTs can be classified into four families according to protein sequence similarities and sub-cellular localization (Guo et al. 2008a, b). PHTs participate in various plant growth and development processes due to the importance of phosphate. However, involvement of a PHT4 member, ClPHT4;2, in modulating carotenoid accumulation has only recently been reported, in watermelon (Zhang et al. 2017).

Here, in citrus, we also observed the role of CsPHT4;2 in promoting carotenoid accumulation to over ten times the control level. The promotive effect was on total amount rather than on a specific carotenoid, since the percentage of each carotenoid in the total content was not obviously affected following transient over-expression of CsPHT4;2 in calli of both cultivars (Fig. 6b). The effect was much stronger with calli of ‘Cara Cara’, a lycopene-accumulating sweet orange mutant (Xu et al. 2006), and as a result, all five predominant carotenoids, including carotenes lycopene, phytoene and phytofluene as well as xanthophylls 9-cis-violaxanthin and violaxanthin, increased to a similar extent (Fig. 6b). All these data support the involvement and importance of CsPHT4;2 in promoting carotenoid accumulation, and this is in agreement with the findings in watermelon that ClPHT4;2 is required for modulating carotenoid biosynthesis (Zhang et al. 2017). The mechanism of action, whereby PHT4;2 regulates carotenoid accumulation, is unclear and additional studies on carotenogenic gene expression or post-transcriptional regulation are needed to address this question. The fact that only CsPHT4;2 is significantly up-regulated in the lycopene accumulation group among all PHT4 members suggests that this gene may be of particular importance (Table 3).

Not only does CsPHT4;2 exert an effect on carotenoid production, but interestingly, the converse is true and altered carotenoid production can affect CsPHT4;2 expression. This mutual interaction may have a great potential in modulating carotenoid accumulation, but many details need to be clarified. For example, the expression of CsPHT4;2 was induced following CPTA treatment, which promoted lycopene accumulation (Fig. 4), but not following NFZ treatment which promoted phytoene and phytofluene accumulation (Fig. 4), suggesting that the enhanced expression of CsPHT4;2 was specifically related to high lycopene.

In conclusion, carotenoid accumulation and chromoplast development are both perturbed by carotenoid inhibitor treatments. There are multiple mutual interactions that occur in both directions, affecting gene expression, product accumulation, and plastid structure. Data from transcriptomic analysis as well as transient expression assay suggest that CsPHT4;2 participates in this process and may be important for metabolic regulation.

Author contribution statement

PL and CX designed the research. PL and SW performed the experiments; PL, DG, and CX analyzed the data and wrote the manuscript. All of the authors read and approved the final manuscript.

Notes

Acknowledgements

This work was supported by the National Key Research and Development Program of China (2016YFD0400100) and the 111 project (B17039).

Compliance with ethical standards

Conflict of interest

The authors declare that they have no conflicts of interest.

Supplementary material

425_2018_2970_MOESM1_ESM.jpg (3 mb)
Supplementary material 1 (JPEG 3056 kb)
425_2018_2970_MOESM2_ESM.jpg (1.7 mb)
Supplementary material 2 (JPEG 1722 kb)
425_2018_2970_MOESM3_ESM.jpg (4.9 mb)
Supplementary material 3 (JPEG 4999 kb)
425_2018_2970_MOESM4_ESM.xlsx (10 kb)
Supplementary material 4 (XLSX 10 kb)
425_2018_2970_MOESM5_ESM.xlsx (9 kb)
Supplementary material 5 (XLSX 9 kb)
425_2018_2970_MOESM6_ESM.xlsx (131 kb)
Supplementary material 6 (XLSX 130 kb)
425_2018_2970_MOESM7_ESM.xlsx (117 kb)
Supplementary material 7 (XLSX 116 kb)

References

  1. Al-Babili S, Hartung W, Kleinig H, Beyer P (1999) CPTA modulates levels of carotenogenic proteins and their mRNAs and affects carotenoid and ABA content as well as chromoplast structure in Narcissus pseudonarcissus flowers. Plant Biol 1:607–612.  https://doi.org/10.1111/j.1438-8677.1999.tb00270.x CrossRefGoogle Scholar
  2. Botella-Pavía P, Besumbes O, Phillips M, Carretero-Paulet L, Boronat A, Rodríguez-Concepción M (2004) Regulation of carotenoid biosynthesis in plants: evidence for a key role of hydroxymethylbutenyl diphosphate reductase in controlling the supply of plastidial isoprenoid precursors. Plant J 40:188–199.  https://doi.org/10.1111/j.1365-313X.2004.02198.x CrossRefPubMedGoogle Scholar
  3. Breitenbach J, Zhu C, Sandmann G (2001) Bleaching herbicide norflurazon inhibits phytoene desaturase by competition with the cofactors. J Agric Food Chem 49:5270–5272CrossRefPubMedGoogle Scholar
  4. Chen Y, Li FQ, Wurtzel ET (2010) Isolation and characterization of the Z-ISO gene encoding a missing component of carotenoid biosynthesis in plants. Plant Physiol 153:66–79.  https://doi.org/10.1104/pp.110.153916 CrossRefPubMedPubMedCentralGoogle Scholar
  5. Chiu CJ, Taylor A (2007) Nutritional antioxidants and age-related cataract and maculopathy. Exp Eye Res 84:229–245.  https://doi.org/10.1016/j.exer.2006.05.015 CrossRefPubMedGoogle Scholar
  6. Coggins C, Henning G, Yokoyama H (1970) Lycopene accumulation induced by 2-(4-chlorophenylthio)-triethylamine hydrochloride. Science 168:1589–1590CrossRefPubMedGoogle Scholar
  7. Cookson PJ, Kiano JW, Shipton CA, Fraser PD, Romer S, Schuch W et al (2003) Increases in cell elongation, plastid compartment size and phytoene synthase activity underlie the phenotype of the high pigment-1 mutant of tomato. Planta 217:896–903.  https://doi.org/10.1007/s00425-003-1065-9 CrossRefPubMedGoogle Scholar
  8. Enfissi E, Nogueira M, Bramley PM, Fraser PD (2017) The regulation of carotenoid formation in tomato fruit. Plant J 89:774–788.  https://doi.org/10.1111/tpj.13428 CrossRefPubMedGoogle Scholar
  9. Fantini E, Falcone G, Frusciante S, Giliberto L, Giuliano G (2013) Dissection of tomato lycopene biosynthesis through virus-induced gene silencing. Plant Physiol 163:986–998.  https://doi.org/10.1104/pp.113.224733 CrossRefPubMedPubMedCentralGoogle Scholar
  10. Ford NA, Erdman JW Jr (2012) Are lycopene metabolites metabolically active? Acta Biochim Pol 59:1–4CrossRefPubMedGoogle Scholar
  11. Fraser PD, Bramley PM (2004) The biosynthesis and nutritional uses of carotenoids. Prog Lipid Res 43:228–265.  https://doi.org/10.1016/j.plipres.2003.10.002 CrossRefGoogle Scholar
  12. Fraser PD, Enfissi EM, Halket JM, Truesdale MR, Yu D, Gerrish C et al (2007) Manipulation of phytoene levels in tomato fruit: effects on isoprenoids, plastids, and intermediary metabolism. Plant Cell 19:3194–3211.  https://doi.org/10.1105/tpc.106.049817 CrossRefPubMedPubMedCentralGoogle Scholar
  13. Fu XM, Kong WB, Peng G, Zhou JY, Azam M, Xu CJ et al (2012) Plastid structure and carotenogenic gene expression in red- and white-fleshed loquat (Eriobotrya japonica) fruits. J Exp Bot 63:341–354.  https://doi.org/10.1093/jxb/err284 CrossRefPubMedGoogle Scholar
  14. Galpaz N, Wang Q, Menda N, Zamir D, Hirschberg J (2008) Abscisic acid deficiency in the tomato mutant high-pigment 3 leading to increased plastid number and higher fruit lycopene content. Plant J 53:717–730.  https://doi.org/10.1111/j.1365-313X.2007.03362.x CrossRefGoogle Scholar
  15. Guo B, Irigoyen S, Fowler TB, Versaw WK (2008a) Differential expression and phylogenetic analysis suggest specialization of plastid-localized members of the PHT4 phosphate transporter family for photosynthetic and heterotrophic tissues. Plant Signal Behav 3:784–790.  https://doi.org/10.4161/psb.3.10.6666 CrossRefPubMedPubMedCentralGoogle Scholar
  16. Guo B, Jin Y, Wussler C, Blancaflor EB, Motes CM, Versaw WK (2008b) Functional analysis of the Arabidopsis PHT4 family of intracellular phosphate transporters. New Phytol 177:889–898.  https://doi.org/10.1111/j.1469-8137.2007.02331.x CrossRefPubMedGoogle Scholar
  17. Irigoyen S, Karlsson PM, Kuruvilla J, Spetea C, Versaw WK (2011) The sink-specific plastidic phosphate transporter PHT4; 2 influences starch accumulation and leaf size in Arabidopsis. Plant Physiol 157:1765–1777.  https://doi.org/10.1104/pp.111.181925 CrossRefPubMedPubMedCentralGoogle Scholar
  18. Kachanovsky DE, Filler S, Isaacson T, Hirschberg J (2012) Epistasis in tomato color mutations involves regulation of phytoene synthase 1 expression by cis-carotenoids. Proc Natl Acad Sci USA 109:19021–19026.  https://doi.org/10.1073/pnas.1214808109 CrossRefPubMedGoogle Scholar
  19. Kilambi HV, Kumar R, Sharma R, Sreelakshmi Y (2013) Chromoplast-specific carotenoid-associated protein appears to be important for enhanced accumulation of carotenoids in hp1 tomato fruits. Plant Physiol 161:2085–2101.  https://doi.org/10.1104/pp.112.212191 CrossRefPubMedPubMedCentralGoogle Scholar
  20. Kilambi H, Manda K, Rai A, Charakana C, Bagri J, Sharma R et al (2017) Green-fruited Solanum habrochaites lacks fruit-specific carotenogenesis due to metabolic and structural blocks. J Exp Bot 68:4803–4819.  https://doi.org/10.1093/jxb/erx288 CrossRefPubMedPubMedCentralGoogle Scholar
  21. Kolotilin I, Koltai H, Tadmor Y, Bar-Or C, Reuveni M, Meir A et al (2007) Transcriptional profiling of high pigment-2 dg tomato mutant links early fruit plastid biogenesis with its overproduction of phytonutrients. Plant Physiol 145:389–401.  https://doi.org/10.1104/pp.107.102962 CrossRefPubMedPubMedCentralGoogle Scholar
  22. La Rocca N, Rascio N, Oster U, Rudiger W (2007) Inhibition of lycopene cyclase results in accumulation of chlorophyll precursors. Planta 225:1019–1029.  https://doi.org/10.1007/s00425-006-0409-7 CrossRefPubMedGoogle Scholar
  23. Lange BM, Ketchum RE, Croteau RB (2001) Isoprenoid biosynthesis. Metabolite profiling of peppermint oil gland secretory cells and application to herbicide target analysis. Plant Physiol 127:305–314CrossRefPubMedPubMedCentralGoogle Scholar
  24. Langfelder P, Horvath S (2008) WGCNA: an R package for weighted correlation network analysis. BMC Bioinform 9:559.  https://doi.org/10.1186/1471-2105-9-559 CrossRefGoogle Scholar
  25. Leitner-Dagan Y, Ovadis M, Shklarman E, Elad Y, Rav David D, Vainstein A (2006) Expression and functional analyses of the plastid lipid-associated protein CHRC suggest its role in chromoplastogenesis and stress. Plant Physiol 142:233–244.  https://doi.org/10.1104/pp.106.082404 CrossRefPubMedPubMedCentralGoogle Scholar
  26. Lieberman M, Segev O, Gilboa N, Lalazar A, Levin I (2004) The tomato homolog of the gene encoding UV-damaged DNA binding protein 1 (DDB1) underlined as the gene that causes the high pigment-1 mutant phenotype. Theor Appl Genet 108:1574–1581.  https://doi.org/10.1007/s00122-004-1584-1 CrossRefPubMedGoogle Scholar
  27. Liu LH, Shao ZY, Zhang M, Wang QM (2015) Regulation of carotenoid metabolism in tomato. Mol Plant 8:28–39.  https://doi.org/10.1016/j.molp.2014.11.006 CrossRefGoogle Scholar
  28. Lois L, Rodríguez-Concepción M, Gallego F, Campos N, Boronat A (2000) Carotenoid biosynthesis during tomato fruit development: regulatory role of 1-deoxy-d-xylulose 5-phosphate synthase. Plant J 22:503–513CrossRefGoogle Scholar
  29. Lu S, Van Eck J, Zhou X, Lopez AB, O’Halloran DM, Cosman KM et al (2006) The cauliflower Or gene encodes a DnaJ cysteine-rich domain-containing protein that mediates high levels of beta-carotene accumulation. Plant Cell 18:3594–3605.  https://doi.org/10.1105/tpc.106.046417 CrossRefPubMedPubMedCentralGoogle Scholar
  30. Lu YP, Liu SY, Sun H, Wu XM, Li JJ, Zhu L (2010) Neuroprotective effect of astaxanthin on H2O2-induced neurotoxicity in vitro and on focal cerebral ischemia in vivo. Brain Res 1360:40–48.  https://doi.org/10.1016/j.brainres.2010.09.016 CrossRefPubMedGoogle Scholar
  31. Lu PJ, Wang CY, Yin TT, Zhong SL, Grierson D, Chen KS et al (2017) Cytological and molecular characterization of carotenoid accumulation in normal and high-lycopene mutant oranges. Sci Rep 7:761.  https://doi.org/10.1038/s41598-017-00898-y CrossRefPubMedPubMedCentralGoogle Scholar
  32. Maass D, Arango J, Wüst F, Beyer P, Welsch R (2009) Carotenoid crystal formation in Arabidopsis and carrot roots caused by increased phytoene synthase protein levels. PLoS One 4:e6373.  https://doi.org/10.1371/journal.pone.0006373 CrossRefPubMedPubMedCentralGoogle Scholar
  33. McQuinn RP, Wong B, Giovannoni JJ (2018) AtPDS overexpression in tomato: exposing unique patterns of carotenoid self-regulation and an alternative strategy for the enhancement of fruit carotenoid content. Plant Biotechnol J 16:482–494.  https://doi.org/10.1111/pbi.12789 CrossRefPubMedGoogle Scholar
  34. Mortimer CL, Misawa N, Perez-Fons L, Robertson FP, Harada H, Bramley PM, Fraser PD (2017) The formation and sequestration of nonendogenous ketocarotenoids in transgenic Nicotiana glauca. Plant Physiol 173:1617–1635.  https://doi.org/10.1104/pp.16.01297 CrossRefPubMedPubMedCentralGoogle Scholar
  35. Mueller C, Schwender J, Zeidler J, Lichtenthaler H (2000) Properties and inhibition of the first two enzymes of the non-mevalonate pathway of isoprenoid biosynthesis. Biochem Soc Trans 28:792–793CrossRefPubMedGoogle Scholar
  36. Murashige T, Tucker DPH (1969) Growth factor requirements of Citrus tissue culture. Proc First Int Citrus Symp 3:1155–1161Google Scholar
  37. Mustilli AC, Fenzi F, Ciliento R, Alfano F, Bowler C (1999) Phenotype of the tomato high pigment-2 mutant is caused by a mutation in the tomato homolog of DEETIOLATED1. Plant Cell 11:145–157.  https://doi.org/10.1105/tpc.11.2.145 CrossRefPubMedPubMedCentralGoogle Scholar
  38. Neuman H, Galpaz N, Cunningham FX, Zamir D, Hirschberg J (2014) The tomato mutation nxd1 reveals a gene necessary for neoxanthin biosynthesis and demonstrates that violaxanthin is a sufficient precursor for abscisic acid biosynthesis. Plant J 78:80–93.  https://doi.org/10.1111/tpj.12451 CrossRefPubMedGoogle Scholar
  39. Nisar N, Li L, Lu S, Khin NC, Pogson BJ (2015) Carotenoid metabolism in plants. Mol Plant 8:8–82.  https://doi.org/10.1016/j.molp.2014.12.007 CrossRefGoogle Scholar
  40. Nogueira M, Mora L, Enfissi EM, Bramley PM, Fraser PD (2013) Subchromoplast sequestration of carotenoids affects regulatory mechanisms in tomato lines expressing different carotenoid gene combinations. Plant Cell 25:4560–4579.  https://doi.org/10.1105/tpc.113.116210 CrossRefPubMedPubMedCentralGoogle Scholar
  41. Paolillo DJ Jr, Garvin DF, Parthasarathy MV (2004) The chromoplasts of Or mutants of cauliflower (Brassica oleracea L. var. botrytis). Protoplasma 224:245–253.  https://doi.org/10.1007/s00709-004-0059-1 CrossRefPubMedGoogle Scholar
  42. Qin G, Gu H, Ma L, Peng Y, Deng XW, Chen Z et al (2007) Disruption of phytoene desaturase gene results in albino and dwarf phenotypes in Arabidopsis by impairing chlorophyll, carotenoid, and gibberellin biosynthesis. Cell Res 17:471–482.  https://doi.org/10.1038/cr.2007.40 CrossRefGoogle Scholar
  43. Ralley L, Schuch W, Fraser PD, Bramley PM (2016) Genetic modification of tomato with the tobacco lycopene β-cyclase gene produces high β-carotene and lycopene fruit. Z Naturforschung 71:295–301.  https://doi.org/10.1515/znc-2016-0102 CrossRefGoogle Scholar
  44. Rey P, Gillet B, Römer S, Eymery F, Massimino J, Peltier G et al (2000) Over-expression of a pepper plastid lipid-associated protein in tobacco leads to changes in plastid ultrastructure and plant development upon stress. Plant J 21:483–494.  https://doi.org/10.1046/j.1365-313x.2000.00699.x CrossRefPubMedGoogle Scholar
  45. Rodríguez-Villalón A, Gas E, Rodríguez-Concepción M (2009) Phytoene synthase activity controls the biosynthesis of carotenoids and the supply of their metabolic precursors in dark-grown Arabidopsis seedlings. Plant J 60:424–435.  https://doi.org/10.1111/j.1365-313X.2009.03966.x CrossRefPubMedGoogle Scholar
  46. Simkin AJ, Gaffé J, Alcaraz JP, Carde JP, Bramley PM, Fraser PD et al (2007) Fibrillin influence on plastid ultrastructure and pigment content in tomato fruit. Phytochemistry 68:1545–1556.  https://doi.org/10.1016/j.phytochem.2007.03.014 CrossRefPubMedGoogle Scholar
  47. Singh DK, Maximova SN, Jensen PJ, Lehman BL, Ngugi HK, McNellis TW (2010) FIBRILLIN4 is required for plastoglobule development and stress resistance in apple and Arabidopsis. Plant Physiol 154:1281–1293.  https://doi.org/10.1104/pp.110.164095 CrossRefPubMedPubMedCentralGoogle Scholar
  48. Srinivasan R, Babu S, Gothandam KM (2017) Accumulation of phytoene, a colorless carotenoid by inhibition of phytoene desaturase (PDS) gene in Dunaliella salina V-101. Bioresour Technol 242:311–318.  https://doi.org/10.1016/j.biortech.2017.03.042 CrossRefGoogle Scholar
  49. van Wijk KJ, Kessler F (2017) Plastoglobuli: plastid microcompartments with integrated functions in metabolism, plastid developmental transitions, and environmental adaptation. Annu Rev Plant Biol 68:253–289.  https://doi.org/10.1146/annurev-arplant-043015-111737 CrossRefPubMedGoogle Scholar
  50. Walter MH, Strack D (2011) Carotenoids and their cleavage products: biosynthesis and functions. Nat Prod Rep 28:663–692.  https://doi.org/10.1039/c0np00036a CrossRefGoogle Scholar
  51. Welsch R, Zhou X, Yuan H, Alvarez D, Sun T, Schlossarek D et al (2018) Clp protease and OR directly control the proteostasis of phytoene synthase, the crucial enzyme for carotenoid biosynthesis in Arabidopsis. Mol Plant 11:149–162.  https://doi.org/10.1016/j.molp.2017.11.003 CrossRefGoogle Scholar
  52. Xu CJ, Fraser PD, Wang WJ, Bramley PM (2006) Differences in the carotenoid content of ordinary citrus and lycopene-accumulating mutants. J Agric Food Chem 54:5474–5481.  https://doi.org/10.1021/jf060702t CrossRefPubMedGoogle Scholar
  53. Yuan H, Zhang J, Nageswaran D, Li L (2015) Carotenoid metabolism and regulation in horticultural crops. Hortic Res 2:15036.  https://doi.org/10.1038/hortres.2015.36 CrossRefPubMedPubMedCentralGoogle Scholar
  54. Zhang LC, Ma G, Kato M, Yamawaki K, Takagi T, Kiriiwa Y et al (2012) Regulation of carotenoid accumulation and the expression of carotenoid metabolic genes in citrus juice sacs in vitro. J Exp Bot 63:871–886.  https://doi.org/10.1093/jxb/err318 CrossRefPubMedGoogle Scholar
  55. Zhang J, Guo SG, Ren Y, Zhang HY, Gong GY, Zhou M et al (2017) High-level expression of a novel chromoplast phosphate transporter ClPHT4;2 is required for flesh color development in watermelon. New Phytol 213:1208–1221.  https://doi.org/10.1111/nph.14257 CrossRefPubMedGoogle Scholar
  56. Zhou XJ, Welsch R, Yang Y, Álvarez D, Riediger M, Yuan H et al (2015) Arabidopsis OR proteins are the major posttranscriptional regulators of phytoene synthase in controlling carotenoid biosynthesis. Proc Natl Acad Sci USA 112:3558–3563.  https://doi.org/10.1073/pnas.1420831112 CrossRefGoogle Scholar
  57. Zhu CF, Bai C, Sanahuja G, Yuan D, Farre G, Naqvi S et al (2010) The regulation of carotenoid pigmentation in flowers. Arch Biochem Biophys 504:132–141.  https://doi.org/10.1016/j.abb.2010.07.028 CrossRefPubMedGoogle Scholar

Copyright information

© Springer-Verlag GmbH Germany, part of Springer Nature 2018

Authors and Affiliations

  1. 1.Zhejiang Provincial Key Laboratory of Horticultural Plant Integrative BiologyZhejiang UniversityHangzhouChina
  2. 2.Division of Plant and Crop Sciences, School of BiosciencesUniversity of NottinghamSutton BoningtonUK

Personalised recommendations