Conservation Genetics
© Springer Science+Business Media B.V. 2008
10.1007/s10592-008-9571-8

Twenty-one novel tri- and tetranucleotide microsatellite loci for the Amur tiger (Panthera tigris altaica)

Jian-Hui Wu1, 2, 3, Yan-Le Lei1, 2, 3, Sheng-Guo Fang1, 2, 3 and Qiu-Hong Wan1, 2, 3  
(1)
College of Life Sciences, Zhejiang University, Hangzhou, 310058, P.R. China
(2)
State Conservation Center for Gene Resources of Endangered Wildlife, Zhejiang University, Hangzhou, 310058, P.R. China
(3)
Key Laboratory of Conservation Genetics and Reproductive Biology for Endangered Wild Animals of the Ministry of Education, Zhejiang University, Hangzhou, 310058, P.R. China
 
 
Qiu-Hong Wan
Received: 11 March 2008Accepted: 20 March 2008Published online: 26 March 2008
Abstract
Amur tiger is the largest subspecies of tiger in the world and his conservation has also received much attention. In this study, we isolated and characterized twenty-one tri- and tetranucleotide microsatellite markers from this species. The number of alleles for each locus ranged from two to nine in a group of 60 individuals and the observed and expected heterozygosities were 0.333–0.917 and 0.302–0.822, respectively. The overall discrimination power and exclusion probabilities in parentage and paternity testing for these markers were 1.00, 0.9947 and 0.9999, respectively, indicating high-resolution power of microsatellite markers.
Keywords
Amur tiger Microsatellite Polymorphic Exclusionary power
Amur Tiger (Panthera tigris altaica), the largest living cat in the world, lives in the Russian Far East in the Amur-Ussuri region of Primorski and Khabarovski Krais (States) whilst a few are found in northeast of China and Korea (http://​www.​savethetigerfund​.​org). In the last half-century we have lost three subspecies of them. The Bali tiger went extinct in the 1940’s, followed by the Caspian tiger in the 1970’s and the Javan tiger in the 1980’s. It is also likely that we have lost the South China tiger in the wild and only a few individuals of this subspecies remain in captivity (Tilson et al. 2004). There are about 400 Amur tigers in the wild but less than 20 wild individuals exist in China (Wang 1998). Therefore, developing polymorphic microsatellites is essential for genetic examination of the Amur tiger and thus promotes his conservation. Microsatellites have been proved to be a reliable marker for conservation genetics (Zhang and Hewitt 2003;Wan et al. 2004). In this study, we isolated 21 novel microsatellite loci for Panthera tigris altaica.
A total of 60 blood samples were collected from Xiongsen Bear and Tiger Village, one of which was used for microsatellite development. Genomic DNA was extracted using a conventional protocol (Sambrook and Russell 2001). Microsatellite enrichment followed the protocols of Fischer and Bachmann (1998) and Bloor et al. (2001) with some modifications. A 400–1,200 bp Sau3A I-restricted fraction was recovered and ligated to linkers Sau3A I-F (5′-GCG GTA CCC GGG AAG CTT GG 3′) and Sau3A I-R (5′-GAT CCC AAG CTT CCC GGG TAC CGC 3′). The ligated fragments were amplified using Sau3A I-F as forward and reverse primers in a 20 μl reaction system composed of 1 μl of template DNA (30–50 ng/μl), 1 U Taq DNA polymerase (TaKaRa), 2 μl of 10 × PCR buffer (TaKaRa), 1.6 μl of 25 mM MgCl2, 2 μl of 20 mM dNTPs, 1 μl of primer (Sau3A I-F). PCR conditions were as follows: 94°C for 5 min, then 30 cycles of 94°C for 30 s, 60°C for 45 s, 72°C for 90 s, and a final period at 72°C for 10 min. The PCR products were hybridized to biotin-labeled probes by incubation 6–8 h at the optimized temperature and then streptavidin-coated magnetic beads (Roche) were added to capture the target fragment with microsatellite repeats. The eluted fragments were cloned into pMD 18-T vector (TaKaRa) and transformed into JM109 Competent Cells (TaKaRa). Recombinant clones were screened by amplification directly from bacterial colonies, using Sau3A I-F and corresponding probe sequence as forward and reverse primers, respectively. Positive colonies were sequenced on automated ABI 3700 DNA sequencer. Primier version 5.0 was used to design primers for the clones containing microsatellite sequences.
A 5′-M13 tail (5′-CAC GAC GTT GTA AAA CGA C) was added to the forward primer of each primer pair to allow fluorescent labeling during amplification reactions. PCR amplification were performed in a 10 μl volume for all primers, which contains 1 μl of 20 mM dNTPs, 1 μl of 10 × PCR buffer (TaKaRa), 1 μl template of DNA (about 10 ng/μl), 0.8 μl of 25 mM MgCl2, 0.5 U Taq DNA polymerase (TaKaRa), 0.4 μl of each 10 μM primer and 1 μl of 1 μM IRD labeled M13 primer (LI-COR). PCR amplification were conducted as: 94°C for 5 min, 30 cycles of 94°C for 30 s, 40 s at optimized primer-specific annealing temperature (Table 1), 72°C for 45 s, and followed by a final 7 min extension at 72°C. The PCR products were loaded on LI-COR 4200 automated DNA Sequencer.
Table 1
Twenty-one polymorphic microsatellite loci from the Amur tiger
Locus
Repeat motif
Primer sequence (5′–3′)
T a (°C)
Product size (bp)
Accession No. (GenBank)
Pati01
(TGC)8
F: ATGTTCAAAGTCACTGGGAGG
57.7
169–199
EU416173
R: AGGCTGCGTGGTTCTGG
Pati02
(AGC)13
F: TCCGAAGTCTGTCCTGTT
53.0
145–154
EU416174
R: AGTTGGGAATGCTGCTC
Pati03
(TGC)12
F: AAGCCAGTAATCATCCAACC
49.5
170–176
EU416175
R: CCAGCCTCTTCATCACCA
Pati04
(AGC)15
F: CCCCAAACTAAGAACATC
53.0
207–216
EU416176
R: TCCAGAGCCTTGAAAA
Pati05
(AGC)11
F: TAGTGGCTAATACCTTGTGG
47.0
224–233
EU416177
R: TGGAAGTCCTGGTGAAAT
Pati06
(TGC)15
F: GACTACTGGGCCTCACTC
53.9
228–246
EU416178
R: GAAATCTGTTGGCTTCTAAT
Pati07
(AGC)8
F: TCTCATCATTCCTTCCCATTA
53.0
250–253
EU416179
R: AGACTCTTCACTCGCCTCC
Pati08
(CAG)16
F: AGTCCACGCCAGACCAGAAA
53.8
284–293
EU416180
R: TCGGCAGCAATATCATCCAG
Pati09
(TGC)11
F: AGCCAATCATCCAATCAAA
47.0
110–125
EU416181
R: CAAGGACAGGAGCCAGTTA
Pati10
(GCA)11
F: AGATGCCATGCACTGTTT
53.8
144–159
EU416182
R: TCTACGCAATCCCTTACC
Pati11
(AGC)7AGA(AGC)5
F: AGCAGGGCAGAGCAAG
58.0
253–356
EU416183
R: GAGAACAGGGAGGTGGA
Pati12
(GCA)13
F: TCCGAAGTCTGTCCTGTTG
47.0
144–153
EU416184
R: AAGTTGGGAATGCTGCTC
Pati13
(CTG)10
F: CCACCCTCTGTGCCTTCT
49.5
237–240
EU416185
R: TAGCCCGCTTCACCTCA
Pati14
(GCT)8
F: ATTTAGCCTCTTGCAGTTTAG
47.0
166–178
EU416186
R: GATTTGCCACATCATTTCTC
Pati15
(CTT)20
F: AACCTTCCTGCAAAACAAA
50.7
200–224
EU416187
R: ACTCCAAAGCCCAAACTCT
Pati16
(AGAT)5(GATA)13
F: CTGCCTGGAGTTGATGGG
51.0
243–263
EU416188
R: ACGCTGGAGAAATACACCTGA
Pati17
(GATA)12
F: GACAAGATTATCAAGGAAC
49.0
170–186
EU416189
R: GCTTAGAGTCTGCTCAAG
Pati18
(CAGA)6CAT(ATAG)11
F: TGTTTGGCTATAACCATT
48.0
202–226
EU416190
R: AACCCAGTGTCTCCTTGT
Pati19
(AGAT)5(GATA)14
F: CCTGCCTGGAGTTGATGG
52.0
245–265
EU416191
R: ACGCTGGAGAAATACACCTGA
Pati20
(GATA)10
F: TTAACAATGCAACATACAG
51.0
247–279
EU416192
R: TTTTCACCTTCCTTCG
Pati21
(TCTG)3(TCTA)9(TCTG)4
F: GGGCAAATACACTAACCA
54.7
300–324
EU416193
R: CTCCTGCTAGAATCTCCAA
T a is the annealing temperature
The SAGAGT version 3.2 (LI-COR) was used to perform genotyping. Cervus version 2.0 (Marshall et al. 1998) was adopted to calculate the number of alleles, the observed and expected heterozygosities, mean polymorphic information content (PIC) and probability of exclusion (PE). Deviations from Hardy–Weinberg equilibrium and linkage disequilibrium were analyzed using web-based GENEPOP 4.0 (Raymond and Rousset 1995). The discrimination power (DP) of each microsatellite locus and the cumulative DP (CDP) of a set of microosatellite loci were calculated as described by Kloosterman et al. (1993).
Approximately 4,000 colonies were screened and a total of 200 recombinants that potentially contained microsatellite sequences were obtained. We randomly chose 107 colonies for sequencing and 86 ones contained repeat sequences. Seventy primer pairs were designed, of which 50 dyads succeeded in PCR amplification and yielded specific PCR products. Finally, we got 21 pairs of polymorphic primers (Table 1).
The number of alleles per locus ranged from 2 (locus Pati07) to 9 (locus Pati15) with an average of 4.62, presenting a moderate PIC value of 0.546 (Table 2). The observed and expected heterozygosities of these microsatellites ranged from 0.333 to 0.917 (average = 0.605) and from 0.302 to 0.822 (average = 0.608), respectively, indicating a relatively high level of genetic diversity in the Amur tiger. The loci Pati16 and Pati19 showed significant deviation from Hardy–Weinberg equilibrium (P < 0.001). Furthermore, both of them presented lower observed heterozygosity (H O) than expected (H E) (Table 1), probably suggesting existence of inbreeding (Genlous and Björn 2003). Five of the pairwise comparisons among loci (Pati04–Pati08, Pati02–Pati12, Pati05–Pati13 and Pati16–Pati19) exhibited significant linkage disequilibrium (P < 0.001; Table 2). These loci showed their overall values of DP, PE-1 (for parentage testing) and PE-2 (for paternity testing) were 1.00, 0.9947 and 0.9999, respectively (Table 2), indicating high-resolution power of these microsatellite loci. As a result, this set of polymorphic microsatellite loci would provide a powerful tool for the population genetic studies of the Amur tiger. Furthermore, these markers could serve as potential source of microsatellites for other tiger subspecies in the future.
Table 2
The values of the number of alleles per locus (N A), the observed and expected heterozygosities (H O and H E), polymorphism information content (PIC), discrimination power (DP) and probability of exclusion (PE-1 and PE-2) for the 21 microsatellite loci in the Amur tiger
Locus
N A
H O
H E
PIC
DP
Excl-1
Excl-2
Pati01
5
0.617
0.728
0.672
0.869
0.299
0.471
Pati02
4
0.567
0.507
0.438
0.653
0.129
0.257
Pati03
3
0.717
0.661
0.581
0.776
0.215
0.361
Pati04
4
0.667
0.621
0.542
0.771
0.200
0.342
Pati05
4
0.417
0.540
0.491
0.726
0.153
0.309
Pati06
6
0.717
0.684
0.626
0.837
0.261
0.429
Pati07
2
0.467
0.477
0.361
0.613
0.112
0.181
Pati08
4
0.717
0.655
0.585
0.794
0.228
0.382
Pati09
5
0.583
0.683
0.641
0.833
0.274
0.456
Pati10
4
0.633
0.610
0.540
0.746
0.186
0.335
Pati11
3
0.533
0.493
0.385
0.613
0.120
0.201
Pati12
4
0.567
0.507
0.438
0.653
0.129
0.257
Pati13
2
0.333
0.302
0.255
0.466
0.045
0.127
Pati14
4
0.550
0.528
0.469
0.692
0.141
0.284
Pati15
9
0.833
0.768
0.723
0.880
0.366
0.542
Pati16*
5
0.367
0.585
0.542
0.749
0.187
0.358
Pati17
4
0.667
0.628
0.557
0.784
0.203
0.353
Pati18
7
0.833
0.822
0.789
0.918
0.456
0.632
Pati19*
5
0.350
0.586
0.543
0.748
0.188
0.359
Pati20
5
0.650
0.592
0.536
0.761
0.187
0.346
Pati21
6
0.917
0.799
0.759
0.887
0.406
0.585
Mean
4.52
0.605
0.608
    
Overall
   
0.546
1.000
0.9947
0.9999
* Significant deviation from Hardy Weinberg equilibrium (P < 0.001)
Acknowledgements
We thank Xiongsen Bear and Tiger Village of Guilin in China for providing all samples. This work was supported by a special grant from the state forestry administration of China (No. 2005-4-C04).
References
Bloor PA, Barker FS, Watts PC, Noyes HA, Kemp SJ (2001) Microsatellite libraries by enrichment. http://​www.​liv.​ac.​uk/​~kempsj/​genomics.​html
Fischer D, Bachmann K (1998) Microsatellite enrichment in organisms with large genomes (Allium cepa L). Biotechniques 24:796–802PubMed
Genlous S, Björn S (2003) Microsatellite variability and heterozygote deficiency in the arctic-alpine Alaskan wheatgrass (Elymus alaskanus) complex. Genome 46:729–737CrossRef
Kloosterman AD, Budowle B, Daselaar P (1993) PCR-amplification and detection of the human DIS80 VNTR locus. Amplification conditions, population genetics and application in forensic analysis. Int J Legal Med 105:257–264PubMedCrossRef
Marshall TC, Slate J, Kruuk LEB, Pemberton JM (1998) Statistical confidence for likelihood-based paternity inference in natural populations. Mol Ecol 7:639–655PubMedCrossRef
Raymond M, Rousset F (1995) GENEPOP (version 1.2): population genetics software for exact tests and ecumenicism. J Heredity 86:248–249
Sambrook J, Russell DW (2001) Molecular cloning: a laboratory manual, 3rd edn. Cold Spring Harbor Laboratory Press, New York
Tilson R, Defu H, Muntifering J, Nyhus PJ (2004) Dramatic decline of wild South China tigers Panthera tigris amoyensis: Field survey of priority tiger reserves. Oryx 38:40–47CrossRef
Wan QH, Wu H, Fujihara T, Fang SG (2004) Which genetic marker for which conservation genetics issue? Electrophoresis 25:2165–2176PubMedCrossRef
Wang S (1998) China red data book of endangered animals. Science Press, Beijing
Zhang DX, Hewitt GM (2003) Nuclear DNA analyses in genetic studies of populations: practice, problems and prospects. Mol Ecol 12:563–584PubMedCrossRef